Biomarker for detecting therapeutic effect of atrial septal defect and application thereof
By detecting the expression of GPNMB gene in serum, using the non-metastatic melanoma glycoprotein B gene as a biomarker, the discomfort and radiation effects of echocardiography were solved, and the rapid and accurate diagnosis of the treatment effect of atrial septal defect was achieved, and objective diagnostic standards were provided.
Patent Information
- Application Number
- CN202510501706.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-21
- Publication Date
- 2025-07-18
AI Technical Summary
Existing echocardiography methods have problems with discomfort, radiation effects and relying on physician experience when evaluating the treatment effect of atrial septal defects, making it difficult to achieve objective and accurate diagnosis.
The non-metastatic melanoma glycoprotein B gene (GPNMB) was used as a biomarker to quickly and objectively evaluate the therapeutic effect of atrial septal defect by detecting the expression level of GPNMB gene in serum and using technical methods such as qRT-PCR.
It realizes rapid and accurate diagnosis of the treatment effect of atrial septal defects, reduces radiation exposure and examination discomfort to patients, provides objective diagnostic standards, and reduces the risk of misdiagnosis and misdiagnosis.
Smart Images

Figure CN120330318A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biological medicine technology. More specifically, the present invention relates to a biomarker for detecting the treatment effect of atrial septal defect and its application. Background Art
[0002] Atrial septal defect (ASD) is one of the most common congenital heart diseases, which refers to the occurrence of an abnormal passage between the left and right atria and left-to-right shunt at the atrial level due to the underdevelopment of the atrial septum. ASD accounts for about 7-15% of pediatric congenital heart diseases and 25% of adult congenital heart diseases. If ASD is not treated for a long time, atrial arrhythmia, pulmonary hypertension, paradoxical embolism, congestive heart failure, etc. will occur, severely reducing the patient's lifespan. ASD can be divided into three types: secundum type, primum type, and sinus venosus type. Among them, secundum type ASD is mainly treated by transcatheter interventional occlusion, and the instrument used for intervention is an occluder. The nitinol metal occluder has become a commonly used occluder for interventional treatment of ASD due to its advantages such as less trauma, shorter hospital stay, and fewer complications. However, through long-term follow-up of ASD children who have received interventional metal occluders, it has been found that due to its non-degradable characteristics, the long-term retention of the nitinol metal occluder in the bodies of ASD children will cause a series of complications, such as heart valve damage, thrombus formation, nickel allergy, aortic atrial fistula, etc.
[0003] In order to solve the non-degradable disadvantage of the metal occluder, in recent years, a completely biodegradable occluder made mainly of poly-L-lactic acid (PLLA) has been successfully developed and put on the market. The PLLA biodegradable occluder has more advantages compared with the metal occluder. After being implanted into the human body, the PLLA biodegradable occluder can be gradually degraded into water and carbon dioxide and excreted with the human blood circulation. At the same time, the defect site is gradually repaired by the newly generated tissue. Under ideal circumstances, tissue repair and the degradation of the PLLA biodegradable occluder are completed simultaneously, and the ASD children are cured without the residue of the occluder in the body, making up for the disadvantage of the non-degradable residue caused by the implantation of the metal occluder into the human body. Clinical follow-up of children who have received PLLA occluders has not found serious complications, indicating its high biocompatibility, the ability to coexist safely with human tissues, and the hope to replace the traditional metal occluder as the mainstream occluder for treating ASD.
[0004] Currently, the evaluation of the treatment effect of ASD (i.e., tissue repair) is mainly through echocardiogram examination. However, for echocardiogram examination, the instrument needs to be inserted into the human body through the esophagus or chest cavity, which will cause discomfort to the human body. Transesophageal echocardiogram may also induce serious arrhythmia. If the patient has esophageal ulcers, this examination is not suitable. At the same time, echocardiogram examination releases radiation. Most ASD patients are relatively young, and the radiation released during the examination will have an adverse impact on their physical development. In addition, the accuracy of echocardiogram examination highly depends on the experience of the doctor. The diagnostic results have no objective criteria and are prone to misdiagnosis and missed diagnosis. Therefore, it would be very meaningful to detect the treatment effect of ASD through blood biomarkers. Summary of the Invention
[0005] Based on this, the purpose of the present invention is to provide a biomarker for detecting the treatment effect of atrial septal defect.
[0006] The specific technical solutions to achieve the above invention purpose are as follows.
