SNP (Single Nucleotide Polymorphism) molecular marker related to pork quality trait gene THRSP, primer pair and application of SNP molecular marker

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to a pork quality trait gene THRSP, a primer pair and application of the SNP molecular marker and the primer pair, wherein the meat quality trait is intramuscular fat content; the molecular marker is located in a partial sequence of a pig THRSP gene, the nucleotide sequence of the molecular marker is shown as SEQ ID NO.1 in a sequence table, and a Ggt exists at the 141bp position of the sequence; and A basic group mutation. The invention also provides a primer pair for amplifying the molecular marker and a method for breeding by using the molecular marker. According to the invention, the correlation between one SNP molecular marker in the pig THRSP gene and the intramuscular fat content character of the pig is explored for the first time, so that the SNP molecular marker can be used for marker-assisted selective breeding of the pig, that is, the new application of the SNP molecular marker in the pig THRSP gene in marker-assisted breeding of the pork quality character is provided, the early screening of the pork quality character is realized, and the screening method is simple and rapid.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of pig molecular markers, and particularly relates to a SNP molecular marker related to a pork quality trait gene THRSP, a primer pair and application thereof. BACKGROUND

[0002] Genetic improvement of pork quality has been paid more and more attention by breeders. Intramuscular fat (IMF) content is an important indicator for evaluating pork quality, which is significantly correlated with pork flavor, tenderness and juiciness. Although the heritability of meat quality traits such as IMF is relatively high, between 0.2-0.4, it is difficult to improve meat quality through conventional breeding due to the difficulty in live determination of meat quality traits. Therefore, it is of great significance to find molecular markers affecting meat quality traits and improve pork quality through molecular assisted breeding.

[0003] THRSP gene (thyroid hormone responsive, THRSP) is a thyroid hormone-induced liver protein that can form a heterodimer with MIG12 and participate in the regulation of lipid biosynthesis. In our previous study, we found that the expression level and chromatin open region of the THRSP gene were significantly different between two populations of selenium Dui black pigs with extremely high / low IMF, suggesting that the THRSP gene may affect pork quality traits such as IMF.

[0004] However, whether the THRSP gene can improve pork quality has not been reported, and identifying SNP sites in the THRSP gene related to meat quality traits has potential value for genetic improvement of pork quality. SUMMARY

[0005] The present application aims to overcome the defects of the prior art and provides a SNP molecular marker related to a pork quality trait gene THRSP, a primer pair and application thereof. The present application finds that a certain SNP in the THRSP gene is associated with pork quality traits, which can be used as a molecular marker for screening and breeding of pork quality traits.

[0006] One of the objectives of the present application is to provide a SNP molecular marker related to a pork quality trait gene THRSP, wherein the pork quality trait is intramuscular fat content; the molecular marker is located in part of the sequence of the pig THRSP gene, and the nucleotide sequence is shown in SEQ ID NO. 1 of the sequence listing, wherein there is a G>A base mutation at the 141st bp of the sequence, the sequence length is 291 bp, and the rs number of the SNP is rs81214375.

[0007] Further, the G or A base polymorphism site at the 141bp of the sequence SEQ ID NO. 1, shows three genotypes of GG, GA or AA, wherein the G allele is the dominant allele.

[0008] The second object of the present application provides an application of the SNP molecular marker in the screening of pork quality traits and / or pig breeding.

[0009] The third object of the present application provides a primer pair for amplifying the above-mentioned molecular marker, comprising: the nucleotide sequence of the upstream primer is shown in SEQ ID NO. 2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO. 3.

[0010] The fourth object of the present application provides an application of the above-mentioned primer pair in the screening of pork quality traits and / or pig breeding.

[0011] The fifth object of the present application provides a kit for rapid selection by using the above-mentioned SNP molecular marker, comprising the above-mentioned primer pair.

[0012] The sixth object of the present application provides a method for screening pork quality traits and / or pig selection, comprising:

[0013] S1, extracting the genomic DNA of the pig;

[0014] S2, using the genomic DNA obtained in step S1 as a template, performing PCR amplification by using the above-mentioned primer pair to obtain the molecular marker and purifying the same;

[0015] S3, performing sequencing analysis on the purified molecular marker in step S2, retaining the individual carrying the A allele at the 141bp of the sequence, and eliminating the individual carrying the G allele.

[0016] Further, in step S1, the genomic DNA is extracted from the ear tissue of the pig to be tested.

