Application of ect2 gene in regulating poplar secondary xylem development

By overexpressing the ECT2 gene in poplar and utilizing the ECT2 protein to regulate RNA stability and translation, the lack of research on RNA-binding proteins in the development of secondary xylem in forest trees was addressed, resulting in a significant increase in the width of poplar secondary xylem. This has important value for forestry resource development and ecological restoration.

CN120330238BActive Publication Date: 2025-12-23BEIJING FORESTRY UNIVERSITY
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510446743.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-10
Publication Date
2025-12-23
Estimated Expiration
2045-04-10

AI Technical Summary

Technical Problem

In the current technology, there is limited research on the role of RNA-binding proteins in the development of secondary xylem in forest trees, which affects the regulatory effect on the development of secondary xylem in poplar trees.

Method used

By overexpressing the ECT2 gene in poplar through genetic transformation, the width of the secondary xylem in poplar is increased by utilizing the ECT2 protein to regulate RNA stability and translation.

Benefits of technology

It significantly increased the width of the secondary xylem of poplar trees, providing a promising application for improving the development of secondary xylem in plants, and has important value for forestry resource development and ecological restoration.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120330238B_ABST
    Figure CN120330238B_ABST
Patent Text Reader

Abstract

The application provides application of an ECT2 gene in regulation of development of a poplar secondary xylem. The application obtains a transgenic poplar overexpressing the ECT2 gene through genetic transformation, finds that overexpression of the ECT2 gene can increase the width of the poplar secondary xylem, and the nucleotide sequence of the ECT2 gene is shown as SEQ ID NO:1. The ECT2 gene has a regulation effect on the development of the secondary xylem of the poplar.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, and particularly relates to an application of an ECT2 gene in regulating development of a secondary xylem of a poplar. BACKGROUND

[0002] The poplar has the characteristics of fast growth, high-quality wood and disease resistance, etc., so it becomes an ideal choice for greening engineering and forest restoration plan. The poplar can quickly improve the environment, reduce soil erosion, and provide the function of wind and sand fixation, has good environmental adaptability, and is often used in land protection, river bank stabilization and soil and water conservation. The wood of the poplar is light and easy to process, so it is widely used in furniture manufacturing, papermaking and wood industry. The poplar not only occupies an important position in the national economy, but also plays an important role in ecological restoration and environmental protection.

[0003] Epigenetic modification refers to a chemical modification that affects gene expression or cell function without changing the DNA sequence. Epigenetic modification mainly includes DNA methylation, RNA modification and histone modification. In the field of biological research, more than 160 different types of RNA modification have been identified, including N1-methyladenosine, N6-methyladenosine, N7-methylguanosine, etc. N6-methyladenosine modification is one of the common RNA modifications, and RNA N6-methyladenosine modification is mainly regulated by methyltransferase, demethylase and binding protein, and plays an important role in RNA stability, translation and degradation. However, the research on RNA binding protein in forest trees is still relatively less. Therefore, it is of great significance to study the role of the protein in the development of the secondary xylem of the poplar. SUMMARY

[0004] The present application aims to at least solve one of the technical problems in the related art. The present application provides an application of an ECT2 gene in regulating development of a secondary xylem of a poplar. The present application obtains a transgenic poplar overexpressing the ECT2 gene through genetic transformation, finds that overexpression of the ECT2 gene can increase the width of the secondary xylem of the poplar, indicating that the ECT2 gene of the poplar has a regulatory effect on the development of the secondary xylem. The present application provides an important basis for sustainable forestry resource development, and has important value for forest cultivation and ecological restoration.

[0005] Specifically, the present application provides the following technical solutions:

[0006] The first aspect of the present application provides an application of an ECT2 gene in regulating development of a secondary xylem of a poplar, wherein the nucleotide sequence of the ECT2 gene is shown as SEQ ID NO: 1.

[0007] According to the embodiment of the present application, the amino acid sequence of the ECT2 protein encoded by the ECT2 gene is shown as SEQ ID NO: 2.