[0007] In the first aspect of the present invention, there is provided the application of non-metastatic melanoma glycoprotein B gene as a biomarker in the preparation of a kit for detecting the treatment effect of atrial septal defect.
[0008] In the second aspect of the present invention, there is provided the application of a reagent for detecting the expression level of non-metastatic melanoma glycoprotein B gene in the preparation of a kit for detecting the treatment effect of atrial septal defect.
[0009] The inventors of the present invention first performed single-cell sequencing on the neonatal tissues at the 1st, 3rd, and 6th months after treating atrial septal defect in pigs with a occluder made mainly of PLLA, then conducted cell subset analysis, and combined with differential gene analysis. It was found that during the treatment of atrial septal defect in pigs, the expression of the non-metastatic melanoma glycoprotein B gene (GPNMB) in macrophages showed a pattern of first increasing and then decreasing, which was similar to the trend of the tissue damage repair process (divided into three stages: the inflammatory phase, the proliferative phase, and the remodeling phase. The inflammatory phase consists of the accumulation of inflammatory cells, the production of pro-inflammatory cytokines, and the phagocytosis of necrotic debris. The proliferative stage is characterized by cell proliferation, angiogenesis, and the production of collagen. The remodeling stage involves the maturation of the regenerated or repaired tissue and the regression of fibrosis), and it is a marker gene specific to one of the macrophage subsets. Therefore, it is speculated that it may be used as a biomarker for detecting the treatment effect of atrial septal defect. On this basis, by detecting the expression of the GPNMB gene at the mRNA level and protein level in the neonatal tissues on the occluder at the 1st, 3rd, and 6th months after implanting the PLLA-ASD occluder in ASD pigs and in the serum of ASD children, and detecting the effect of GPNMB on the expression of proteins related to tissue damage repair (inflammatory factors, proliferative factors, and classical fibrosis proteins) at the cellular level, it was verified that it can be used as a biomarker for detecting the treatment effect of atrial septal defect. Therefore, by detecting the change in the expression of the GPNMB gene in the serum of ASD patients, the treatment effect of atrial septal defect can be quickly, objectively, and accurately diagnosed, which has great clinical application value. Description of the Drawings
[0010] Figure 1 This is the occluding effect diagram of the atrial septal defect site of Bama minipigs in Example 1 of the present invention. A is the follow-up cardiac ultrasound result; B is the follow-up electrocardiogram; C is the ASD tissue site separated from the removed heart.
[0011] Figure 2 This is the cell subset classification and proportion composition diagram of the neonatal tissues on the PLLA-ASD occluder in Example 1 of the present invention. A is the cell attribute annotation of the UMAP clustering of the neonatal tissues on the PLLA-ASD occluder at the 1st, 3rd, and 6th months after treating ASD pigs with the PLLA-ASD occluder; B and C are the proportion compositions of the clustered cells in each group; D is the heat map of the top 50 differential genes with the largest changes in macrophages.
[0012] Figure 3 This is the macrophage subset classification and specific marker gene diagram in Example 1 of the present invention. A is the macrophage subset annotation; B is the marker gene specific to the macrophage subset.
[0013] Figure 4This is the expression map of the GPNMB gene in the new tissue on the PLLA-ASD occluder at the 1st, 3rd, and 6th months after the PLLA-ASD occluder was implanted in pigs with ASD in Example 2 of the present invention; A shows the expression results at the mRNA level; B shows the expression results at the protein level.
[0014] Figure 5 This is the expression map of the GPNMB gene in the serum at the 1st, 3rd, and 6th months after an ASD patient was implanted with a PLLA-ASD occluder in Example 3 of the present invention; A shows the expression results of the serum at the mRNA level; B shows the expression results of the serum at the protein level.
[0015] Figure 6 This is the effect map of GPNMB on inflammatory factors (TNF-α and IL-1β), classical fibrotic protein factors (α-SMA), and proliferation factors (PCNA) in Example 4 of the present invention; A shows the result map of successfully overexpressing GPNMB (PLVX-GPNMB) and knocking out GPNMB (V2-GPNMB) in THP-1 cells; B - C respectively show the result maps of GPNMB affecting inflammatory factors, classical fibrotic protein factors, and proliferation factors. Detailed implementation manners
[0016] To facilitate the understanding of the present invention, the present invention will be described more comprehensively below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, these embodiments are provided to make the understanding of the disclosed content of the present invention more thorough and comprehensive.
