A SNP molecular marker located on chromosome 8 of pigs and associated with intramuscular fat traits in pigs and its application

By locating key SNP molecular markers on pig chromosome 8, combined with primer pairs and kits, the problem of slow progression of intramuscular fat traits in traditional breeding methods has been solved, achieving efficient molecular marker-assisted breeding and improving pork quality and economic benefits.

CN120330348BActive Publication Date: 2026-06-30NORTHWEST A & F UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
NORTHWEST A & F UNIV
Filing Date
2025-05-20
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

Traditional breeding methods are ineffective in improving the genetic progress of intramuscular fat traits in pigs. Traditional methods are inefficient and pose breeding risks. Existing molecular marker technology is not accurate in its localization, which affects meat quality and economic benefits.

Method used

Key SNP molecular markers were located on pig chromosome 8 using genome-wide association analysis (GWAS). Primer pairs and kits were designed to detect and screen pig individuals with the TT genotype, eliminate individuals with low intramuscular fat, retain individuals with high intramuscular fat (CT or CC genotypes), and increase allele frequency generation by generation.

Benefits of technology

This has enabled efficient and accurate molecular marker-assisted breeding, increasing intramuscular fat content in pigs, improving meat quality and economic benefits, and shortening the breeding process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120330348B_ABST
    Figure CN120330348B_ABST
Patent Text Reader

Abstract

This invention belongs to the fields of molecular biology and molecular marker technology, specifically relating to a SNP molecular marker located on chromosome 8 of pigs and associated with the intramuscular fat trait, and its application. The SNP site of this molecular marker on chromosome 8 corresponds to the T>C mutation at positions 43,738,941 on chromosome 8 in the International Swine Reference Genome Version 11.1. By selecting the dominant allele of this SNP, this invention can increase the frequency of the dominant allele generation by generation, thereby increasing intramuscular fat content, improving meat quality, and breeding superior pigs with the aforementioned traits. This contributes to accelerating the progress of pig genetic improvement and effectively improving the economic benefits of pig breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of molecular biotechnology and molecular marker technology, specifically relating to a SNP molecular marker located on chromosome 8 of pigs that is associated with intramuscular fat traits in pigs and its application. Background Technology

[0002] Meat quality traits are important economic traits, closely related to breeding efficiency. Intramuscular fat (IMF), as a core indicator of pork quality, directly affects the flavor, tenderness, and juiciness of the meat. Studies have shown that local breeds such as Qinchuan Black Pig have attracted much attention due to their excellent IMF deposition ability, which is significantly higher than that of commercial pig breeds, making them ideal models for studying lipid metabolism regulation. The genetic regulation of IMF exhibits multi-gene network characteristics, involving key pathways such as fatty acid synthesis (ACC, FASN), oxidation (CPT1B), and cell differentiation (PPARγ).

[0003] Pig farms highly value the IMF (Individual Molecular Factor) trait in breeding pigs, but traditional breeding methods face challenges. Despite continuous advancements in breeding techniques, genetic progress in IMF content has been relatively slow. This is primarily because IMF is a complex trait, influenced by both environmental and genetic factors, and traditional phenotypic selection is inefficient. In recent years, the application of molecular breeding techniques has provided a new approach to addressing this issue.

[0004] Currently, candidate gene mapping and QTL mapping remain the main methods for studying IMF. Studies have identified functional genes such as PLIN2 (lipid droplet coating protein 2), FABP (adipocyte-type fatty acid-binding protein), and ADIG (adipocyte differentiation-related gene), but these methods have significant limitations: candidate gene mapping is susceptible to population heterogeneity and linkage disequilibrium, and the selected genes may pose breeding risks due to indirect association; while QTL mapping can identify chromosomal regions, its broad confidence intervals (usually including hundreds of genes) limit its practical application. For example, the IMF-related QTL initially mapped in SSC4 only finally identified ACSL1 as a key gene after many years of research.

