SNP (Single Nucleotide Polymorphism) molecular marker located on porcine chromosome 8 and related to porcine intramuscular fat character and application of SNP molecular marker

By localizing SNP molecular markers on pig chromosome 8, combining primer pairs and kits, efficient and accurate molecular marker assisted breeding is achieved, solving the problem of slow improvement of intramuscular fat content in traditional breeding methods, and improving meat quality and economic benefits.

CN120330348AActive Publication Date: 2025-07-18NORTHWEST A & F UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510649690.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-20
Publication Date
2025-07-18
Estimated Expiration
2045-05-20

AI Technical Summary

Technical Problem

Traditional breeding methods are difficult to effectively increase the fat content in pig muscles, resulting in slow progress in improving meat traits. The existing molecular breeding technology has problems of gene association and inaccurate positioning.

Method used

Through genome-wide association analysis (GWAS), SNP molecular markers are located on pig chromosome 8, primer pairs and kits are designed to detect SNP molecular markers, screen pig breeds with high intramuscular fat traits, and dominant alleles are selected generation by generation to establish molecular marker-assisted breeding technology.

Benefits of technology

It has improved the fat content in pig muscles, improved meat quality, increased the economic benefits of breeding pigs, shortened the breeding process, and improved meat quality and corporate profits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120330348A_ABST
    Figure CN120330348A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of molecular biotechnology and molecular markers, and particularly relates to an SNP (Single Nucleotide Polymorphism) molecular marker located on a porcine chromosome 8 and related to porcine intramuscular fat traits and an application of the SNP molecular marker. SNP loci of the SNP molecular marker related to intramuscular fat traits on the 8 # chromosome of the pig correspond to Tgt at 43th, 738th and 941th sites on the 8 # chromosome of a reference sequence of an international pig reference genome version 11.1; c mutation. By optimizing the dominant alleles of the SNP, the frequency of the dominant alleles can be increased generation by generation, the fat content in pig muscle can be increased, the meat quality can be improved, excellent breeding pigs with the characters can be bred, the progress of genetic improvement of the pigs can be accelerated, and the economic benefit of breeding of the breeding pigs can be effectively improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the fields of molecular biotechnology and molecular marker technology, and particularly relates to an SNP molecular marker located on porcine chromosome 8 and related to porcine intramuscular fat traits and its application. Background Art

[0002] Meat quality traits are important economic traits and are closely related to breeding efficiency. Intramuscular fat (IMF), as a core indicator of pork quality, directly affects the flavor, tenderness, and juiciness of meat products. Some studies have shown that local breeds such as Qinchuan black pigs have attracted much attention due to their excellent IMF deposition ability, which is significantly higher than that of commercial pig breeds, and they are ideal models for studying fat metabolism regulation. The genetic regulation of IMF presents the characteristics of a multi-gene network, involving key pathways such as fatty acid synthesis (ACC, FASN), oxidation (CPT1B), and cell differentiation (PPARγ).

[0003] Farmers attach great importance to the IMF trait in breeding of breeding pigs, but traditional breeding methods face challenges. Although breeding technologies have advanced year by year, the genetic progress of IMF content has been relatively slow. This is mainly because IMF is a complex trait, affected by both environmental and genetic factors, and the efficiency of traditional phenotypic selection is low. In recent years, the application of molecular breeding technology has provided a new way to solve this problem.

[0004] Currently, candidate gene method and QTL mapping are still the main means for studying IMF. Some functional genes such as PLIN2 (perilipin 2), FABP (adipocyte fatty acid-binding protein), and ADIG (adipocyte differentiation-related gene) have been identified, but these methods have significant limitations: the candidate gene method is easily interfered by population heterogeneity and linkage disequilibrium, and the selected genes may lead to breeding risks due to indirect association; although QTL mapping can identify chromosomal regions, the broad confidence intervals (usually containing hundreds of genes) limit its practical application. For example, the IMF-related QTL located on SSC4 in the early stage was finally confirmed that ACSL1 is the key gene after years of research.