[0017] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly understood by those skilled in the technical field to which the present invention belongs. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and do not limit the present invention. The term "and / or" used in the present invention includes any and all combinations of one or more of the related listed items.
[0018] If not specifically specified, the embodiments are all carried out under conventional experimental conditions or according to the conditions recommended in the manufacturer's instructions. The raw materials and reagents used in the present invention are all commercially available, and any biological germplasm materials can be provided for scientific research.
[0019] In some embodiments of the present invention, the application of the non-metastatic melanoma glycoprotein B gene as a biomarker in the preparation of a kit for detecting the treatment effect of atrial septal defect is disclosed.
[0020] In some of these embodiments, the atrial septal defect is a secundum atrial septal defect.
[0021] In some of these embodiments, an occluder made mainly of polylactic acid is used to treat the atrial septal defect.
[0022] In other embodiments of the present invention, the application of a reagent for detecting the expression level of non-metastatic melanoma glycoprotein B gene in the preparation of a kit for detecting the therapeutic effect of atrial septal defect is disclosed.
[0023] In some of these embodiments, the atrial septal injury is a secundum atrial septal injury.
[0024] In some of these embodiments, an occluder made mainly of polylactic acid is used to treat the atrial septal injury.
[0025] In some of these embodiments, polymerase chain reaction technology, gene sequencing technology, and Western blotting technology are used to detect the expression level of non-metastatic melanoma glycoprotein B gene.
[0026] In some of these embodiments, the polymerase chain reaction is qRT-PCR, immunological PCR, nested PCR, in situ PCR, membrane-bound PCR, anchored PCR, solid-phase PCR, asymmetric PCR, long-distance PCR, parachute PCR, or gradient PCR.
[0027] In some of these embodiments, the polymerase chain reaction is qRT-PCR, and the nucleotide sequences of the primers used in the qRT-PCR are shown as SEQ ID NO:5 and SEQ ID NO:6.
[0028] In some of these embodiments, the test sample of the kit is serum.
[0029] The method for detecting the therapeutic effect of atrial septal defect of the present invention includes the following steps: using qRT-PCR to measure the expression level of non-metastatic melanoma glycoprotein B gene in the serum of a sample of a patient with ASD to be treated, and comparing it with the reference value of a control healthy child. The closer the ratio is to 1, the better the tissue injury repair effect and the better the therapeutic effect.
[0030] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.
[0031] Example 1 Screening Biomarkers for Detecting the Therapeutic Effect of ASD
[0032] It includes the following steps:
[0033] 1. Fifteen 10 - month - old Bama minipigs were raised in an SPF environment, and 3 normal pigs were used as the control group. A catheter - intervention modeling operation was performed on 12 pigs by puncturing at the position of the foramen ovale in the atrial septum of the heart and dilating with a balloon. One month later, atrial septal defect (ASD) was confirmed by echocardiography. Three ASD pigs were left as the ASD pig model group (ASD group), and PLLA - ASD occluders (from Xianjian Technology Co., Ltd.) were implanted into the remaining 9 ASD pigs. These pigs were regularly (at the 1st, 3rd, and 6th months) examined by echocardiography and electrocardiogram to ensure that the PLLA - ASD occluder did not fall off or shift, and the electrocardiogram was normal. The results are as shown in Figure 1 A and B in it. Follow - up echocardiography showed that the position of the occluder was good, and the follow - up electrocardiogram was normal.
[0034] 2. At the 1st, 3rd, and 6th months after the implantation of PLLA - ASD occluders in ASD pigs, whole blood was collected from the normal group, ASD group, and ASD pigs treated with PLLA - ASD occluders at the 1st, 3rd, and 6th months, and serum was separated, and then euthanasia was performed; the atrial septal tissue of normal pigs (Control), the atrial septal defect site of ASD pigs (Model), and the new tissue of ASD pigs treated with PLLA - ASD occluders (Occlusion) were taken out respectively, as shown in Figure 1 C in it.
[0035] 3. The new tissue on the occluders of the normal group, ASD group, and ASD pigs treated with PLLA - ASD occluders for 1, 3, and 6 months was collected, and single - cell sequencing was performed on the tissue according to the experimental steps of single - cell sequencing. Cell subset analysis was performed on the results of single - cell sequencing. The results showed that there were 10 cell subsets, and macrophages and fibroblasts had the largest proportion ( Figure 2 A in it), and among them, macrophages changed the most among the groups ( Figure 2 B and C in it), which suggested that macrophages play an important role in the treatment process of atrial septal defect.