[0005] Breakthroughs in genome-wide association studies (GWAS) have brought new opportunities to the study of complex traits. This method utilizes whole-genome resequencing technology to precisely locate genetic variations and discover new candidate genes. Compared to traditional methods, GWAS has significant advantages in terms of localization accuracy and the discovery of new genes. Combined with selection signal analysis methods such as Fst, it can further screen genomic regions under selection pressure, providing precise targets for molecular breeding. Currently, studies have used GWAS to locate the ADIPOQ gene region in SSC14, revealing a new mechanism by which adiponectin regulates muscle energy metabolism. These advances signify that pig breeding in my country is transitioning from traditional phenotypic selection to precision genomic breeding. Summary of the Invention

[0006] In order to overcome the shortcomings and disadvantages of the prior art, the primary objective of this invention is to provide a SNP molecular marker located on chromosome 8 of pigs that is associated with the intramuscular fat trait in pigs.

[0007] Another object of the present invention is to provide a primer pair for detecting the above-mentioned SNP molecular markers.

[0008] Another object of the present invention is to provide a kit for detecting the above-mentioned SNP molecular markers.

[0009] The fourth objective of this invention is to provide applications of the above-mentioned SNP molecular markers, primer pairs, and kits.

[0010] The fifth objective of this invention is to provide a method for genetic improvement of pigs.

[0011] The objective of this invention is achieved through the following technical solution:

[0012] A molecular marker of intramuscular fat associated with the intramuscular fat trait located on chromosome 8 of pigs, whose SNP site corresponds to the T>C mutation at position 43,738,941 on chromosome 8 of the International Pig Reference Genome Version 11.1 reference sequence; the polymorphism of the base at this site affects the intramuscular fat trait of pigs, and pigs with the TT genotype have lower intramuscular fat content than pigs with the CT or CC genotypes;

[0013] The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO: 1, where M in the sequence is T or C, leading to differences in intramuscular fat traits in pigs;

[0014] The SNP site of the SNP molecular marker is the T125-C125 nucleotide mutation at position 125 of the sequence marked in SEQ ID NO: 1 (corresponding to the T>C mutation at positions 43,738,941 on chromosome 8 of the International Pig Reference Genome Version 11.1 reference sequence, named g.125T>C);

[0015] The pigs mentioned are Danish Large White pigs or Qinchuan Black pigs;

[0016] A primer pair for detecting the above-mentioned SNP molecular markers comprises primers P001-F and P002-R, the nucleotide sequences of which are shown below:

[0017] P001-F: 5'-CTTGGCTGTGGAGTATGTAGATTCA-3',

[0018] P002-R: 5'-GAGATGTAAAGGGTTGAGAGGGATG-3';

[0019] The pigs mentioned are Danish Large White pigs or Qinchuan Black pigs;

[0020] A kit for detecting the above-mentioned SNP molecular markers, comprising the above-mentioned primer pairs;

[0021] The pigs mentioned are Danish Large White pigs or Qinchuan Black pigs;

[0022] The application of the SNP molecular markers, primer pairs or kits in identifying porcine intramuscular fat-related traits, screening pig breeds with high intramuscular fat traits or in the genetic breeding of porcine intramuscular fat-related traits.

[0023] The genetic breeding method is preferably marker-assisted breeding;

[0024] The application of the aforementioned SNP molecular markers in gene editing or assisted identification of pig breeds;

[0025] The pigs mentioned are Danish Large White pigs or Qinchuan Black pigs;

[0026] A method for detecting intramuscular fat characteristics in pigs, comprising the following steps:

[0027] The above-mentioned SNP molecular markers on pig chromosome 8 were detected, and the intramuscular fat trait of pigs was determined based on whether the single nucleotide of the SNP site was C or T. Among them, the intramuscular fat content of pigs with the TT genotype was lower than that of pigs with the CT or CC genotypes.

[0028] The pigs mentioned are Danish Large White pigs or Qinchuan Black pigs;

[0029] The method for screening pig breeds with high intramuscular fat using the above-mentioned SNP molecular markers includes the following steps:

[0030] The above-mentioned SNP molecular markers were detected on the 8th chromosome of pigs. Based on the SNP sites of the SNP molecular markers, individuals with the TT genotype were eliminated, while individuals with the CT or CC genotypes were retained. Among them, the intramuscular fat content of pigs with the TT genotype was lower than that of pigs with the CT or CC genotypes.