[0005] Nowadays, the breakthrough of genome-wide association study (GWAS) technology has brought new opportunities for the study of complex traits. This method uses whole-genome resequencing technology to accurately locate genetic variations and discover new candidate genes. Compared with traditional methods, GWAS has significant advantages in terms of mapping accuracy and discovering new genes. Combining selection signal analysis methods such as Fst, the genomic regions under selection pressure can be further screened to provide accurate targets for molecular breeding. Currently, some studies have mapped to the ADIPOQ gene region on SSC14 through GWAS, revealing a new mechanism of adiponectin regulating muscle energy metabolism. These progress mark the transformation of pig breeding in China from traditional phenotypic selection to genomic precision breeding. Summary of the Invention

[0006] In order to overcome the deficiencies and drawbacks of the prior art, the primary object of the present invention is to provide an SNP molecular marker located on porcine chromosome 8 and related to intramuscular fat traits in pigs.

[0007] Another object of the present invention is to provide a primer pair for detecting the above-mentioned SNP molecular marker.

[0008] Another object of the present invention is to provide a kit for detecting the above-mentioned SNP molecular marker.

[0009] The fourth object of the present invention is to provide the applications of the above-mentioned SNP molecular marker, primer pair and kit.

[0010] The fifth object of the present invention is to provide a method for genetic improvement of pigs.

[0011] The objects of the present invention are achieved by the following technical solutions:

[0012] An SNP molecular marker located on porcine chromosome 8 and related to intramuscular fat traits, the SNP locus corresponding to the T>C mutation at position 43,738,941 on chromosome 8 of the reference sequence of the international porcine reference genome version 11.1; the polymorphism of the bases at this locus affects the intramuscular fat traits in pigs, wherein the intramuscular fat content of pigs with the TT genotype is lower than that of pigs with the CT genotype or the CC genotype;

[0013] The nucleotide sequence of the above-mentioned SNP molecular marker is as shown in SEQ ID NO: 1, where M in the sequence is T or C, resulting in differences in intramuscular fat traits in pigs;

[0014] The SNP locus of the above-mentioned SNP molecular marker is the nucleotide mutation of T125-C125 at position 125 of the SEQ ID NO: 1 sequence (corresponding to the T>C mutation at position 43,738,941 on chromosome 8 of the reference sequence of the international porcine reference genome version 11.1, named g.125T>C);

[0015] The above-mentioned pigs are Danish Large White pigs or Qinchuan Black pigs;

[0016] A primer pair for detecting the above-mentioned SNP molecular marker, comprising primer P001-F and primer P002-R, and their nucleotide sequences are as follows:

[0017] P001-F: 5’-CTTGGCTGTGGAGTATGTAGATTCA-3’,

[0018] P002-R: 5’-GAGATGTAAAGGGTTGAGAGGGATG-3’;

[0019] The pigs mentioned above are Danish Large White pigs or Qinchuan Black pigs;

[0020] A kit for detecting the above SNP molecular markers, comprising the above primer pair;

[0021] The pigs mentioned above are Danish Large White pigs or Qinchuan Black pigs;

[0022] The application of the above SNP molecular markers, primer pairs or kits in identifying porcine intramuscular fat-related traits, screening pig breeds with high intramuscular fat traits or genetic breeding of porcine intramuscular fat-related traits;

[0023] The genetic breeding mentioned above is preferably marker-assisted breeding;

[0024] The application of the above SNP molecular markers in gene editing or assisting in identifying pig breeds;

[0025] The pigs mentioned above are Danish Large White pigs or Qinchuan Black pigs;

[0026] A method for detecting porcine intramuscular fat traits, comprising the following steps:

[0027] Detect the above SNP molecular markers on porcine chromosome 8, and judge the porcine intramuscular fat traits according to whether the single nucleotide at the SNP locus of the SNP molecular marker is C or T; among them, the intramuscular fat content of pigs with the TT genotype is lower than that of pigs with the CT genotype or CC genotype;

[0028] The pigs mentioned above are Danish Large White pigs or Qinchuan Black pigs;

[0029] A method for screening pig breeds with high intramuscular fat traits by using the above SNP molecular markers, comprising the following steps:

[0030] Detect the above SNP molecular markers on porcine chromosome 8, and eliminate individuals with the TT genotype according to the SNP locus of the SNP molecular marker, and retain individuals with the CT genotype or CC genotype; among them, the intramuscular fat content of pigs with the TT genotype is lower than that of pigs with the CT genotype or CC genotype;

[0031] The detection method mentioned above comprises the following steps:

[0032] (1) Extract the genomic DNA of the pigs to be tested;

[0033] (2) Use the above primer pair or the primer pair in the above kit as the amplification primer, and use the genomic DNA of the pigs to be tested obtained in step (1) as the template DNA for PCR amplification to obtain a PCR amplification product;

[0034] (3) Sequence the PCR amplification product to obtain a sequencing result;

[0035] (4) Determine the genotype of the SNP molecular marker based on the sequencing results;

[0036] The pig is a Danish Large White pig or a Qinchuan Black pig;

[0037] A method for genetic improvement of pigs, comprising the following steps:

[0038] Determine the locus of the above SNP molecular marker of the breeding pigs in the core breeding population, and make corresponding selections according to the molecular marker: Select breeding pig individuals with the genotype CT or CC at position 43,738,941 on chromosome 8 of the international pig reference genome version 11.1 in the core breeding population of breeding pigs, and eliminate breeding pig individuals with the genotype TT at the locus, so as to gradually increase the frequency of allele C at this locus, thereby improving the intramuscular fat trait of the offspring pigs;

[0039] The pig is a Danish Large White pig or a Qinchuan Black pig;

[0040] To fully explore the unique local pig breed resources in Shaanxi Province, transform the resource advantages into economic impetus, and meet the market demand for high-quality breeding pigs and diversified pork products, this study takes the Qinchuan Black pig, a cultivated pig breed, and the Danish Large White pig, a commercial pig breed, as the research objects. In previous studies, some candidate genes related to the intramuscular fat trait of the Qinchuan Black pig were mined using multi-omics joint analysis. The present invention uses genome-wide selection signal scanning and binary GWAS methods to mine the key molecular target affecting the intramuscular fat trait of the Qinchuan Black pig, which is located at position 43,738,941 on chromosome 8 of the pig, belonging to the T>C mutation. The polymorphism of the base at this locus shows significant differentiation in genotype frequency between high and low intramuscular fat populations and will affect the intramuscular fat trait. The present invention provides a scientific basis for the protection of local pig breeds and the improvement of economic value.

[0041] The present invention has the following advantages and effects compared with the prior art:

[0042] (1) The present invention studies and determines that the molecular marker related to the intramuscular fat trait of pigs is located on the nucleotide sequence of chromosome 8 of the pig, verifies its effect on the intramuscular fat trait, and finally establishes an efficient and accurate molecular marker-assisted breeding technology, and applies it to the genetic improvement of increasing the intramuscular fat trait of breeding pigs, thereby improving the intramuscular fat content of the offspring pigs, improving the pork quality, increasing the economic profit of enterprises, and enhancing the core competitiveness.

[0043] (2) The present invention provides a primer pair and a kit for detecting the above SNP molecular marker. Through this primer pair and kit, an efficient and accurate molecular marker-assisted breeding technology can be established to quickly and accurately select and breed the intramuscular fat trait, and accelerate the breeding process.

[0044] (3) By preferentially selecting the advantageous allele of this SNP, the present invention can gradually increase the frequency of the advantageous allele, increase the intramuscular fat trait of breeding pigs, breed excellent breeding pigs with intramuscular fat traits, and accelerate the progress of pig genetic improvement, thereby effectively improving the economic benefits of pig breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 It is a result diagram of genome-wide selection signal scanning (Fst) for intramuscular fat traits on chromosome 8 of Qinchuan black pigs and Danish Large White pigs using Plink software; wherein: the x-axis represents the chromosome number of pigs; the y-axis represents the Fst value.

[0046] Figure 2 It is a Manhattan plot of binary genome-wide association analysis for intramuscular fat traits on chromosome 8 of Qinchuan black pigs and Danish Large White pigs using the Logistic Mixed Model in Plink software; wherein: the x-axis represents the chromosome number of pigs; the main y-axis represents -log 10 P value.