[0008] According to an embodiment of the present application, the application is achieved by overexpressing the ECT2 gene in the poplar, so that the width of the secondary xylem of the poplar stem is increased.

[0009] According to an embodiment of the present application, the poplar comprises a construct in vivo, and the construct comprises the ECT2 gene.

[0010] According to an embodiment of the present application, the poplar comprises a host cell in vivo, and the host cell comprises the ECT2 gene.

[0011] According to an embodiment of the present application, the overexpression is that the expression amount of the ECT2 gene is 3-6 times of the expression amount of the wild-type poplar ECT2 gene.

[0012] The second aspect of the present application provides a method for regulating the development of the secondary xylem of a plant, comprising:

[0013] introducing the ECT2 gene, or a construct comprising the ECT2 gene, or a host cell comprising the ECT2 gene into the plant in vivo;

[0014] selecting a plant overexpressing the ECT2 gene;

[0015] The nucleotide sequence of the ECT2 gene is shown in SEQ ID NO: 1.

[0016] The third aspect of the present application provides a transgenic plant comprising an ECT2 gene, or a construct comprising the ECT2 gene, or a host cell comprising the ECT2 gene.

[0017] The construct comprises the ECT2 gene, and the host cell comprises the ECT2 gene.

[0018] The ECT2 gene is overexpressed in the transgenic plant.

[0019] According to an embodiment of the present application, the transgenic plant comprises at least one of a poplar, a locust tree, a willow, a Paulownia fortune, a white ash, an Arabidopsis thaliana, a tobacco, a rice, a spinach, a celery, a lettuce, a calendula, a soybean, a corn, a sugarcane, a peanut, a potato, a tomato, a sorghum. According to a preferred embodiment, the transgenic plant is a poplar or an Arabidopsis thaliana. For example, it can be a 84k poplar. The 84k poplar is a deciduous tree belonging to the Populus of the Salicaceae family, which has many excellent properties, including rapid growth, strong disease resistance, wide adaptability, no flying pollen pollution, etc., and thus plays an important role in ecological improvement and urban greening.

[0020] The fourth aspect of the present application provides an application of an ECT2 gene or an ECT protein in regulating the development of the secondary xylem of a plant.

[0021] The nucleotide sequence of the ECT2 gene is shown as SEQ ID NO: 1.

[0022] The amino acid sequence of the ECT2 protein is shown as SEQ ID NO: 2.

[0023] The present application has at least the following beneficial effects:

[0024] The present application provides the application of poplar ECT2 gene in regulating the development of secondary xylem, which can be used to improve the development of secondary xylem of plants, and has a broad application prospect. BRIEF DESCRIPTION OF DRAWINGS

[0025] Figure 1 is the map result of the expression vector provided according to the embodiment of the present application.

[0026] Figure 2 is the relative expression amount result graph of the target gene of the transgenic poplar provided according to the embodiment of the present application.

[0027] Figure 3 is the semi-thin section graph of the secondary xylem of the transgenic poplar plant provided according to the embodiment of the present application.

[0028] Figure 4 is the width statistical graph of the secondary xylem of the transgenic poplar plant provided according to the embodiment of the present application. DETAILED DESCRIPTION

[0029] The embodiments of the present application are described in detail below, examples of which are shown in the accompanying drawings, the embodiments described below by referring to the drawings are exemplary and are intended to explain the present application, and cannot be understood as a limitation of the present application.

[0030] The mentioned ECT2 protein is mainly responsible for recognizing and binding RNA molecules containing N6-methyladenosine (m 6 A) modified RNA molecules, thereby regulating the stability, translation and nuclear output of these RNA. The ECT2 protein in poplar is an RNA binding protein related to m 6 A modification.

[0031] In poplar, ECT2 protein may be involved in a variety of biological functions. For example, YTHDF family proteins are known to promote mRNA translation and stability in mammals. ECT2 protein in poplar plays an important role in the development of secondary xylem, response to environmental stress and gene expression regulation.

[0032] The ECT2 gene described in the present application has the nucleotide sequence shown in SEQ ID NO: 1.

