Application of molecular markers closely linked to the seed color trait in breeding of light seed color rapeseed varieties

By developing the molecular marker RSCA07-1, which is closely linked to the color trait of rapeseed seeds, and using KASP amplification technology and colorimeter to quantify the index, the lack of multi-dimensional indicators of rapeseed seed color was solved, enabling efficient breeding of light-colored seed rapeseed varieties and improving breeding efficiency and oil quality.

CN120330365BActive Publication Date: 2026-06-26ANKANG UNIV +1
View PDF 4 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
ANKANG UNIV
Filing Date
2025-04-18
Publication Date
2026-06-26

AI Technical Summary

Technical Problem

The lack of molecular markers for multi-dimensional indicators of rapeseed color in existing technologies leads to low breeding efficiency for light-colored rapeseed varieties, making it difficult to conduct efficient screening through molecular marker technology.

Method used

A molecular marker RSCA07-1 closely linked to the color trait of rapeseed grains was developed. It is located at the 29926716th base position on chromosome A07 of the ZS11.v0 genome and is a polymorphism caused by A or G mutation. Genotyping was performed using KASP amplification technology, and breeding was carried out in combination with colorimeter-quantified indicators of lightness (L*), yellowness (b*), and saturation (c*).

Benefits of technology

It improves the accuracy of grain color phenotypic analysis, significantly shortens the breeding cycle, and provides an efficient molecular tool for the breeding of light-grained Brassica napus, thereby improving oil quality and processing performance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120330365B_ABST
    Figure CN120330365B_ABST
Patent Text Reader

Abstract

The present application belongs to the field of molecular biology and genetic breeding technology, and specifically discloses a molecular marker closely linked to the seed grain color trait of Brassica napus and application of the molecular marker in breeding of a light-colored seed grain Brassica napus variety. The present application first uses a color difference meter to analyze the color difference of the seed grain of Brassica napus, and identifies a gene locus RSC.A07 for controlling the brightness (L*), yellowness (b*) and saturation (c*) of the seed grain. The locus is located between 29889019-30276565 bp of the A07 chromosome of the ZS11.v0 genome of Brassica napus. A molecular marker closely linked to the locus is RSCA07-1, which is located at the 29926716th base position on the A07 chromosome and is a polymorphism caused by A or G mutation. The molecular marker is closely linked to the target trait, and can be used for molecular assistance in breeding of light-colored seed grain Brassica napus, significantly shortening the breeding cycle, and at the same time providing an efficient molecular tool for breeding of light-colored seed grain Brassica napus variety, and helping to improve oil quality and upgrade the industry.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of molecular biology and genetic breeding technology, specifically relating to gene loci of the color trait of Brassica napus seeds, especially molecular markers closely linked to the color trait of Brassica napus seeds and their application in the breeding of light-colored Brassica napus varieties. Background Technology

[0002] Rapeseed is an important oilseed crop in my country, and its seed color directly affects oil quality and market acceptance. In traditional breeding, seed color screening relies on naked-eye observation, which is inefficient and easily affected by environmental factors. With the development of molecular marker technology, screening for target traits through gene mapping has become an important method in modern breeding. However, current methods for characterizing the seed color of Brassica napus are relatively limited, mostly using color scanners. This study uses software to obtain the RGB values ​​of seed images, converts them to CMYK values, and uses the chromaticity value (Y*100) as a standard to measure seed coat color for QTL detection and other genetic studies.

[0003] Chinese patent CN109022458B (Shanxi University) discloses a BnHXK9 gene related to insect resistance and seed coat color in Brassica napus and its application in preparing aphid-resistant plants. Chinese patent application CN110511944A (Huazhong Agricultural University) discloses a BnTT8 gene controlling seed coat color in Brassica napus and its application in breeding yellow-seeded Brassica napus. However, currently, QTL identification using colorimeter-based quantitative indicators such as lightness (L*), yellowness (b*), and saturation (c*) is lacking in Brassica napus, and molecular markers targeting multi-dimensional indicators of seed color are not yet available. This limits the efficient breeding of light-seeded Brassica napus varieties. Therefore, developing molecular markers closely linked to multi-dimensional indicators of seed color is of great significance for further breeding light-seeded Brassica napus varieties and accelerating the improvement of rapeseed quality. Summary of the Invention

[0004] The main technical problem solved by this invention is to provide a molecular marker closely linked to the color trait of Brassica napus seeds for the breeding of light-colored seed rapeseed varieties.