[0047] Figure 3 It is an analysis diagram of genotype difference results at the 125th position at the 5' end of Qinchuan black pigs and Danish Large White pigs. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0048] The present invention will be further described in detail below in conjunction with embodiments and the accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0049] Example 1 Experimental Subjects, Phenotypic Determination and DNA Sample Collection

[0050] (1) Experimental Animals

[0051] The experimental pig population used in the present invention is the core population of Danish Large White pigs of a certain company in Shaanxi and a new breed of Qinchuan black pigs (formerly known as Qinling Black, QLB, bred by crossing Guanzhong black pigs and Danish Large White pigs) cultivated in the livestock teaching experiment base of Northwest A&F University.

[0052] A total of 560 Danish Large White pigs and 361 Qinchuan black pigs in this experimental pig population were selected in this experiment, and there are detailed pedigree records. The experimental pig population was fed freely and provided with water, and the entire feeding method, breeding conditions, etc. were always kept consistent, which is a conventional method.

[0053] (2) Phenotype

[0054] For the GWAS of binary traits, since it has been proven in previous studies that the intramuscular fat of Qinchuan black pigs is significantly higher than that of Danish Large White pigs (Yu T, Tian X, Li D, et al. Transcriptome, proteome and metabolome analysis provide insights on fat deposition and meat quality in pig[J]. Food Research International, 2023, 166:112550-. DOI:10.1016 / j.foodres.2023.112550.), the phenotype of Qinchuan black pigs with high intramuscular fat was set as "1", and the phenotype of Danish Large White pigs with low intramuscular fat was set as "0".

[0055] (3) Collection of pig tissue samples

[0056] To extract DNA, ear samples of 921 pigs were collected and stored in a -80°C refrigerator for subsequent DNA extraction and sequencing.

[0057] Example 2

[0058] (1) Extraction of sample DNA

[0059] ① Prepare the lysis buffer in advance: Add Tris-HCl (pH 8.0) with a final concentration of 10 mM, EDTA (pH 8.0) with a final concentration of 1 mM, NaCl with a final concentration of 100 mM, and SDS with a final concentration of 0.5% (w / v) to 1.8 mL of deionized water in sequence and mix well. Then add 25 μL of proteinase K at 20 mg / mL (the final proteinase K concentration is about 0.25 mg / mL), and dispense the above reagents into 2.0 mL EP tubes, 1.925 mL per tube. Place the dispensed EP tubes in a 56°C water bath shaker for preheating for 10 - 15 min to fully mix the components and reach the appropriate reaction temperature.

[0060] ② Take about 60 mg of ear tissue samples of Danish Large White pigs and put them into an EP tube. Cut the tissue into small pieces, add 600 μL of lysis buffer, invert several times, and then add 10 μL of proteinase K at 20 mg / mL and mix well.

[0061] ③ Incubate at 56°C for 1 - 2 h to digest the tissue.

[0062] ④ After complete digestion, add an equal volume (600 μL) of Tris-saturated phenol, centrifuge at 4°C and 12000 r / min for 10 min, and aspirate the supernatant to a new 2.0 mL EP tube.

[0063] ⑤ Repeat the previous step.

[0064] ⑥Transfer the supernatant to a new 2.0 mL EP tube, add an equal volume of phenol / chloroform / isoamyl alcohol (V25:V24:V1), and invert vigorously to mix well.

[0065] ⑦Centrifuge at 4°C and 12,000 r / min for another 10 min, transfer the supernatant to a new 2.0 mL EP tube.

[0066] ⑧Repeat step ④.

[0067] ⑨Add an equal volume of chloroform / isoamyl alcohol (V24:V1), invert gently for 10 min, centrifuge at 4°C and 12,000 r / min for 10 min, and transfer 300 μL of the upper aqueous phase to a centrifuge tube.

[0068] ⑩Add 750 μL of absolute ethanol, mix gently, and white flocculent DNA will precipitate. Centrifuge at 4°C and 14,000 r / min for 10 min, carefully pour off the supernatant and leave the precipitate.