[0033] wherein the nucleotide sequence of SEQ ID NO: 1 is as follows:

[0034]

[0035] The amino acid sequence of the protein encoded by the gene is shown as SEQ ID NO. 2.

[0036] The amino acid sequence shown in SEQ ID NO: 2 is as follows:

[0037] MPEPTSKIQPSDRSVTPVLSNFMDPTVCYLPNGYQSYYYGGYNGAGEWDDYSKYLNPEGVDMVSGVYGDNGSAMYPHGYWYGPYSPYSPAASPVPTMGNDGQLYGPQHYQYPPPYFQPLTPSGEPFTPSHVAPSQGDLSISTATDQKPLPVETAKENSNGIANGVDVKGSNGAVPYKPKYQNSYGRGGFTKGLPASGYKDLKSRFDRLQPDSPLLDTSVLSSGLYKNTEISSSFSKAGNAPSSRNQNFHQNSHFMGWQHPALAPGVGSTHGYMNRMYPNKFYGQYGNGFKSGMGFGSGGYNAGINGHGWLAIDSKYKPKGRGNGYFGYHNDSIDGLNELNRGPRAKGYFKNQKGFVPATVAVKGQSVPSSDTNVEEKDKTTVVPDREQYNKADFPEEYDNAKFFIIKSYSEDDVHKCIKYNVWASTPNGNKKLDAAYQEAEQKSGGCPVFLLFSVNTSGQFVGLAEMTGRVDFDKSVEYWQQDKWTGYFPVKWHIVKDVPNSFLKHITLENNENKPVTNSRDTQEVKLEQGLKLIKIFKDHSSKTCILDDFVFYEDREKMIQEKKAKQQQLKKQVWDGKPCEEKKEIANGS (SEQ ID NO: 2)

[0038] The ECT2 gene can be overexpressed in a plant to regulate the development of the secondary xylem of the plant. The ECT2 gene can be introduced into a plant in the form of a construct. The construct can be a cloning vector such as a T vector, a lambda phage vector, a P1 phage vector, a cosmid vector, a bacterial artificial chromosome, a yeast artificial chromosome, pGEM-T, pUC18, or an expression vector such as an adenovirus vector, a retrovirus vector, or a plasmid vector. The plasmid vector can be a plant expression vector such as an expression vector selected from the group consisting of plant expression vectors pBIN19, pBI121, pBI221, pCAMBIA1300, pGreen, and the like. The type of vector can be selected according to actual needs. According to an embodiment of the present application, the construct is at least one of a plasmid, a virus, and a phage.

[0039] The ECT2 gene can be overexpressed in a plant to regulate the development of the secondary xylem of the plant. The plant includes a host cell, and the host cell contains the ECT2 gene. The host cell includes, but is not limited to, a plant cell, a bacterial cell, a yeast cell, or an insect cell.

[0040] The present application also provides a transgenic plant containing the ECT2 gene, or the construct described above, or the host cell described above.

[0041] The present application also provides a method for regulating the development of the secondary xylem of a plant, including: introducing the ECT2 gene, or the construct, or the host cell described above into the plant; and screening to obtain a plant overexpressing the ECT2 gene.

[0042] The overexpression or overexpression as mentioned refers to a phenomenon that the amount of a protein synthesized, accumulated, or released in a cell exceeds the normal level. In the present application, overexpression refers to a significant increase in the expression amount of the ECT2 gene in a transgenic plant compared to a wild-type plant (so that the expression amount of the ECT2 protein is significantly increased). According to a specific embodiment, the significant difference as mentioned can be p<0.05. According to a specific embodiment, in the present application, the overexpression as mentioned refers to that the expression amount of the ECT2 gene in a transgenic plant is 3-6 times the expression amount of a wild-type ECT2 gene.

[0043] The plant capable of overexpressing the ECT2 gene can be obtained by transforming a receptor plant cell with the isolated nucleic acid molecule as described above, for example, by an Agrobacterium-mediated method, a gene gun method, or the like, and allowing the receptor plant cell to differentiate to form a complete plant.