[0036] 4. Analyzing the top 50 differentially expressed genes with the greatest changes in macrophages, the results showed that among these 50 differentially expressed genes, the GPNMB gene had the most significant difference ( Figure 2 D in it), and its expression first increased and then gradually decreased with the progress of treatment with PLLA - ASD occluders, which was similar to the trend of tissue injury repair process.
[0037] 5. Further subset analysis of macrophages was performed ( Figure 3 A in it), and marker genes of each macrophage subset were identified through single - cell sequencing data analysis. It was found that GPNMB was a marker gene unique to one of the macrophage subsets ( Figure 3 B in it).
[0038] Therefore, based on the above results, it is inferred that the GPNMB gene may be used as a biomarker for detecting the therapeutic effect of atrial septal injury.
[0039] Example 2 Verification of the GPNMB gene as a biomarker for detecting the therapeutic effect of ASD
[0040] In this example, by detecting the changes in the GPNMB gene at the mRNA level and protein level in the new tissues on the ASD pig occluder at 1, 3, and 6 months after treatment with the PLLA-ASD occluder, it was verified whether it could be used as a biomarker for detecting the therapeutic effect of ASD.
[0041] 1. Expression at the mRNA level
[0042] ①. Respectively, for the atrial septal tissue of the normal pig heart, the atrial septal defect site of the ASD pig heart, and the new tissues on the ASD pig occluder at 1, 3, and 6 months after treatment with the PLLA-ASD occluder in Example 1, extract RNA from the tissue samples according to the Trizol reagent manual (Invitrogen Life Technologies, Carlsbad, CA), and measure its concentration and purity.
[0043] ②. Use the HiScript II One Step qRT-PCR SYBR Green kit (Vazyme Q221) to perform real-time measurement in the Lightcycler through SYBR green. Use the housekeeping gene GAPDH to standardize in each individual sample, and use the 2-ΔΔCt method to quantify the relative expression changes. The specific reaction system is shown in Table 1, and the reaction program is shown in Table 2.
[0044] Among them, the primers include:
[0045] GPNMB forward primer F: CGCCAAACGGTTTCAGGATG (SEQ ID NO:1)
[0046] GPNMB reverse primer R: GGCCCCCTTTCCAAGAGTTT (SEQ ID NO:2)
[0047] Housekeeping gene GAPDH forward primer F:
[0048] TCGGAGTGAACGGATTTGGC (SEQ ID NO:3)
[0049] Housekeeping gene GAPDH reverse primer R:
[0050] CACCCCATTTGATGTTGGCG (SEQ ID NO:4).
[0051] Table 1
[0052] Component Volume 2X onestep SYBR Green Mix 10 μL onestep SYBR Green Enzyme Mix 1 μL Primer Forward (10 μM) 0.4 μL each Primer Reverse (10 μM) 0.4 μL each Template RNA 1 μg <![CDATA[RNase-free ddH2O]]> to 20 μL
[0053] Table 2
[0054] Reverse transcription 50 °C 3 min Pre-denaturation 95℃30s Cyclic reaction 95 °C 10 s, 60 °C 30 s, 40 cycles Melt Curve Stage Melting curve 95 °C 15 s, 60 °C 60 s, 95 °C 15 s
[0055] The results are as Figure 4 shown in A of Figure 4 . The results show that compared with the ASD group, in the new tissues at the 1st, 3rd, and 6th months after the PLLA-ASD occluder was implanted in ASD pigs, the expression of the GPNMB gene at the mRNA level first increased significantly and then gradually decreased.
[0056] 2. Expression at the protein level
[0057] ①. Protein lysate was added to the atrial septum tissue of the normal pig heart in Example 1, the atrial septal defect site of the ASD pig heart, and the new tissue on the ASD pig occluder at the 1st, 3rd, and 6th months after PLLA-ASD occluder treatment, sonicated, left standing at room temperature for 10 minutes, centrifuged at 12,000 rpm for 5 minutes, and the supernatant was collected as the total protein extracted;
[0058] ②. According to the experimental steps of the BCA detection kit, the protein concentration of the extracted total protein was measured;
[0059] ③. According to the protein concentration of each group, with a loading amount of 30 μg per well, protein loading buffer was added to make protein samples, and the proteins were denatured at 99 °C in a metal bath for 15 minutes;
[0060] ④. The protein samples were subjected to SDS-PAGE gel electrophoresis and transferred to a PVDF membrane at a constant current of 300 mA;
[0061] ⑤. The PVDF membrane containing proteins was blocked at room temperature in the blocking solution for 1 hour; the primary antibody solution was prepared according to the antibody instruction manual, and the PVDF membrane was immersed in the primary antibody solution and incubated overnight at 4 °C; the PVDF membrane was washed three times with TBST solution, 5 minutes each time; the secondary antibody solution was prepared according to the antibody instruction manual, and the PVDF membrane was immersed in the secondary antibody solution and incubated on a shaker at room temperature for 1 hour; the PVDF membrane was washed three times with TBST solution, 5 minutes each time;
[0062] ⑥. The PVDF membrane was developed, photographed, and the protein gray scale analysis was performed using Image J software to make a graph.