[0069] Centrifuge again, briefly centrifuge at 4°C and 14,000 r / min for 2 min, and aspirate the residual absolute ethanol in the tube.

[0070] Add 20 - 200 μL of TE to dissolve the precipitate.

[0071] Use Nanodrop to detect the purity of DNA (OD260 / 620 ratio), and use Qubit to accurately quantify the DNA concentration. When the OD260 / 620 ratio of all DNA samples is between 1.8 and 2.0 and the DNA concentration meets the test requirements, it is used for subsequent library construction and sequencing.

[0072] (2) Whole-genome resequencing

[0073] All whole-genome resequencing data were completed by BGI Shenzhen Co., Ltd. The specific methods and steps are as follows:

[0074] ①Construct a library: Randomly fragment the qualified DNA extracted in step (1); through steps such as end repair of DNA fragments, addition of polyA at the 3' end, preparation of sequencing adapters, and amplification by PCR instrument, a sequencing library is obtained.

[0075] ②Sequencing on the machine: Perform resequencing on the DNB SEQ-T7 platform of BGI, with an average sequencing depth of 11.7×, and obtain raw sequencing data in the FASTQ format.

[0076] (3) Analysis of resequencing data

[0077] ① Use the Fastp software (v0.20.0) with default parameters to perform quality control on the raw sequencing data obtained in step (2), including filtering out adapter sequences and low-quality reads, etc., to obtain the quality-controlled sequencing data in FASTQ file format;

[0078] ② Use the BWA-mem module in the BWA-MEM software (v0.7.17) with default parameters to align the quality-controlled sequencing data in step ① to the international pig reference genome version 11.1 to obtain the aligned BAM file;

[0079] ③ Use the SortSam and MarkDuplicates functions of the Picard Tools software to sort the aligned BAM file in step ② and remove duplicate sequences;

[0080] ④ Use the HaplotypeCaller module of the GATK software for SNP calling to accurately identify SNPs and obtain a VCF file containing all SNP site information; use the VariantFiltration module of the GATK software to further filter the variants, and finally identify 23,271,982 SNPs.

[0081] (4) Genome-wide selection signal scanning analysis

[0082] Based on the SNP site information results (VCF file) obtained in step (5), select the Fst (fixation index) method founded by the American geneticist Wright, and use VCFtools (v0.1.16) to perform genome-wide selection scanning analysis on the Danish Large White pig and Qinchuan Black pig populations. Set the parameters as a 50-kb sliding window and a 25-kb step size to calculate the Fst value between the Danish Large White pig and the Qinchuan Black pig. The regions corresponding to the top 1% Fst values are designated as candidate regions, and the annotated genes within these regions are all regarded as candidate genes.

[0083] (5) Binary genome-wide association (GWAS) analysis

[0084] Select the Plink software developed by Shaun Purcell et al. from Harvard University, and perform binary GWAS analysis between variant sites and traits using a logistic mixed-effects model:

[0085] ① The logistic mixed-effects model is as follows:

[0086] Suppose there is a binary phenotype variable yi (taking values of 0 or 1), representing the trait of the i-th individual (such as whether it is a high intramuscular fat trait), then the logistic mixed-effects model can be expressed as:

[0087] logit(P(yi = 1)) = α + βxi + gi

[0088] where logit(p) = log(p / (1 - p)) is the logit transformation that converts the probability p to a linear scale. α is the intercept term, β is the additive effect (fixed effect) of the candidate SNP to be tested, corresponding to the coefficient of the SNP genotype indicator variable xi. xi is also coded as 0, 1, representing different genotypes of the SNP. gi is the polygenic effect (random effect), representing the impact of all other genetic variations on the phenotype of individual i, usually estimated through the genomic relationship matrix (GRM); in the logistic mixed-effect model, the polygenic effect gi is usually assumed to follow a multivariate normal distribution, and its variance-covariance matrix is determined by the GRM. This model can simultaneously consider the fixed effect (the effect of a specific SNP) and the random effect (the polygenic background), thus more accurately evaluating the association between SNPs and binary traits.