[0005] Meanwhile, the present invention provides a kit for detecting molecular markers closely linked to the color trait of rapeseed grains.

[0006] To solve the above-mentioned technical problems, the present invention provides the following technical solutions:

[0007] The application of a molecular marker closely linked to the seed color trait of Brassica napus in the breeding of light-seeded rapeseed varieties. The molecular marker is RSCA07-1, located at the 29926716th base position on chromosome A07 of the ZS11.v0 genome, and is a polymorphism caused by an A or G mutation.

[0008] This invention identifies a previously unreported locus associated with seed color in Brassica napus, RSC.A07. This locus is located on chromosome A07 of the Brassica napus ZS11.v0 genome (see BnIR Brassica napus multi-omics database, Genome ID: ZS11.v0), between 29889019 and 30276565 bp, and is associated with the lightness (L*), yellowness (b*), and saturation (c*) of seed color (these three color indicators are measured by a colorimeter). The molecular marker closely linked to the RSC.A07 locus is RSCA07-1, located at base position 29926716 on chromosome A07, and is a polymorphism caused by an A or G mutation.

[0009] As a preferred embodiment of the present invention, the application includes:

[0010] Using the genomic DNA of the rapeseed sample as a template, KASP amplification was performed using a primer set designed and synthesized based on the RSCA07-1 molecular marker to obtain the genotype results. Based on the results, rapeseed varieties were selected and bred.

[0011] Specifically, the primer set includes two forward amplification primers, RSCA07-1Fg and RSCA07-1Fa (with the corresponding tag sequences of FAM and HEX fluorescent groups added respectively), and one reverse amplification primer, RSCA07-1R, as shown below:

[0012] RSCA07-1Fg: 5'-GAAGGTGACCAAGTTCATGCTTTTGGCCGTTTCACATGGTACCCGG-3';

[0013] RSCA07-1Fa:5'-GAAGGTCGGAGTCAACGGATT TTGGCCGTTTCACATGGTACCCG A-3';

[0014] RSCA07-1R: 5'-GCTCTTGATCGTGATTCACAGAGTG-3'.

[0015] Specifically, the source sequence for the KASP amplification is shown below:

[0016] TTGGCCGTTTCACATGGTACCCGGTCTATTTCATCTGTGACGTCCAAATGCAGTGAGTTCCGCAAGAAATCTATAGCTTCAGATCTGATATCAACCGCCACTTTCTCGGGTCCAGACACAGAGAAAAATATCTCATCCATA AATCTGCAACAAATAAACTCTGACAGCAATGTCCTTCTCCGGATCACTTTTCAAATCTTCCTCTCCAGCCTTCTCCTGAACCAGGACCGAAGCTTTGAGCCTAAGCCATCTTCAACACTCTGTGAATCACGATCAAGAGC.

[0017] Specifically, the reaction system (10 μL) for KASP amplification is as follows: 1 μL of 100 ng genomic DNA, 1.4 μL of 10 μM primer set, 5 μL of HiGeno 2×Probe Mix, and the remainder is water.

[0018] Specifically, the reaction program for KASP amplification is as follows: 10 cycles of 95℃ for 10 min, 95℃ for 20 s and 61℃-55℃ (decreasing by 0.6℃ per cycle) for 40 s, followed by 30-34 cycles of 95℃ for 20 s and 55℃ for 40 s, and finally reading the fluorescence signal at 25℃ for 1 min.

[0019] Specifically, after the KASP amplification is completed, the fluorescence signal is read using Roche LightCycer480 software, and then the fluorescence signal is analyzed and converted using the online software snpdecoder (http: / / www.snpway.com / snpdecoder / ). The genotype result is output according to the different fluorescence signal colors.

[0020] A kit for detecting molecular markers closely linked to the color trait of rapeseed seeds, the kit comprising at least a primer set designed and synthesized based on the RSCA07-1 molecular marker;

[0021] The RSCA07-1 molecular marker is located at the 29926716th base position on chromosome A07 of the ZS11.v0 genome, and is a polymorphism caused by an A or G mutation.