[0017] Compared with the prior art, the present application has the beneficial effects that: the present application firstly discovers that a SNP molecular marker (rs81214375) in the pig THRSP gene is related to the pork quality traits, specifically related to the intramuscular fat content trait of the pig, and thus the molecular marker can be used for screening the pork quality traits and selection, i.e. a new application of a SNP molecular marker in the pig THRSP gene in marker-assisted breeding of pork quality traits is provided, early screening of pork quality traits is realized, and the screening method is simple and rapid. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1It is an agarose gel electrophoresis detection diagram of the PCR product in Example 1 of the present application, wherein lane M is DL1000 Marker, and lanes 1-3 are amplified fragments in black pigs, and the fragment size is 291bp;

[0019] Figure 2 It is a sequencing map of the g.12480071G>A site in Example 1 of the present application; DETAILED DESCRIPTION

[0020] The technical solutions of the present application will be described clearly and completely in combination with the examples in the present application. Obviously, the described examples are only some of the examples of the present application, but not all the examples. Based on the examples in the present application, all the other examples obtained by those skilled in the art without creative labor belong to the scope of protection of the present application.

[0021] Example 1: Obtaining of the SNP detection fragment of the pig THRSP gene and establishment of the polymorphic site detection method

[0022] 1. Extraction of pig genomic DNA

[0023] The test pig variety of the present application is Suidu black pig, which is a new pig variety approved by the state in Hubei Province and is led by Hubei Academy of Agricultural Sciences. The pig genomic DNA is extracted by using the animal tissue genomic DNA extraction kit (PureLink Pro 96 Genomic DNA Purification Kit, K182104A) produced by Invitrogen Company, and the pig genomic DNA is extracted according to the instructions of the kit. The extracted DNA is detected for concentration and quality, and is stored at -20℃ for standby. TM

[0024] 2. Obtaining of the SNP genetic marker detection fragment of the pig THRSP gene

[0025] (1) PCR amplification

[0026] According to the SNP genetic marker detection sequence (as shown in SEQ ID NO. 1) in the genomic sequence (GenBank ID: NC_010451) of the pig THRSP gene, a pair of primers is designed to amplify the fragment of the polymorphic site.

[0027] The nucleotide sequence of the SNP genetic marker detection sequence is as follows:

[0028] ​ATGGACGAGAAAGCCACCATGCAGGTGCTGGCCAAGCGCTACCCCAAGAACTGCCTGCTGACCGTCATGGACCGGTACCTGGCCGTGGCTCGCAACATGGAGCAGGTGGTGATGATCCCCAGCCTGCTGCGGGATGTGCA CTGAGTGCACATGGGTGCCAGGCCCAGTCGGGGGCCCCCGATTTCTACAACTACTTCACCATGCTCAAGGCCATCCGTGTGGCTGTGGACCATGGGCTGCTGCCCCGGGAGGAGTGGCAGGCCAAGGTGGCGGATGGCAAAAACGATGGG, as set forth in SEQ ID NO. 1.

[0029] The primers are as follows:

[0030] The upstream primer is 5'GGGAAATTGCAGAACTGGGC 3', as set forth in SEQ ID NO. 2.

[0031] The downstream primer is 5'CCCATCGTTTTTGCCATCCG 3', as set forth in SEQ ID NO. 3.

[0032] The above primers are used to perform PCR amplification with black pig genomic DNA as a template. The PCR reaction system is 50 μL, and each component in the system is as follows: genomic DNA 100 ng, PCR mix 25 μL, the above upstream and downstream primers each 1 μL, and ddH2O is added to a total volume of 50 μL.

[0033] The running program of PCR is as follows: 98℃ pre-denaturation for 45 s; 98℃ denaturation for 10 s, 65℃ annealing for 30 s, 72℃ extension for 30 s, 40 cycles; 72℃ extension for 5 min; and 4℃ preservation. The PCR product is detected by 1% agarose gel electrophoresis, and the detection result is shown in FIG. 1, wherein lane M is DL1000 Marker, and lanes 1-3 are amplified fragments in black pigs, and the size of the amplified fragments is 291 bp. Figure 1

[0034] (2) PCR product purification

[0035] The above PCR amplification product is purified by using a Gel Extraction Kit reagent box of Shanghai Shengong Bioengineering Co., Ltd., and the specific steps are shown in the instruction manual of the reagent box.

[0036] 3. Detection of molecular markers by using PCR product direct sequencing method

[0037] ​The PCR purification product obtained above was directly sent to Beijing Aoke Company for sequencing, and the genotype of the site in the detection population was determined according to the sequencing result. The SeqMan software was used for analysis, and the results are shown in the following table 1. Figure 2 As shown in the table, it was found that there was a G>A allele mutation at 141 bp in the sequence, i.e. g.12480071G>A, and the mutation caused the polymorphism of the THRSP gene.