[0031] The detection method includes the following steps:

[0032] (1) Extract genomic DNA from the pigs to be tested;

[0033] (2) Using the primer pairs mentioned above or the primer pairs in the kit mentioned above as amplification primers, and using the genomic DNA of the pig to be tested obtained in step (1) as template DNA, PCR amplification is performed to obtain PCR amplification products.

[0034] (3) Sequencing the PCR amplification products to obtain sequencing results;

[0035] (4) Based on the sequencing results, determine the genotype of the SNP molecular markers;

[0036] The pigs mentioned are Danish Large White pigs or Qinchuan Black pigs;

[0037] A method for genetic improvement of pigs, comprising the following steps:

[0038] The sites of the above-mentioned SNP molecular markers in the core breeding pig population were determined, and corresponding selections were made based on the molecular markers: breeding pig individuals with the CT or CC genotype at locus 43,738,941 on chromosome 8 of the International Swine Reference Genome Version 11.1 were selected from the core breeding pig population, and breeding pig individuals with the TT genotype were culled, so as to increase the frequency of allele C at this locus in each generation, thereby improving the intramuscular fat trait of offspring pigs;

[0039] The pigs mentioned are Danish Large White pigs or Qinchuan Black pigs;

[0040] To fully explore the unique local pig breed resources of Shaanxi Province, transform resource advantages into economic drivers, and meet market demand for high-quality breeding pigs and diversified pork products, this study focuses on the Qinchuan Black Pig and the Danish Large White Pig. Previous research used multi-omics analysis to identify candidate genes related to intramuscular fat traits in the Qinchuan Black Pig. This invention utilizes genome-wide selection signal scanning and binary GWAS to identify key molecular targets influencing intramuscular fat traits in the Qinchuan Black Pig. These targets are located at positions 43,738,941 on chromosome 8 of the pig, and belong to the T>C mutation. Polymorphisms at this site show significant genotypic frequency differentiation in high and low intramuscular fat populations, thus affecting intramuscular fat traits. This invention provides a scientific basis for the protection and economic enhancement of local pig breeds.

[0041] The present invention has the following advantages and effects compared with the prior art:

[0042] (1) This invention studies and identifies the molecular markers related to intramuscular fat traits in pigs located on the nucleotide sequence of chromosome 8 of pigs, verifies their effect on intramuscular fat traits, and finally establishes an efficient and accurate molecular marker-assisted breeding technology. This technology is then applied to the genetic improvement of increasing intramuscular fat traits in breeding pigs, thereby increasing the intramuscular fat content of offspring pigs, improving pork quality, increasing enterprise economic profits, and enhancing core competitiveness.

[0043] (2) The present invention provides a primer pair and kit for detecting the above-mentioned SNP molecular markers. With the primer pair and kit, an efficient and accurate molecular marker-assisted breeding technology can be established to quickly and accurately select intramuscular fat traits and accelerate the breeding process.

[0044] (3) By selecting the dominant allele of the SNP, the present invention can increase the frequency of the dominant allele generation by generation, increase the intramuscular fat trait of breeding pigs, select superior breeding pigs with intramuscular fat trait, accelerate the progress of pig genetic improvement, and thus effectively improve the economic benefits of breeding pigs. Attached Figure Description

[0045] Figure 1 This is a graph showing the results of genome-wide selection signal scanning (Fst) on chromosome 8 of Qinchuan Black Pig and Danish Large White Pig using Plink software; where: the x-axis represents the chromosome number of the pig; and the y-axis represents the Fst value.

[0046] Figure 2 This is a Manhattan plot of a binary genome-wide association study (GWAS) conducted using the Logistic Mixed Model in Plink software to analyze intramuscular fat traits on chromosome 8 in Qinchuan Black pigs and Danish Large White pigs. The plot shows the x-axis representing the chromosome number of the pig and the principal y-axis representing -log(s). 10 P-value.

[0047] Figure 3 This is a graph showing the genotypic differences between Qinchuan Black Pig and Danish Large White Pig at position 125 of the 5' end. Detailed Implementation

[0048] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0049] Example 1: Experimental Subjects, Phenotypic Determination, and DNA Sample Collection

[0050] (1) Experimental animals

[0051] The experimental pig population used in this invention consists of the core population of Danish Large White pigs from a company in Shaanxi Province and the Qin Chuan Black pig (formerly known as Qinling Black, QLB, a new breed bred by crossbreeding Guanzhong Black pig and Danish Large White pig) bred by the Animal Husbandry Teaching and Experiment Base of Northwest A&F University.