[0022] In a preferred embodiment of the present invention, the primer set includes two forward amplification primers RSCA07-1Fg and RSCA07-1Fa and one reverse amplification primer RSCA07-1R, the sequences of which are shown below:

[0023] RSCA07-1Fg: 5'-GAAGGTGACCAAGTTCATGCTTTTGGCCGTTTCACATGGTACCCGG-3';

[0024] RSCA07-1Fa: 5'-GAAGGTCGGAGTCAACGGATTTTGGCCGTTTCACATGGTACCCGA-3';

[0025] RSCA07-1R: 5'-GCTCTTGATCGTGATTCACAGAGTG-3'.

[0026] As a preferred embodiment of the present invention, the kit may further include an amplification reaction premix containing a dual-color fluorescent probe, such as HiGeno 2×Probe Mix, which is a commercially available product.

[0027] Specifically, the amplification reaction premix includes DNA polymerase, PCR buffer, dNTPs, a dual-color fluorescent probe, and Mg. 2+ .

[0028] The beneficial effects of this invention are:

[0029] This invention is the first to utilize a colorimeter for color difference analysis of rapeseed seeds and identify a gene locus, RSC.A07, that controls the lightness (L*), yellowness (b*), and saturation (c*) of seed color. This locus, previously unreported, is a novel site influencing the color of Brassica napus seeds, which is beneficial for breeding light-colored rapeseed. Light-colored rapeseed seeds have less pigment content, lower fiber content, and higher oil content, reducing or eliminating the need for decolorization steps and exhibiting better processing performance. These are ideal breeding traits for Brassica napus and represent one of the key research directions in China.

[0030] The gene loci regulating the seed color trait of Brassica napus provided by this invention are helpful for the breeding of light-seeded Brassica napus varieties, providing gene resources for the breeding of new light-seeded Brassica napus varieties. Simultaneously, the molecular markers closely linked to the loci associated with the seed color trait of Brassica napus provided by this invention offer usable markers for molecular-assisted selection in the future breeding of new light-seeded Brassica napus varieties.

[0031] In summary, this invention has the following beneficial effects: it introduces colorimetric quantitative indicators (L*, a*, b*, c*, and h*) into the rapeseed grain color evaluation system for the first time, which can improve the accuracy of phenotypic analysis; the molecular marker RSCA07-1 is closely linked to the target trait and can be used for molecular assistance in the breeding of light-seeded rapeseed, significantly shortening the breeding cycle, and providing an efficient molecular tool for the breeding of light-seeded rapeseed varieties, thus contributing to the improvement of oil quality and industrial upgrading. Attached Figure Description

[0032] Figure 1 The image shows the associated locus RSC.A07, which was identified in the experimental example based on genome-wide association analysis, controlling the traits of seed brightness (L*), yellowness (b*), and saturation (c*) of rapeseed. The image on the left is the Manhattan plot of the genome-wide association analysis of the trait, and the rapeseed image is its corresponding QQ plot.

[0033] Figure 2 The experiment used molecular markers to analyze the differences in grain color phenotypes between two haplotypes of RSC.A07; the vertical axis indicates the three genotypes of RSCA07-1 and the corresponding number of Brassica napus germplasm resources.

[0034] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings obtained in the experimental examples have been briefly described above. It should be understood that the above drawings only show some experimental examples of the present invention and should not be considered as any limitation on the scope of protection of the claims. For those skilled in the art, other related drawings can be obtained based on these drawings without any creative effort. Detailed Implementation

[0035] The technical solution of the present invention will be clearly and completely described below with reference to specific embodiments and experimental examples. However, those skilled in the art should understand that the embodiments are only used to illustrate the technical solution of the present invention and should not be regarded as limiting the scope of protection of the present invention. Based on the following embodiments, all other implementation schemes obtained by those skilled in the art without creative effort, such as implementation schemes obtained by modification, variation or simple substitution, should fall within the scope of protection of the present invention.

[0036] Unless otherwise specified, the experimental methods used in the following embodiments and experimental examples are conventional methods; the raw materials, reagents, instruments, etc. used are all commonly used in the field and are available to the public or can be obtained through commercial means, unless otherwise specified; the terms and abbreviations involved have their conventional meanings in the field.