[0089] ② Binary GWAS analysis method between variant sites and traits

[0090] Use Plink software (v1.90) to convert the SNP site information results (VCF file) obtained in step (5) into a Plink binary format file, and filter out variants with a variant detection rate lower than 10% and a minor allele frequency (MAF) lower than 5%; finally, use Plink software (v1.90) to perform binary genome-wide association analysis, with a significant threshold line of 0.05 / n, and annotate the regions 100 kb upstream and downstream of the significant sites.

[0091] (6) Association analysis between different genotypes and intramuscular fat trait phenotypes

[0092] The results of the genome-wide selection signal scanning analysis are shown in Figure 1 , and it can be seen from Figure 1 that the Fst value of the window corresponding to the MSMO1 gene is relatively high, indicating a relatively high degree of differentiation of this gene between the Qinchuan black pig population and the Large White pig population.

[0093] To further identify the SNP sites affecting intramuscular fat traits, we performed binary genome-wide association analysis, and the results are shown in Figure 2 . Through GWAS analysis, it was found that there is a major QTL (Lipid accretion rate QTL) significantly affecting intramuscular fat traits on chromosome 8 (Chr8: 43,528,960 bp - 62,028,768 bp), and its most significantly associated site g.125T>C (a T>C mutation at position 43,738,941 on chromosome 8 of the reference sequence of the international pig reference genome version 11.1) was focused on. According to Figure 2As can be seen from Table 1, the SNP locus g.125T>C of the molecular marker is extremely significantly correlated with intramuscular fat traits (P<0.001), indicating that this molecular marker significantly affects the intramuscular fat traits of pigs. Through the assisted selection of this SNP locus in pigs, it is expected to improve the intramuscular fat traits of pigs during the breeding process.

[0094] In addition, according to Table 1 and Figure 3 it is also known that in the Danish Large White pig population with low intramuscular fat, the proportion of individuals with the TT genotype reaches more than 98%, and the proportion of individuals with the CC genotype is 0, indicating that for the trait of low intramuscular fat, the TT genotype is the dominant allele genotype in the Danish Large White pig population, that is, the TT genotype may be related to the low intramuscular fat of Danish Large White pigs; while in the Qinchuan Black pig population with high intramuscular fat, the proportion of individuals with the TT genotype is about 0.003%, indicating that in the Qinchuan Black pig population, for the trait of high intramuscular fat, the TT genotype may be unfavorable to the intramuscular fat trait, and this conclusion corroborates the previous conclusion.

[0095] In the Danish Large White pig population with low intramuscular fat, the CC genotype does not exist, the proportion of the CT genotype is extremely low, and the proportion of the TT genotype is extremely high. While in the Qinchuan Black pig population with high intramuscular fat, the proportions of the CC genotype and the CT genotype are higher, indicating that on the premise that the alleles T and C are related to the intramuscular fat traits of pigs, the percentage of intramuscular fat in pigs with the TT genotype is low, and the percentage of intramuscular fat in the CC and CT genotypes is high. Intramuscular fat trait is an important trait for measuring pork quality, and intramuscular fat trait will affect the quality, taste, flavor, nutritional value and consumer acceptance of pork. Combining the above analysis, it can be seen that pigs with the TT genotype have low intramuscular fat content and poor meat quality performance. During the breeding process, it is necessary to eliminate the breeding pigs with the TT genotype and retain the breeding pigs with the CC genotype and the CT genotype to gradually increase the frequency of the allele C at this locus. At present, the frequency of the dominant allele in the Qinchuan Black pig population is about 70.0%, and it is 0 in Danish Large White pigs, indicating that it still has great potential for genetic improvement.

[0096] In addition, the number of individuals with the CC genotype in the Danish Large White pig is 0%, while the number of individuals with the CC genotype in the Qinchuan Black pig accounts for 43.2%. The difference in this SNP genotype can also be used to assist in the identification of Qinchuan Black pigs and Danish Large White pigs.