[0044] The mentioned plant secondary xylem development includes, but is not limited to, the width of the plant secondary xylem. According to a specific embodiment, the width of the secondary xylem of the plant overexpressing the ECT2 gene is at least 15% higher than that of the wild type plant, and according to a preferred embodiment, at least 20% higher.

[0045] The technical solutions of the present application are described below through specific embodiments. It should be noted that these embodiments are only used to facilitate the understanding of those skilled in the art and should not be regarded as a limitation on the protection scope of the present application. Unless otherwise specified, the reagents used in the embodiments can be obtained by commercial purchase.

[0046] Embodiment 1

[0047] In Embodiment 1, the gene sequence of ECT2 of poplar was obtained in a database, and the amplification primer was designed and analyzed according to the base sequence of the coding region, so as to amplify the gene. The gene sequence of ECT2 is shown as SEQ ID NO: 1, and the amino acid sequence of ECT2 protein is shown as SEQ ID NO: 2.

[0048] The extracted poplar leaf RNA is reverse transcribed, and then the obtained cDNA is used as a template to amplify the gene by using the method of PCR. The specific method is as follows:

[0049] (1) Extraction of total RNA of poplar leaves

[0050] The leaf of the poplar tissue culture seedling was taken and ground into powder under the liquid nitrogen environment for use. The total RNA was extracted by using the plant RNA rapid extraction kit (RN38-EASYspin Plus, manufacturer: Beijing Aidley Biotechnology Co., Ltd.).

[0051] (2) Synthesis of cDNA

[0052] 1) The reverse transcription mixed solution was configured according to the following system and placed in a 200 μL RNase free PCR tube; the specific system is shown in Table 1:

[0053] Table 1: Reverse transcription system

[0054] Component Amount Total RNA 50 ng - 5 μg Anchored oligo(dT)18 primer 1 μL 2 x TS Reaction Mix 10 μL TransScript RT / RI Enzyme Mix 1 μL gDNA Remover 1 μL Add nuclease-free water to 20 μL

[0055] 2) After being mixed thoroughly, it was incubated at 42℃ for 30 min;

[0056] 3) It was heated at 85℃ for 5 s to inactivate the TransScript RT / RI and gDNA Remover;

[0057] 4) The obtained cDNA needs to be stored at -20℃.

[0058] All reagents used in the reaction were purchased from Beijing Zison Bio-technology Co., Ltd.

[0059] (3) Amplification of the target gene

[0060] According to the above-mentioned gene sequence, the Snapgene software was used to design the full-length primer of the gene sequence SEQ ID NO: 3 and SEQ ID NO: 4:

[0061] F1: CCCTTTCATCTTCTGCTGACCAAAC (SEQ ID NO: 3)

[0062] R1: CCTGTTTCTTGAGCTGCTGTTG (SEQ ID NO: 4)

[0063] Then, the Populus cDNA sequence was used as a template, and the cDNA sequence of the target gene was obtained by amplification according to the following PCR reaction system; the reagents and amounts used below refer to the PrimeSTAR Max DNA Polymerase reagent instruction manual of Baorai Biotechnology (Beijing) Co., Ltd., and are shown in Table 2 below:

[0064] Table 2: PCR amplification system

[0065] Component Amount cDNA 1 μL Upstream primer 2 μL Downstream primer 2 μL PrimeSTAR Max Premix 50 μL Nuclease-free water 45 μL Total volume 100 μL

[0066] Then, the PCR reaction was carried out according to the following PCR reaction program:

[0067] Pre-denaturation: 98°C for 2 min;

[0068] (Denaturation: 98°C for 10 s, annealing: 56°C for 15 s, extension: 72°C for 1 min 30 s) x 35 cycles;

[0069] Extension: 72°C for 5 min; 16°C for incubation.

[0070] The amplified target gene sequence is shown as SEQ ID NO: 1.