[0052] This experiment selected 560 Danish Large White pigs and 361 Qinchuan Black pigs from the experimental herd, with detailed herd pedigree records. The pigs had free access to feed and water, and the feeding methods and conditions remained consistent throughout the experiment, adhering to standard practices.

[0053] (2) Phenotype

[0054] For the binary trait GWAS, since previous studies have shown that the intramuscular fat of Qinchuan Black Pig is significantly higher than that of Danish Large White Pig (Yu T, Tian X, Li D, et al. Transcriptome, proteome and metabolome analysis provide insights on fat deposition and meat quality in pig[J]. Food Research International, 2023, 166:112550-.DOI:10.1016 / j.foodres.2023.112550.), the phenotype of Qinchuan Black Pig with high intramuscular fat is set as "1", and the phenotype of Danish Large White Pig with low intramuscular fat is set as "0".

[0055] (3) Collection of pig tissue samples

[0056] To extract DNA, ear samples were collected from 921 pigs and stored at -80°C for subsequent DNA extraction and sequencing.

[0057] Example 2

[0058] (1) Sample DNA extraction

[0059] ① Prepare the lysis buffer: Add 10mM Tris-HCl (pH 8.0), 1mM EDTA (pH 8.0), 100mM NaCl, and 0.5% (w / v) SDS to 1.8mL of deionized water and mix thoroughly. Then add 25μL of proteinase K at a final concentration of 20mg / mL (final proteinase K concentration approximately 0.25mg / mL). Aliquot the above reagents into 2.0mL EP tubes, 1.925mL per tube. Preheat the aliquoted EP tubes in a 56℃ water bath for 10-15min to ensure thorough mixing and reach the appropriate reaction temperature.

[0060] ② Take about 60 mg of ear tissue sample from Danish Large White pigs and place it in an EP tube. Cut the tissue into small pieces, add 600 μL of lysis buffer, invert the tube several times, and then add 10 μL of 20 mg / mL proteinase K. Mix thoroughly.

[0061] ③ Incubate at 56℃ for 1-2 hours to digest the tissue.

[0062] ④ After complete digestion, add an equal volume (600 μL) of Tris-saturated phenol, centrifuge at 4℃ and 12000 r / min for 10 min, and transfer the supernatant to a new 2.0 mL EP tube.

[0063] ⑤ Repeat the previous step.

[0064] ⑥ Transfer the supernatant to a new 2.0 mL EP tube, add an equal volume of phenol / chloroform / isoamyl alcohol (V25:V24:V1), and mix vigorously by inverting.

[0065] ⑦ Centrifuge at 12,000 r / min for 10 min at 4℃, and transfer the supernatant to a new 2.0 mL EP tube.

[0066] ⑧ Repeat step ④.

[0067] ⑨ Add an equal volume of chloroform / isoamyl alcohol (V24:V1), slowly invert for 10 min, centrifuge at 4℃ and 12000 r / min for 10 min, and transfer 300 μL of the upper aqueous phase to a centrifuge tube.

[0068] ⑩ Add 750 μL of anhydrous ethanol, mix gently, and the DNA will precipitate as a white flocculent. Centrifuge at 4°C and 14000 r / min for 10 min, and carefully discard the supernatant to keep the precipitate.

[0069] Centrifuge again at 4℃ and 14000r / min for 2 minutes to remove any remaining anhydrous ethanol from the tube.

[0070] Add 20-200 μL of TE to dissolve the precipitate.

[0071] Nanodrop detects DNA purity (OD260 / 620 ratio), and Qubit precisely quantifies DNA concentration. Once the OD260 / 620 ratio of all DNA samples is between 1.8 and 2.0, and the DNA concentration meets the experimental requirements, it is used for subsequent library construction and sequencing.

[0072] (2) Whole genome resequencing

[0073] The whole-genome resequencing data were all completed by BGI Genomics Co., Ltd. in Shenzhen. The specific methods and steps are as follows:

[0074] ① Library construction: The qualified DNA extracted in step (1) is randomly fragmented and processed into a sequencing library through steps such as DNA fragment end repair, 3' end addition of polyA, sequencing adapter configuration, and PCR amplification.