[0063] The results are as Figure 4As shown in B in [reference], the results showed that compared with the ASD group, in the newly formed tissues at the 1st, 3rd, and 6th months after the implantation of PLLA-ASD occluder in ASD pigs, the expression of GPNMB gene at the protein level first increased significantly and then gradually decreased.
[0064] Based on the above results, it can be seen that in the newly formed tissues after the treatment of ASD pigs with PLLA-ASD occluder, the expression of GPNMB gene at the mRNA level and protein level both first increased significantly and then gradually decreased, which is similar to the process of tissue injury repair. Therefore, the GPNMB gene can be used as a biomarker for detecting the therapeutic effect of ASD.
[0065] Example 3 Further verification of GPNMB gene as a biomarker for detecting the therapeutic effect of ASD
[0066] In this example, by detecting the change rules of GPNMB gene at the mRNA level and protein level in the sera of ASD children at the 1st, 3rd, and 6th months after treatment with PLLA-ASD occluder, its ability to be used as a biomarker for detecting the therapeutic effect of ASD was further verified.
[0067] 1. Expression at the mRNA level
[0068] ①. Collect the sera of healthy children (healthy control group), ASD children, and ASD children at the 1st, 3rd, and 6th months after treatment with PLLA-ASD occluder in the hospital. Extract the serum RNA according to the Trizol reagent manual (Invitrogen Life Technologies, Carlsbad, CA), and measure its concentration and purity.
[0069] ②. Use the HiScript II One Step qRT-PCR SYBR Green kit (Vazyme Q221) to perform real-time measurement in the Lightcycler through SYBR green. Use the housekeeping gene GAPDH to standardize each individual sample, and use the 2-ΔΔCt method to quantify the relative expression changes. The specific reaction system and reaction program are the same as Tables 1 and 2 in Example 2 (only the primers are different).
[0070] Forward primer F of GPNMB: GCGAGATCACCCAGAACACA (SEQ ID NO:5)
[0071] Reverse primer R of GPNMB: AGAGCCAGGCTTGTGTCATC (SEQ ID NO:6)
[0072] Forward primer F of the internal reference gene GAPDH:
[0073] GATTCCACCCATGGCAAATTC(SEQ ID NO:7)
[0074] Reverse primer R for the internal reference gene GAPDH:
[0075] CTGGAAGATGGTGATGGGATT(SEQ ID NO:8).
[0076] The results are as Figure 5 shown in A. In the serum of ASD children after treatment with PLLA-ASD occluder implantation, the expression of GPNMB gene at the mRNA level showed a pattern of first increasing significantly and then gradually decreasing.
[0077] 2. Expression at the protein level
[0078] ①. Collect the serum of healthy children (healthy control group), ASD children, and ASD children at 1, 3, and 6 months after treatment with PLLA-ASD occluder implantation in the hospital. Extract serum proteins according to the plasma serum albumin removal kit (proteintech, PK10025) and measure the protein concentration.
[0079] ②. Perform Western blot on proteins from different groups to detect the expression changes of GPNMB in the serum. The method is the same as above.
[0080] The results are as Figure 5 shown in B. In the serum of ASD children after treatment with PLLA-ASD occluder implantation, the expression of GPNMB gene at the protein level first increased significantly and then gradually decreased.
[0081] Based on the above results, it can be seen that in the serum of ASD children after treatment with PLLA-ASD occluder implantation, the expression of GPNMB gene at both the mRNA level and the protein level first increased significantly and then gradually decreased, which is similar to the process of tissue injury repair. Therefore, the GPNMB gene can be used as a biomarker for detecting the treatment effect of ASD. By detecting the expression level of GPNMB gene in the serum, the treatment effect of atrial septal defect can be detected.