[0071] Then, the PCT product was detected by agarose gel electrophoresis: 0.5 g of agarose was weighed and added to 50 mL of 1xTAE, and then 4 μL of GoldView (purchased from Zhongke Ruaitai Biotechnology Co., Ltd.) was added after microwave heating and shaking. After shaking, pour into the gel plate. After the agarose gel solidified, the mixture of the PCR product and the Loading buffer (purchased from Beijing Zison Bio-technology Co., Ltd.) was added to the gel well for electrophoresis detection, and the length of the recovered cDNA fragment was 1857 bp.

[0072] Example 2

[0073] Example 2 constructs an expression vector and introduces the expression vector into E. coli; specifically including:

[0074] (1) Design primers with Kpn I and Xba I restriction sites (SEQ ID NO: 5 and SEQ ID NO: 6), using the method of Reference Example 1, use SEQ ID NO: 5 and SEQ ID NO: 6 as primers to amplify the target gene with the restriction sites, and recover the PCR product.

[0075] F2: GAGAGGACAGGGTACCATGGCTACCCTTTCATCTTCTG (SEQ ID NO: 5)

[0076] R2: ACTGACAGAAAATTTCTAGATGAACCATTTGCTATCTCTTTCTTT (SEQ ID NO: 6)

[0077] (2) Construct the expression vector: use endonuclease Kpn I and Xba I to double enzyme cut (endonuclease Kpn I and Xba I are purchased from Baorui Biotechnology Beijing Co., Ltd.) the vector pCAMBIA2300 with the restriction sites. Then recover the product after enzyme cutting, and use homologous recombination enzyme (purchased from Beijing Jinsha Biological Science Co., Ltd.) to connect the target gene fragment and the expression vector, and the vector map is as shown in Figure 1 .

[0078] (3) Transform the ligation product into E. coli competent DH5a (purchased from Shanghai Weidi Biotechnology Co., Ltd.), then add 700 μL of LB culture solution without antibiotics, and place in a constant temperature shaker at 37°C, 220 rpm, recover for 30 min. Centrifuge the recovered E. coli at 4,000 rpm for 1 min, discard the excess supernatant, only leave 100 μL, mix well with a gun head, drop on LB solid medium containing 50 μg / mL Kan, and evenly spread with a sterile spreader. Invert the medium in a constant temperature incubator, culture at 37°C for 12-16 h. After the colonies grow, pick single colonies in 1 mL of LB liquid medium containing 50 μg / mL Kan, culture at 37°C for about 4 h, perform PCR on the picked single colony liquid, then perform gel electrophoresis identification, select the liquid with correct bands for sequencing, screen positive clones, obtain and extract plasmid using a kit (purchased from Beijing Quanshi Jin Biotechnology Co., Ltd.).

[0079] The preparation of LB liquid medium: 5 g of tryptone, 5 g of NaCl, 2.5 g of yeast extract, and ddH2O were weighed, respectively, and then the volume was made up to 500 mL. The mixture was sterilized in a high-pressure steam sterilization pot at 121°C for 20 min, and then cooled to room temperature.

[0080] The preparation of LB solid medium was similar to that of LB liquid medium, but 5 g of agar powder was added before the volume was made up. The mixture was sterilized in a high-pressure steam sterilization pot at 121°C for 20 min, and then cooled to room temperature.

[0081] (4) The constructed expression vector was introduced into Agrobacterium GV3101 by using a kit (purchased from Beijing Huayueyang Company), and Agrobacterium liquid containing the successfully introduced expression vector was obtained.

[0082] Example 3

[0083] In Example 3, the overexpression vector was introduced into the leaves of poplar by Agrobacterium-mediated genetic transformation. After a series of processes such as pre-culture, infection, dark culture, induction of adventitious buds, induction of bud rooting, propagation, and seedling culture, the plants were transplanted to a greenhouse.

[0084] (1) Leaf pre-culture: The 4th-6th leaves of aseptic tissue culture seedlings were cut, 4-5 horizontal cuts were made on the main veins of the lower surface of the leaves using a sterilized scalpel, and then the leaves were placed on the pre-culture medium with the lower surface facing up and cultured for 1-2 days. The culture surface was stored upside down.