[0075] ② Sequencing: Resequencing was performed on BGI's DNB SEQ-T7 platform, with an average sequencing depth of 11.7×, yielding raw sequencing data in FASTQ format.

[0076] (3) Resequencing data analysis

[0077] ① Use the Fastp software (v0.20.0) with default parameters to perform quality control on the raw sequencing data obtained in step (2), including filtering out adapter sequences and low-quality reads, to obtain the quality-controlled sequencing data in FASTQ file format;

[0078] ② Using the BWA-mem module in the BWA-MEM software (v0.7.17) with default parameters, align the quality-controlled sequencing data from step ① to the International Swine Reference Genome version 11.1 to obtain the aligned BAM file;

[0079] ③ Use the SortSam and MarkDuplicates functions of Picard Tools software to sort the BAM files after alignment in step ② and remove duplicate sequences;

[0080] ④ SNP calling was performed using the HaplotypeCaller module of GATK software to accurately identify SNPs and obtain a VCF file containing information on all SNP sites; the variants were further filtered using the VariantFiltration module of GATK software, and 23,271,982 SNPs were finally identified.

[0081] (4) Genome-wide selection signal scanning analysis

[0082] Based on the SNP locus information (VCF file) obtained in step (5), the Fst (fixation index) method, developed by American geneticist Wright, was selected. VCFtools (v0.1.16) was used to perform a genome-wide selection scan analysis on Danish Large White pigs and Qinchuan Black pigs. A sliding window of 50kb and a step size of 25kb were set to calculate the Fst value between Danish Large White pigs and Qinchuan Black pigs. The regions corresponding to the top 1% of Fst values ​​were designated as candidate regions, and the annotated genes within these regions were considered candidate genes.

[0083] (5) Binary genome-wide association analysis (GWAS)

[0084] We used Plink software, developed by Shaun Purcell et al. from Harvard University, and employed a logistic mixed-effects model to perform a binary GWAS analysis between variant sites and traits.

[0085] ①The logical mixed effects model is as follows:

[0086] Suppose there is a binary phenotypic variable yi (taking values ​​of 0 or 1) representing the trait of the i-th individual (e.g., whether it has a high intramuscular fat trait), then the logistic mixed effects model can be expressed as:

[0087] logit(P(yi=1))=α+βxi+gi

[0088] Here, logit(p) = log(1-pp) is the logistic transformation, which converts the probability p to a linear scale. α is the intercept term, and β is the additive effect (fixed effect) of the candidate SNP to be tested, corresponding to the coefficient of the SNP genotype indicator variable xi. xi is also encoded as 0 and 1, representing different genotypes of the SNP. gi is the polygenic effect (random effect), representing the influence of all other genetic variations on the individual i phenotype, usually estimated based on the genomic relation matrix (GRM). In the logistic mixed effects model, the polygenic effect gi is usually assumed to follow a multivariate normal distribution, with its variance-covariance matrix determined by the GRM. This model can simultaneously consider fixed effects (the effect of a specific SNP) and random effects (polygenic background), thus more accurately assessing the association between SNPs and binary traits.

[0089] ② Binary GWAS analysis method between variant sites and traits

[0090] The SNP locus information results (VCF file) obtained in step (5) were converted into Plink binary format files using Plink software (v1.90), and variants with a variant detection rate of less than 10% and a minor allele frequency (MAF) of less than 5% were filtered out. Finally, binary genome-wide association analysis was performed using Plink software (v1.90), with a significance threshold of 0.05 / n, and regions 100kb upstream and downstream of significant loci were annotated.

[0091] (6) Association analysis between different genotypes and intramuscular fat phenotypic traits

[0092] The results of the whole-genome selection signal scanning analysis are shown in Figure 1 ,from Figure 1 As can be seen, the Fst value of the window corresponding to the MSMO1 gene is relatively high, indicating that the gene is highly differentiated in the Qinchuan black pig population and the large white pig population.