[0082] Example 4 Effects of overexpressing and knocking out GPNMB gene on proteins related to tissue injury repair
[0083] This example further verified at the cellular level that GPNMB can be used as a biomarker for detecting the treatment effect of ASD. It includes the following steps:
[0084] 1. Construct recombinant plasmids for overexpressing and knocking out GPNMB gene
[0085] ①. Extract RNA from THP-1 cells according to the RNA extraction steps, and reverse transcribe the RNA into cDNA according to the reverse transcription kit instructions; use the upstream primer: ATGGAATGTCTCTACTATTTC (SEQ ID NO:9) and the downstream primer: TTAAGAAACTCCTTTAAATTC (SEQ ID NO:10), amplify the GPNMB gene by PCR, and then ligate the GPNMB gene into the PLVX vector (commercially available) to obtain a recombinant plasmid (PLVX-GPNMB) overexpressing the GPNMB gene.
[0086] ②. Use the CRISPR / Cas9 system for gene knockout. Design the sgRNA of the GPNMB gene, phosphorylate and anneal two Oligos into double-stranded DNA, and clone it into the lentiCRISPRV2 vector (commercially available) , to obtain a recombinant plasmid (V2-GPNMB) with the GPNMB gene knocked out.
[0087] 2. Verify the effect of the GPNMB gene on tissue damage repair-related proteins at the cellular level
[0088] ①. Culture 293T cells, and transfect the recombinant plasmids overexpressing and knocking out the GPNMB gene into 293T cells at a ratio of target plasmid: psPAX2: pMD2.G (commercially available) = 2:1.5:0.5 according to the Lipofectamine TM 3000 transfection reagent instructions. Collect the obtained lentiviral supernatant on the second and third days.
[0089] ②. Culture THP-1 cells. When the cell density reaches 10 6 cells / mL, overexpress and knock out the GPNMB gene in THP-1 cells by lentiviral infection. Determine the successful overexpression and knockout of the GPNMB gene by Western blot technology, and then detect the related proteins of tissue damage repair, such as inflammatory response (inflammatory factors TNF-α, IL-1β), cell proliferation (PCNA), and classical fibrosis protein (α-SMA).
[0090] The results are as Figure 6 shown in A, indicating the successful overexpression and knockout of the GPNMB gene in THP-1 cells. Figure 6 B - C in
[0091] Therefore, the GPNMB gene affects the expression of inflammatory response-related, factor cell proliferation factor, and classical proteins of fibrosis at the cellular level during tissue damage repair.
[0092] The technical features of the above-described embodiments can be combined arbitrarily. For the sake of brevity of description, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, it should be considered as the scope described in this specification.
[0093] The above-described embodiments merely represent several implementation manners of the present invention. The description is relatively specific and detailed, but it should not be construed as a limitation on the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can be made, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the present invention patent shall be subject to the appended claims.
Claims
1. Use of non - metastatic melanoma glycoprotein B gene as a biomarker in the preparation of a kit for detecting the therapeutic effect of atrial septal defect.
2. The application according to claim 1, wherein, The atrial septal defect is a secundum atrial septal defect.
3. The application according to claim 2, wherein The atrial septal defect is treated with a occluder made of polylactic acid as the raw material.
4. Use of a reagent for detecting the expression level of non - metastatic melanoma glycoprotein B gene in the preparation of a kit for detecting the therapeutic effect of atrial septal defect.
5. The application according to claim 4, wherein The atrial septal defect is a secundum atrial septal defect.
6. The application according to claim 5, characterized in that, The atrial septal defect is treated with a occluder made of polylactic acid as the raw material.
7. The application according to claim 4, wherein The expression level of non - metastatic melanoma glycoprotein B gene is detected by polymerase chain reaction technology, gene sequencing technology or Western blotting technology.
8. The application according to claim 7, characterized in that, The polymerase chain reaction is qRT - PCR, immuno - PCR, nested PCR, in - situ PCR, membrane - bound PCR, anchored PCR, solid - phase PCR, asymmetric PCR, long - distance PCR, parachute PCR or gradient PCR.
9. The application according to claim 8, wherein The polymerase chain reaction is qRT - PCR, and the nucleotide sequences of the primers used in the qRT - PCR are as shown in SEQ ID NO:5 and SEQ ID NO:
6.
10. The application according to any one of claims 4 to 9, characterized in that, The test sample of the kit is serum.