[0085] The pre-culture medium was prepared as follows: MS powder 4.43 g / L, sucrose 30 g / L, agar 5 g / L, NAA 0.05 mg / L, and 6-BA 0.5 mg / L.

[0086] (2) Preparation of Agrobacterium infection solution: In a clean bench, 1000 μL of Agrobacterium containing the successfully introduced expression vector was added to 100 mL of LB liquid medium containing antibiotics (50 mg / L kanamycin and 50 mg / L rifampicin), and then mixed and placed in a 28°C, 180 rpm shaking incubator for overnight culture. When the OD600 value of the bacterial solution was 0.6-0.8, the infection transformation was performed.

[0087] (3) Infection and dark culture: In a clean bench, the pretreated leaves were soaked in the Agrobacterium solution for 10-15 min, and the solution was shaken every 3-5 min to ensure that the wounded parts of the leaves were in full contact with the solution. After 10-15 min, the leaves were taken out, the excess bacterial solution was absorbed with sterile filter paper, and then the leaves were placed on the dark culture medium with the lower surface facing up and cultured in the dark for 3-4 days.

[0088] The dark culture medium was prepared as follows: MS powder 4.43 g / L, sucrose 30 g / L, agar 5 g / L, NAA 0.05 mg / L, and 6-BA 0.5 mg / L.

[0089] (4) Inducing resistant adventitious buds: the leaves after dark treatment are transferred to differentiation medium in a clean bench, and cultured under the light cycle of 16h light / 8h dark and the temperature of 25°C. Adventitious buds will grow from the wound of the leaves in about 2 weeks.

[0090] The differentiation medium is formulated as follows: MS powder 4.43g / L, sucrose 30g / L, agar 5g / L, NAA 0.05mg / L, 6-BA 0.5mg / L, Kan 15-50mg / L and temik 0.2g / L.

[0091] (5) Rooting culture: single adventitious buds with the length of more than 1cm are placed in rooting medium to induce rooting and develop into complete plants.

[0092] The rooting medium is formulated as follows: MS powder 2.215g / L, sucrose 30g / L, agar 5g / L, NAA 0.02mg / L, IBA 0.05mg / L, Kan 15-25mg / L and temik 0.2g / L.

[0093] Greenhouse transplanting: the poplar seedlings grown in the culture bottles for 4-8 weeks are acclimated, and transplanted after 6-8 days of acclimation. The medium on the roots of the poplar seedlings is removed before transplanting into the transplanting nutrient soil and culturing in the greenhouse.

[0094] Example 4: Identification of transgenic poplar, gene expression analysis and detection of secondary xylem development related indexes

[0095] Example 4 identifies the transgenic poplar obtained in Example 3.

[0096] (1) In order to identify the transgenic poplar, a forward primer is designed according to the sequence of 35S promoter, and a reverse primer is designed according to the sequence of the gene. If the target gene is successfully transformed, the gene fragment can be amplified by PCR, and if not, it cannot be amplified.

[0097] The designed primers are as follows:

[0098] F3: CGCAAGACCCTTCCTCTATATAAGG (SEQ ID NO: 7),

[0099] R3: GAACCATTTGCTATCTCTTTCTTTTCTTCAC (SEQ ID NO: 8).

[0100] In a clean bench, the poplar leaves (transgenic poplar obtained in Example 3) were cut, and the genomic DNA was extracted using a plant genomic DNA rapid extraction kit (purchased from Beijing Aidley Biotechnology Co., Ltd.).

[0101] Then, the genomic DNA was used as a template to perform PCR amplification using primers F3 and R3 and 2x Taq Mix (purchased from Beijing Bomaide Biotechnology Co., Ltd.). The PCR product was subjected to agarose gel electrophoresis detection, and positive plants successfully transformed with the expression vector were identified.