[0093] To further identify SNP loci influencing intramuscular fat traits, we performed a binary genome-wide association analysis, the results of which are shown below. Figure 2 GWAS analysis revealed a major-effect QTL (Lipid accretion rate QTL) on chromosome 8 (Chr8: 43,528,960bp-62,028,768bp) significantly influencing intramuscular fat traits. The most significantly associated locus, g.125T>C (the T>C mutation at position 43,738,941 on chromosome 8 in the international pig reference genome version 11.1), was of particular interest. Figure 2Analysis of Table 1 shows that the SNP site g.125T>C of the molecular marker is highly significantly correlated with intramuscular fat traits (P<0.001), indicating that this molecular marker significantly affects intramuscular fat traits in pigs. It is hoped that the intramuscular fat traits in pigs can be improved during the breeding process through assisted selection of this SNP site.

[0094] Additionally, according to Table 1 and... Figure 3 Furthermore, it was found that in the Danish Large White pig population with low intramuscular fat, the proportion of individuals with the TT genotype reached over 98%, while the proportion of individuals with the CC genotype was 0. This indicates that for the trait of low intramuscular fat, the TT genotype is the dominant allele in the Danish Large White pig population, meaning that the TT genotype may be related to low intramuscular fat in Danish Large White pigs. In contrast, in the Qinchuan Black pig population with high intramuscular fat, the proportion of individuals with the TT genotype was approximately 0.003%. This suggests that in the Qinchuan Black pig population, for the trait of high intramuscular fat, the TT genotype may be detrimental to the intramuscular fat trait. This conclusion corroborates the previous one.

[0095] In the low intramuscular fat Danish Large White pig population, the CC genotype is absent, the CT genotype is extremely low, and the TT genotype is extremely high. Conversely, in the high intramuscular fat Qinchuan Black pig population, the CC and CT genotypes are more prevalent. This indicates that, given the correlation between alleles T and C and intramuscular fat traits in pigs, pigs with the TT genotype have a lower percentage of intramuscular fat, while those with the CC and CT genotypes have a higher percentage. Intramuscular fat is a crucial trait for assessing pork quality, affecting meat quality, texture, flavor, nutritional value, and consumer acceptance. Based on the above analysis, pigs with the TT genotype have low intramuscular fat content and poor meat quality. Therefore, in breeding processes, it is necessary to cull TT genotype pigs and retain those with the CC and CT genotypes to gradually increase the frequency of allele C at this locus. Currently, the dominant allele frequency in the Qinchuan Black pig population is approximately 70.0%, while it is 0 in the Danish Large White pig population, indicating significant potential for genetic improvement.

[0096] In addition, the number of individuals with the CC genotype in Danish Large White pigs was 0%, while the number of individuals with the CC genotype in Qinchuan Black pigs was 43.2%. The difference in this SNP genotype can also be used to help identify Qinchuan Black pigs and Danish Large White pigs.

[0097] Table 1. Correlation analysis of SNP sites g.125T>C of molecular markers with intramuscular fat traits.

[0098]

[0099]

[0100] Example 2: Target DNA Sequence Amplification and Sequencing

[0101] (1) Primer design

[0102] The DNA sequence of SEQ ID NO:1 on pig chromosome 8 was downloaded from the Ensembl website (http: / / asia.ensembl.org / index.html). Primers were designed using the primer design software Primer Premier 6.0 and synthesized by Sangon Biotech (Shanghai) Co., Ltd. The DNA sequences of the designed primers are shown below:

[0103] P001-F: 5'-CTTGGCTGTGGAGTATGTAGATTCA-3' (SEQ ID NO: 2);

[0104] P002-R: 5'-GAGATGTAAAGGGTTGAGAGGGATG-3' (SEQ ID NO: 3);

[0105] (2) PCR amplification

[0106] PCR amplification: Add 1 μL of DNA template, 3.4 μL of double-distilled water, 5 μL of 2×Taq PCRMasterMix with Loading Dye, and 0.3 μL each of primers P001-F and P002-R to a 10 μL reaction system; the PCR reaction conditions are: pre-denaturation at 94℃ for 5 min to fully untangle the DNA double strands; then perform 35 cycles of amplification, in each cycle first denaturing at 94℃ for 30 s to untangle the DNA double strands into single strands, then annealing at 64.5℃ for 30 s to allow the primers to specifically bind to the template DNA single strands, and finally extending at 72℃ for 45 s to synthesize new DNA strands under the action of DNA polymerase; after 35 cycles, perform a final extension at 72℃ for 5 min to ensure that the newly synthesized DNA strands are fully extended.