[0097] Table 1 Correlation analysis of the SNP locus g.125T>C of the molecular marker and intramuscular fat traits

[0098]

[0099]

[0100] Example 2 Amplification and sequencing of the target DNA sequence

[0101] (1) Primer Design

[0102] Download the DNA sequence of SEQ ID NO:1 on chromosome 8 of pigs through the Ensembl website (http: / / asia.ensembl.org / index.html). Use the primer design software primer premier 6.0 to design primers and entrust Sangon Biotech (Shanghai) Co., Ltd. to synthesize the primers. The DNA sequences of the designed primers are as follows:

[0103] P001-F: 5’-CTTGGCTGTGGAGTATGTAGATTCA-3’ (SEQ ID NO:2);

[0104] P002-R: 5’-GAGATGTAAAGGGTTGAGAGGGATG-3’ (SEQ ID NO:3);

[0105] (2) PCR Amplification

[0106] PCR amplification: Add 1 μL of DNA template, 3.4 μL of double-distilled water, 5 μL of 2×Taq PCR MasterMix with Loading Dye, and 0.3 μL each of primers P001-F and P002-R to a 10 μL reaction system; The PCR reaction conditions are pre-denaturation at 94°C for 5 min to fully unwind the DNA double strand; Subsequently, perform 35 cycles of amplification. In each cycle, first denature at 94°C for 30 s to unwind the DNA double strand into single strands, then anneal at 64.5°C for 30 s to specifically bind the primers to the single-stranded template DNA, and finally extend at 72°C for 45 s to synthesize new DNA strands under the action of DNA polymerase; After 35 cycles, perform a final extension at 72°C for 5 min to ensure complete extension of the newly synthesized DNA strands.

[0107] (3) DNA Sequence Determination

[0108] DNA sequence sequencing and identification: Conducted at BGI-Shenzhen. The gene fragment is sequenced in both forward and reverse reactions. Compare the obtained sequence with the NCBI genomic sequence to obtain the mutations at the corresponding SNP sites. The sequencing results are as follows: CTTGGCTGTGGAGTATGTAGATTCACTTCTACCTGAGAATCCTCTGCAGGAACCATTTAAAAATGCTTGGAATTATATGTTGAACAAT M (T or C)ATACAAAGTTCCAGATTGCAACGTGGGGATCCCTCATAGTTCATGAGGCCCTTTATTTCTTTTTCTGTTTACCTGGATTTTTGTTTCAATTTATACCTTACATGAAAAAGTACAAAATTCAGAAGGATAAACCAGAAACATGGGAAAACCAGTGGAAATGCTTTAAAGTACTTCTGTTTAATCACTTTTGTATCCAGTTTCCTTTGATTTGTGGAACTTATTATTTTACGGAGTATTTCAGTATTCCTTACGATTGGGAAACAATGCCAAGATGGTACATTGCTTTGGCAAGATGCTTTGGCTGTGCTGTGATTGAGGATACCTGGCACTATTTCCTGCATAGGCTCTTACACCACAAAAGAATATATAAATATATTCATAAAATTCATCATGAGTTTCAGGCTCCATTTGGGATGGAAGCTGAATATGCACACCCTCTGGAAACCCTAATTCTGGGAACTGGATTTTTCATTGGAATCATGCTGTTATGTGATCATGTTATTCTTCTTTGGGCCTGGGTGACCGTTCGTTTGATAGAAACTATCGATGTCCATAGTGGTTATGACATCCCTCTCAACCCTTTACATCTC

[0109] Note: The M marked in the sequence list is the mutation site, shown underlined (the mutated base is in parentheses, which is an allelic mutation), and the primer sequence positions are shown in bold at the beginning and end of this sequence.

[0110] Effect analysis of SNP site g.125T>C of molecular marker in Example 3

[0111] According to Table 1 and Figure 2 It can be seen that for intramuscular fat traits, the frequency of the dominant allele genotype (CC) of the SNP site g.125T>C in the Qinchuan black pig population is much higher than that in the Danish Large White pig population. The higher the intramuscular fat content of pigs, the better the meat quality, taste, flavor, and nutritional value. This will greatly improve the economic benefits in breeding and create wealth for enterprises. Among the SNP-marked individuals, by selecting the dominant allele (C) of this SNP in the Qinchuan black pig population, the economic benefits can be ultimately improved, thus increasing the income of enterprises.