[0038] Example 2 Detection of polymorphism distribution of molecular markers in black pigs

[0039] In this example, the polymorphism distribution of the g.12480071G>A site of the pig THRSP gene in 184 Seidu black pigs was detected, and the detection results are shown in Table 1.

[0040] Table 1 Polymorphism distribution of the g.12480071G>A site of the THRSP gene

[0041]

[0042]

[0043] As shown in Table 1, in black pigs, the g.12480071G>A site of the THRSP gene showed three genotypes of GG, GA and AA, among which the GA genotype was more common, and the allele frequency was 59.8%, so the G allele was the dominant allele.

[0044] Example 3 Association analysis of molecular markers and pork quality traits

[0045] In order to determine whether the g.12480071G>A site of the pig THRSP gene is related to the difference of pork quality traits, the method established in Example 1 was used for polymorphism detection, and the correlation between different genotypes of the polymorphic site and the intramuscular fat content trait of pigs was analyzed. The GLM model of SAS19.0 software was used for association analysis of the variation site. The model used is:

[0046] Y ijk = μ + G i + A j + S k + e ijk ,

[0047] Where: Y ijk represents the phenotype value; μ represents the population mean; G i represents the genotype effect; A j represents the annual and seasonal effect; S k represents the paternal effect; e ijk represents the random residual effect. P<0.05 is considered to be significantly different; P<0.01 is considered to be extremely significantly different.

[0048] The correlation analysis between different genotypes and intramuscular fat content traits was carried out in Se-doo black pigs, and the statistical analysis results are shown in Table 2:

[0049] Table 2 Correlation analysis of g.12480071A>C site of THRSP gene and pork quality traits

[0050]

[0051] Note: The trait mean in the table is composed of mean ± standard deviation, and A and B represent extremely significant difference (P<0.01).

[0052] As can be seen from Table 2, in Se-doo black pigs, the intramuscular fat content of AA genotype individuals of g.12480071G>A site is extremely significantly higher than that of GG genotype individuals (P<0.01), therefore, although G allele is the dominant allele, it should be retained in breeding to carry A allele, so as to be beneficial to improve the intramuscular fat content of the population.

[0053] The above describes only the preferred specific embodiments of the present application, but the protection scope of the present application is not limited to this, any person skilled in the art can easily think of changes or replacements within the technical range disclosed by the present application, which should be covered in the protection scope of the present application.

Claims

1. A SNP molecular marker associated with the pork quality trait gene THRSP, characterized in that, The meat quality trait is intramuscular fat content; the molecular marker is located in a partial sequence of a pig THRSP gene, and the nucleotide sequence is shown in the sequence table SEQ ID NO. 1, and there is a G>A base mutation at the 141st bp of the sequence.

2. The SNP molecular marker associated with the pork quality trait gene THRSP according to claim 1, wherein the SNP molecular marker is a SNP marker selected from the group consisting of SEQ ID NOs: 1 to 6. The G or A base polymorphism site at the 141st bp in the sequence SEQ ID NO. 1 is expressed as three genotypes of GG, GA or AA, wherein the G allele is the dominant allele.

3. The SNP molecular marker according to any one of claims 1 or 2, applied to screening of a pig meat quality trait and / or pig breeding.

4. A primer pair for amplifying the molecular marker of claim 1, characterized in that, The primer pair comprises: the nucleotide sequence of the upstream primer is shown in SEQ ID NO. 2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

3.

5. The primer pair according to claim 3, applied to screening of a pig meat quality trait and / or pig breeding.

6. A kit for rapid selection using the SNP molecular marker of claim 1, wherein, The primer pair according to claim 4.

7. A method for screening for pork quality traits and / or breeding of pigs, characterized in that, The method comprises the following steps: S1, extracting genomic DNA of a pig; S2, using the genomic DNA obtained in step S1 as a template, performing PCR amplification by using the primer pair according to claim 4, obtaining the molecular marker according to claim 1 and purifying; S3, performing sequencing analysis on the purified molecular marker in step S2, retaining the individual carrying the A allele at the 141st bp of the sequence, and eliminating the individual carrying the G allele.

8. The method of screening for pork quality traits and / or breeding pigs according to claim 7, wherein, In step S1, the genomic DNA is extracted from the ear tissue of the pig to be tested.

Images