[0107] (3) DNA sequencing

[0108] DNA sequencing identification: Performed at BGI Genomics Co., Ltd. in Shenzhen, with two sequencing reactions (positive and negative). The obtained sequences were compared with the NCBI genome sequence to identify mutations at corresponding SNP sites. The sequencing results are shown below: CTTGGCTGTGGAGTATGTAGATTCACTTCTACCTGAGAATCCTCTGCAGGAACCATTTAAAAATGCTTGGAATTATATGTTGAACAAT M (T or C)ATACAAAGTTCCAGATTGCAACGTGGGGATCCCTCATAGTTCATGAGGCCCTTTATTTCTTTTTCTGTTTCACCTGGATTTTTGTTTCAATTTATACCTTACATGAAAAAGTACAAAATTCAGAAGGATAAACCAGAAACATGGGAAA ACCAGTGGAAATGCTTTAAAGTACTTCTGTTTAATCACTTTTGTATCCAGTTTCCTTTGATTTGTGGAACTTATTATTTTACGGAGTATTTCAGTATTCCTTACGATTGGGAAACAATGCCAAGATGGTACATTGCTTTGGCAAGATG CTTTGGCTGTGCTGTGATTGAGGATACCTGGCACTATTTCCTGCATAGCCTTACACCACAAAAGAATATATAAATATATTCATAAAATTCATCATGAGTTTCAGGCTCCATTTGGGATGGAAGCTGAATATGCACACCCTCTGGA AACCCTAATTCTGGGAACTGGATTTTTCATTGGAATCATGCTGTTATGTGATCATGTTATTCTTCTTTGGGCCTGGGTGACCGTTCGTTTGATAGAAACTATCGATGTCCATAGTGGTTATGACATCCCTCTCAACCTTTACATCTC

[0109] Note: M marked in the sequence listing is the mutation site, indicated by an underline (the mutated base in parentheses represents the allele mutation). The positions of the primer sequences are indicated by bolding at the beginning and end of the sequence.

[0110] Example 3: Analysis of the g.125T>C effect of SNP sites on molecular markers

[0111] According to Table 1 and Figure 2 It is known that, for the intramuscular fat trait, the frequency of the dominant allele (CC) at the SNP locus g.125T>C is significantly higher in the Qinchuan Black pig population than in the Danish Large White pig population. Higher intramuscular fat content in pigs results in better meat quality, superior taste and flavor, and higher nutritional value. This will greatly improve the economic benefits of pig farming and generate wealth for enterprises. By selecting the dominant allele (C) for this SNP in individuals with SNP markers, economic benefits can ultimately be improved, thereby increasing enterprise profits.

[0112] This invention utilizes the detection of the mutation site at position 125 in the SEQ ID NO:1 sequence to conduct preliminary association analysis between its genotype and intramuscular fat trait in pigs, providing a new molecular marker for marker-assisted selection in pigs.

[0113] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. The application of a reagent for detecting SNP molecular markers in the auxiliary identification of pig breeds, characterized in that... Its SNP site corresponds to the T>C mutation at position 43,738,941 on chromosome 8 of the International Pig Reference Genome Version 11.1 reference sequence; The pigs mentioned are Danish Large White pigs and Qinchuan Black pigs, with the CC genotype being Qinchuan Black pigs; The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO: 1, where M in the sequence is T or C.

2. The application according to claim 1, characterized in that: The reagent comprises primers P001-F and P002-R, whose nucleotide sequences are shown below: P001-F: 5'-CTTGGCTGTGGAGTATGTAGATTCA-3', P002-R: 5'-GAGATGTAAAGGGTTGAGAGGGATG-3'.

Citation Information

Patent Citations

  • SNP molecular marker related to intramuscular fat in pork and application of SNP molecular marker

    CN112322753A

  • SNP molecular marker associated with intramuscular fat traits in pigs, use thereof, and method for detecting same

    WO2024021172A1