[0112] The present invention detects the base mutation site at position 125 in the SEQ ID NO:1 sequence, and preliminarily applies the association analysis between its genotype and intramuscular fat traits of pigs, providing a new molecular marker for molecular marker-assisted selection of pigs.

[0113] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited by the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and are all included in the protection scope of the present invention.

Claims

1. A SNP molecular marker located on porcine chromosome 8 and related to intramuscular fat trait, characterized in that Its SNP locus corresponds to the T>C mutation at position 43,738,941 on chromosome 8 of the reference sequence of the international pig reference genome version 11.1; the polymorphism of the base at this locus affects the intramuscular fat trait of pigs. Among them, the intramuscular fat content of pigs with the TT genotype is lower than that of pigs with the CT genotype or the CC genotype.

2. The SNP molecular marker located on pig chromosome 8 and related to the intramuscular fat trait according to claim 1, wherein the nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO: 1, where M in the sequence is T or C.

3. A primer pair for detecting SNP molecular markers related to intramuscular fat traits located on porcine chromosome 8, characterized in that It contains primer P001-F and primer P002-R, and their nucleotide sequences are as follows: P001-F: 5’-CTTGGCTGTGGAGTATGTAGATTCA-3’, P002-R: 5’-GAGATGTAAAGGGTTGAGAGGGATG-3’.

4. A kit for detecting SNP molecular markers related to intramuscular fat traits located on porcine chromosome 8, characterized in that It contains the primer pair described in claim 3.

5. The application of the SNP molecular marker according to claim 1 or 2, the primer pair according to claim 3, or the kit according to claim 4 in identifying pig intramuscular fat-related traits, screening pig breeds with high intramuscular fat traits, or genetic breeding related to pig intramuscular fat traits.

6. The application of the SNP molecular marker according to claim 1 or 2 in gene editing or assisting in identifying pig breeds.

7. A method for detecting intramuscular fat traits in pigs, characterized in that It contains the following steps: Detect the SNP molecular marker according to claim 1 or 2 on pig chromosome 8, and judge the intramuscular fat trait of pigs according to whether the single nucleotide at the SNP locus of the SNP molecular marker is C or T; Among them, the intramuscular fat content of pigs with the TT genotype is lower than that of pigs with the CT genotype or the CC genotype; The pigs are Danish Large White pigs or Qinchuan Black pigs.

8. A method for screening pig breeds with high intramuscular fat traits using SNP molecular markers related to intramuscular fat traits located on porcine chromosome 8, characterized in that It contains the following steps: Detect the SNP molecular marker according to claim 1 or 2 on pig chromosome 8, and eliminate individuals with the TT genotype and retain individuals with the CT genotype or the CC genotype according to the SNP locus of the SNP molecular marker; among them, the intramuscular fat content of pigs with the TT genotype is lower than that of pigs with the CT genotype or the CC genotype.

9. The method according to claim 7 or 8, wherein: The detection method contains the following steps: (1) Extract the genomic DNA of the pig to be tested; (2) Use the above primer pair or the primer pair in the above kit as the amplification primer, and use the genomic DNA of the pig to be tested obtained in step (1) as the template DNA to perform PCR amplification to obtain a PCR amplification product; (3) Sequence the PCR amplification product to obtain a sequencing result; (4) Based on the sequencing result, determine the genotype of the SNP molecular marker.

10. A method for genetic improvement of pigs, characterized in that It contains the following steps: Determine the locus of the SNP molecular marker described in Claim 1 or 2 of the breeding pigs in the core breeding population, and make corresponding selections based on the molecular marker: Select breeding pig individuals with the CT genotype or CC genotype at the 43,738,941st locus on chromosome 8 of the international pig reference genome version 11.1 in the core breeding population of breeding pigs, and eliminate breeding pig individuals with the TT genotype at the locus, so as to gradually increase the frequency of allele C at this locus, thereby improving the intramuscular fat trait of the offspring pigs.

Citation Information

Patent Citations

  • SNP molecular marker related to intramuscular fat in pork and application of SNP molecular marker

    CN112322753A

  • SNP molecular marker associated with intramuscular fat traits in pigs, use thereof, and method for detecting same

    WO2024021172A1