[0102] The PCR reaction system and the reaction procedure were as follows:

[0103] Table 4 PCR reaction system

[0104] Genome DNA 1 μL Upstream primer 0.5 μL Downstream primer 0.5 μL 2 x Taq Mix 5 μL ddH2O 3 μL Total volume 10 μL

[0105] The PCR reaction procedure was as follows: 94°C for 10 min; (94°C for 20 s, 58°C for 30 s, and 72°C for 1 min) for a total of 35 cycles, followed by 72°C for 5 min.

[0106] (2) To further screen the transgenic lines and detect the relative expression amount of the target gene in each transgenic line, quantitative primers were designed, and the specific cDNA sequence in the sample was quantitatively analyzed using the real-time fluorescence quantitative PCR (Quantitative Real-time PCR) technology.

[0107] The primers were designed as follows:

[0108] F4: GGTTTCTGGGGTTTATGGGGA (SEQ ID NO: 9),

[0109] R4: AAAGATCGCCTTGGGAAGGG (SEQ ID NO: 10).

[0110] The qRT-PCR reaction system was as follows:

[0111] SYBR Master Mix 10 μL Upstream primer 0.5 μL Downstream primer 0.5 μL cDNA 1 μL ddH2O 8 μL Total volume 20 μL

[0112] The reaction procedure was as follows: 95°C for 5 min, (95°C for 10 s, 60°C for 10 s, and 72°C for 20 s) for a total of 45 cycles. The experiment was repeated three times, and the relative expression amount was calculated using the 2 -△△CT method.

[0113] The relative expression amount of the target gene is shown in Table 5. Figure 2 Figure 2 ​WT represents wild type poplar, and OE represents transgenic poplar overexpressing ECT2 gene. The results show that the relative expression of the gene in the transgenic poplar is greatly improved.

[0114] (3) Then the tissue culture seedlings grown for 4-8 weeks are transplanted to the greenhouse after hardening-off, and the stem thickness and the xylem development in the semi-thin section are observed after the seedlings grow for 2 months.

[0115] The results are shown in Figure 3 .

[0116] From the results of Figure 3 and Figure 4 , it can be seen that the secondary xylem width of the transgenic poplar is significantly increased compared with the secondary xylem width of the wild type (WT) poplar.

[0117] In the description of the present specification, the description referring to the terms "one embodiment", "some embodiments", "example", "specific embodiment", etc. means that the specific features, structures, materials or characteristics described in connection with the embodiment or example are contained in at least one embodiment or example of the present application. In the present specification, the illustrative description of the above terms does not necessarily refer to the same embodiment or example. Although the embodiments of the present application have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present application, and those skilled in the art can make changes, modifications, replacements and variations to the above embodiments within the scope of the present application.

Claims

1. A kind ECT2 The application of genes in regulating the development of secondary xylem width in poplar trees is characterized by, The ECT2 The nucleotide sequence of the gene is shown in SEQ ID NO:1; the application is achieved by using the... ECT2 Overexpression of the gene in poplar trees increases the width of the secondary xylem in the poplar stem.

2. The application according to claim 1, characterized in that, The poplar tree body includes a component, the component comprising the... ECT2 Gene.

3. The application according to claim 1, characterized in that, The poplar tree contains host cells, and the host cells include the... ECT2 Gene.

4. The application according to claim 1, characterized in that, The overexpression is the ECT2 The gene expression level is that of wild-type poplar. ECT2 3-6 times the gene expression level.

5. A method for increasing the width of secondary xylem in plants, characterized in that, include: Will ECT2 Genes, or constructs, or host cells are introduced into the plant, the constructs comprising the... ECT2 The gene, the host cell includes the gene ECT2 Gene; Screening to obtain overexpression ECT2 Genetically modified plants; The ECT2 The nucleotide sequence of the gene is shown in SEQ ID NO:1; The plant in question is a poplar.

6. Application of ECT protein in increasing the width of secondary xylem in plants, wherein the plant is poplar; The amino acid sequence of the ECT2 protein is shown in SEQ ID NO:2.

Citation Information

Patent Citations

  • CsECT protein related to plant disease resistance, recombinant vector and application of CsECT protein

    CN120058887A