[0037] Experimental Example

[0038] The discovery of loci associated with the color trait of Brassica napus seeds includes the following steps:

[0039] (1) Obtaining color difference index of grains from natural population materials

[0040] The color of seeds from 519 natural populations of freely crossed seeds was detected using a colorimeter. The specific method was as follows: dried seeds were spread evenly in a 1.2cm thick glass dish, completely covering the bottom of the dish to a depth of 0.6cm. Then, a calibrated colorimeter was used to analyze the color difference of the seeds, using the color difference value of the light-colored seed N53-2 as the standard. Five color difference indices were obtained: L* (lightness value), a* (green-red hue, positive values ​​indicate red tones), b* (blue-yellow hue, positive values ​​indicate yellow tones), c* (saturation), and h* (hue).

[0041] (2) Identification of seed color-related loci through genome-wide association analysis (GWAS)

[0042] Genome-wide association analysis (GWAs) was performed using phenotypic data of grain color indices (L*, a*, b*, c*, and h*) obtained from whole-genome resequencing genotyping and colorimetry of 519 natural populations. Specifically, a GEMMA mixed linear model was used for the association analysis, incorporating two correction modes: kinship correction and population stratification correction. The kinship matrix was calculated using GEMMA, and population stratification correction was performed using the PCA matrix calculated by GCTA software. The significance threshold was determined using GEC (GeneticType I error calculator), yielding 1,454,769 effective independent SNPs with a Bonferroni-corrected p-value of 6.87E-7 (0.05 / n, -log10(P) = 6.16). Significant loci with adjacent lengths less than the genome-wide average decay distance (27.3 kb) were merged to obtain candidate association regions for each trait. GWAS analysis of five grain color indicators (L*, a*, b*, c*, and h*) showed that a significantly associated region RSC.A07 was detected on chromosome A07 of the ZS11 reference genome (Genome ID: ZS11.v0, BnIR rapeseed multi-omics database, URL: https: / / yanglab.hzau.edu.cn / BnIR / download?module=genomics) within the range of 29889019-30276565 bp. This site was associated with L*, b*, and c*. Figure 1 In the natural population of rapeseed, all grain colors showed positive b* values, indicating that the b* value represents the yellowness of the grain, while L* and c* represent the lightness and color uniformity of the grain. Therefore, the RSC.A07 site determines the color depth and uniformity of Brassica napus grains, and its tightly linked molecular marker can be used for molecular-assisted selection of light-grained Brassica napus.

[0043] (3) Develop molecular markers tightly linked to the RSC.A07 site.

[0044] Based on the chromosomal region of the RSC.A07 locus and combined with SNP data obtained from parental resequencing, homozygous and polymorphic SNP loci within the candidate region were screened to develop competitive allele-specific PCR (KASP) markers. Specifically, within the RSC.A07 locus-associated region, SNPs with A / G variations at position 29926716 in the natural population were screened. Based on the base sequence information at this position, two forward amplification primers, RSCA07-1Fg and RSCA07-1Fa, were developed, with corresponding tag sequences for FAM and HEX fluorescent groups added, respectively. The two forward primers terminate at position 29926716, with base types A and G, respectively. A reverse primer, RSCA07-1R, was also developed for reverse amplification, as shown in Table 1 (SEQ ID NO: 1-3).

[0045] Table 1 Primer set developed based on RSCA07-1 molecular marker.

[0046]

[0047] The source sequence for KASP amplification based on the RSCA07-1 molecular marker is shown below (SEQ ID NO: 4):

[0048] TTGGCCGTTTCACATGGTACCCG GTCTATTTCATCTGTGACGTCCAAATGCAGTGAGTTCCGCAAGAAATCTATAGCTTCAGATCTGATATCAACCGCCACTTTCTCGGGTCCAGACACAGAGAAAAATATCTCATCCATAAATCTGCAACA ATAAACTCTGACAGCAATGTCCTTCTCCGGATCACTTTTCAAATCTTCCTCTCCAGCCTTCCTCCTGAACCAGGACCGAAGCTTTGAGCCTAAGCCATCTTCAACACTCTGTGAATCACGATCAAGAGC.

[0049] (4) Population genotyping analysis using the molecular marker RSCA07-1

[0050] The designed KASP molecular marker RSCA07-1 was used to detect rapeseed germplasm resources. The KASP primer mixture (50 μL) consisted of: 6 μL of primer RSCA07-1Fg, 6 μL of primer RSCA07-1Fa, and 15 μL of primer RSCA07-1R, with the remainder made up with double-distilled water. The PCR reaction mixture (10 μL) consisted of: 5 μL of HiGeno 2×Probe Mix (purchased from Beijing Jiacheng Biotechnology Co., Ltd.), 1 μL of 100 ng genomic DNA, 1.4 μL (10 μM) of primer mix, with the remainder made up with double-distilled water. The reaction conditions were: 95℃ for 10 min, 95℃ for 20 s, and 61℃-55℃ (decreasing by 0.6℃ per cycle) for 40 s for 10 cycles, followed by 30-34 cycles of 95℃ for 20 s and 55℃ for 40 s, with a final fluorescence signal read at 25℃ for 1 min. After KASP amplification, the fluorescence signal was read using Roche LightCycer 480 software, and then the fluorescence signal was analyzed and converted using the online software snpdecoder (http: / / www.snpway.com / snpdecoder / ). Genotype results were output based on the different fluorescence signal colors. The entire detection process was simple to operate. The GG and A / G genotypes showed higher brightness, yellowness, and color uniformity in their seeds compared to the AA genotype. Figure 2 It has a good selection effect on light-colored seed Brassica napus.

[0051] Example 1

[0052] This embodiment provides the application of a molecular marker closely linked to the seed color trait of Brassica napus in the breeding of light-seeded rapeseed varieties. The molecular marker is RSCA07-1, located at base position 29926716 on chromosome A07 of the ZS11.v0 genome, and is a polymorphism caused by an A or G mutation. The application includes:

[0053] Using the genomic DNA of the rapeseed sample as a template, KASP amplification was performed using a primer set designed and synthesized based on the RSCA07-1 molecular marker to obtain the genotype results, and rapeseed varieties were selected and bred based on the results.

[0054] The primer set includes two forward amplification primers, RSCA07-1Fg and RSCA07-1Fa (with the corresponding tag sequences of FAM and HEX fluorescent groups added respectively), and one reverse amplification primer, RSCA07-1R, with the sequences shown below:

[0055] RSCA07-1Fg: 5'-GAAGGTGACCAAGTTCATGCTTTTGGCCGTTTCACATGGTACCCGG-3';

[0056] RSCA07-1Fa: 5'-GAAGGTCGGAGTCAACGGATTTTGGCCGTTTCACATGGTACCCGA-3';

[0057] RSCA07-1R: 5'-GCTCTTGATCGTGATTCACAGAGTG-3';

[0058] The reaction system (10 μL) for KASP amplification was as follows: 100 ng genomic DNA 1 μL, 10 μM primer set 1.4 μL, HiGeno 2×Probe Mix 5 μL, and the remainder was water;

[0059] The reaction program for KASP amplification is as follows: 10 cycles of 95℃ for 10 min, 95℃ for 20 s and 61℃-55℃ (decreasing by 0.6℃ per cycle) for 40 s, followed by 30-34 cycles of 95℃ for 20 s and 55℃ for 40 s, and finally reading the fluorescence signal at 25℃ for 1 min.

[0060] After the KASP amplification was completed, the fluorescence signal was read using Roche LightCycer480 software, and then the fluorescence signal was analyzed and converted using the online software snpdecoder (http: / / www.snpway.com / snpdecoder / ). The genotype results were output according to the different fluorescence signal colors, and then rapeseed varieties were selected based on the genotype results.

[0061] Example 2

[0062] This embodiment provides a kit for detecting molecular markers closely linked to the color trait of rapeseed grains, comprising: a primer set designed and synthesized based on the RSCA07-1 molecular marker and HiGeno 2×Probe Mix (purchased from Beijing Jiacheng Biotechnology Co., Ltd.);

[0063] The RSCA07-1 molecular marker is located at the 29926716th base position on chromosome A07 of the ZS11.v0 genome, and is a polymorphism caused by an A or G mutation;

[0064] The primer set includes two forward amplification primers, RSCA07-1Fg and RSCA07-1Fa, and one reverse amplification primer, RSCA07-1R, with the sequences shown below:

[0065] RSCA07-1Fg:5'-GAAGGTGACCAAGTTCATGCT TTGGCCGTTTCACATGGTACCCG G-3';

[0066] RSCA07-1Fa:5'-GAAGGTCGGAGTCAACGGATT TTGGCCGTTTCACATGGTACCCG A-3';

[0067] RSCA07-1R: 5'-GCTCTTGATCGTGATTCACAGAGTG-3'.

[0068] Although the technical solution of the present invention has been described in detail above with general descriptions, specific embodiments, and experimental examples, it should be noted that the embodiments and experimental examples are only used to illustrate the technical solution and technical effects of the present invention, and should not be regarded as any limitation on the scope of protection of the present invention. Simple modifications, alterations, or improvements made based on the technical concept of the present invention are all within the scope of protection claimed by the present invention.

Claims

1. The application of a molecular marker closely linked to the seed color trait of Brassica napus in the breeding of light-seeded rapeseed varieties, characterized by: The applications include: Using the genomic DNA of the rapeseed samples to be tested as a template, KASP amplification was performed using a primer set designed and synthesized based on RSCA07-1 molecular markers to obtain genotype results, and GG and AG genotype materials were selected for breeding. The molecular marker, RSCA07-1, is located at the 29926716th base position on chromosome A07 of the ZS11.v0 genome, and is a polymorphism caused by an A or G mutation.

2. The application according to claim 1, characterized in that: The primer set includes two forward amplification primers, RSCA07-1Fg and RSCA07-1Fa, and one reverse amplification primer, RSCA07-1R, with the sequences shown below: RSCA07-1Fg: 5'-GAAGGTGACCAAGTTCATGCTTTTGGCCGTTTCACATGGTACCCGG-3'; RSCA07-1Fa: 5'-GAAGGTCGGAGTCAACGGATTTTGGCCGTTTCACATGGTACCCGA-3'; RSCA07-1R: 5'-GCTCTTGATCGTGATTCACAGAGTG-3'.

3. The application according to claim 2, characterized in that: The reaction system for KASP amplification was as follows: 100 ng genomic DNA 1 µL, 10 µM primer set 1.4 µL, HiGeno 2× Probe Mix 5 µL, with the remainder being water, for a total volume of 10 µL.

4. The application according to claim 2, characterized in that: The reaction procedure for KASP amplification was as follows: 10 cycles of 95℃ for 10 min, 95℃ for 20 s, and 61℃-55℃ for 40 s, with a temperature decrease of 0.6℃ per cycle, followed by 30-34 cycles of 95℃ for 20 s and 55℃ for 40 s, and finally reading the fluorescence signal at 25℃ for 1 min.

5. The application according to claim 1, characterized in that: After the KASP amplification is completed, the fluorescence signal is read using software, then the fluorescence signal is analyzed and converted, and the genotype result is output according to the different fluorescence signal colors.

6. A kit for detecting molecular markers closely linked to the color trait of rapeseed grains, characterized in that: The kit includes at least a primer set designed and synthesized based on the RSCA07-1 molecular marker; The RSCA07-1 molecular marker is located at the 29926716th base position on chromosome A07 of the ZS11.v0 genome, and is a polymorphism caused by an A or G mutation; The primer set includes two forward amplification primers, RSCA07-1Fg and RSCA07-1Fa, and one reverse amplification primer, RSCA07-1R, with the sequences shown below: RSCA07-1Fg: 5'-GAAGGTGACCAAGTTCATGCTTTGGCCGTTTCACATGGTACCCGG-3'; RSCA07-1Fa: 5'-GAAGGTCGGAGTCAACGGATTTTGGCCGTTTCACATGGTACCCGA-3'; RSCA07-1R: 5'-GCTCTTGATCGTGATTCACAGAGTG-3'.

Citation Information

Patent Citations

  • A study on insect resistance and seed coat color correlation in Brassica napus. HXK9 Genes and their applications

    CN109022458B

  • Gene for controlling color of cabbage type rape seed coats, acquiring method for cabbage type rape yellow seed mutant material and application of acquiring method

    CN110511944A

  • Method for rapidly detecting expression of ANS (Anthocyanidin Synthetase) genes from different sources in rape seed capsule and application thereof

    CN102433379A

  • SNP molecular marker combination of brassica napus l. and application method thereof

    US20240315184A1