Chicken infectious anemia virus recombinant VP2 protein and application thereof in virus detection
By using the ELISA kit developed by the recombinant VP2 protein of chicken infectious anemia virus, the problem of detecting chicken infectious anemia virus antibodies was solved, and efficient and specific detection of CIAV antibodies was achieved to ensure the safety of live vaccines and poison species for avian use.
Patent Information
- Application Number
- CN202510487296.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-17
- Publication Date
- 2025-07-22
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
The prior art is difficult to effectively detect the infectious anemia virus (CIAV) antibodies of chickens, resulting in the contamination of exogenous viruses in live avian vaccines, increasing the risk of epidemic transmission and lacking efficient detection methods.
Using chicken infectious anemia virus recombinant VP2 protein as a coated antigen, combining indirect and direct ELISA methods, a high specificity and sensitivity detection kit was developed for detection of CIAV antibodies and screening of SPF chickens.
It has achieved efficient, specific and sensitive detection of CIAV antibodies, prevented and controlled the spread of CIAV infection, and ensured the safety of live vaccines and poisonous species for avian use.
Smart Images

Figure CN120349387A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of virus detection, and particularly relates to a recombinant VP2 protein of chicken infectious anemia virus and its application in virus detection. Background Art
[0002] Chicken infectious anemia virus disease is an immunosuppressive disease characterized by aplastic anemia and atrophy of the whole lymphoid tissue in chicks caused by Chicken infectious anemia virus (CIAV). This disease can be horizontally transmitted and vertically infected through eggs, resulting in the possible reactivation of CIAV during the laying period, so it is clinically difficult to eradicate CIAV. A large number of SPF chicken embryos are used in the production and inspection of veterinary biological products, such as cells, virus seeds, animal-derived materials, semi-finished products, and finished products. A large number of studies have found that there is exogenous virus contamination of CIAV in a variety of live vaccines, resulting in vaccine immune failure and the spread of CIAV disease. This disease is often co-infected with other avian immunosuppressive disease viruses such as MDV (Marek's disease virus), IBDV (infectious bursal disease virus), REV (avian reticuloendotheliosis virus), and ALV (avian leukosis virus), increasing the harm caused by each disease and bringing huge economic losses to the poultry industry. Moreover, there is a lack of effective CIAV vaccines, so it is worthy of great attention.
[0003] The main methods for judging whether there is CIAV infection in chicken flocks, vaccines, and virus seeds are ELISA, indirect immunofluorescence assay (IFA), and virus neutralization test (VN). Among them, ELISA is the most commonly used method for detecting CIAV antibodies, which is suitable for the detection of a large number of chicken flocks. However, most of the current commercial ELISA kits are based on foreign standards and are expensive, not suitable for large-scale clinical detection. At the same time, in the inspection link of avian live vaccine finished products, the "Pharmacopoeia of the People's Republic of China" (Part III) 2020 edition stipulates to use the chicken inspection method to detect CIAV ELISA antibodies to judge whether there is CIAV contamination in the vaccine. The contamination of CIAV in the vaccine is a potential risk for the spread and prevalence of CIA. Therefore, it is urgent to establish a stable and efficient method for detecting CIAV antibodies for the quality detection of avian live vaccines and the diagnosis of CIAV disease. Summary of the Invention
[0004] The present invention provides a recombinant VP2 protein of chicken infectious anemia virus and its application in virus detection. The recombinant VP2 protein can target CIVA antibodies and can be used for clinical detection of CIAV serum antibodies, screening of SPF chickens, detection of exogenous virus antibodies in avian live vaccines or virus seeds, and epidemiological investigations, etc.
[0005] The present invention provides a recombinant VP2 protein of chicken infectious anemia virus, and the recombinant VP2 protein includes any one of the following: (A1) a protein with an amino acid sequence shown in SEQ ID No. 1;
[0006] (A2) a protein which is obtained by substituting, deleting and / or adding one or several amino acid residues to the protein described in (A1), has more than 80% identity with the protein shown in (A1), and has the function of targeting antibodies against chicken infectious anemia virus;
[0007] (A3) a fusion protein which is obtained by connecting a protein tag to the N-terminal and / or C-terminal of the protein described in (A1) or the protein described in (A2).
[0008] The present invention also provides a gene encoding the above recombinant VP2 protein.
[0009] In a preferred embodiment of the present invention, the gene includes any one of the following:
[0010] (B1) a gene with a nucleotide sequence shown in SEQ ID No. 2;
[0011] (B2) a gene which is obtained by substituting, deleting and / or adding one or several nucleotides to the gene described in (B1), has more than 80% identity with the gene shown in (B1), and encodes the VP2 protein as claimed in claim 1;
[0012] (B3) a fusion gene which is obtained by connecting a coding gene of a protein tag to the 3'-end and / or 5'-end of the gene described in (B1) or the gene described in (B2).
[0013] The present invention also provides the application of the above recombinant VP2 protein in preparing a coating antigen for chicken infectious anemia virus antibodies.
[0014] The present invention also provides a kit for screening chicken infectious anemia virus based on an indirect ELISA method, which includes the above recombinant VP2 protein as a coating antigen and also includes other indirect ELISA detection reagents.
[0015] The present invention also provides a monoclonal antibody prepared by using the above recombinant VP2 protein.
[0016] The present invention also provides the application of the above monoclonal antibody in preparing a coating antibody for chicken infectious anemia virus.
[0017] The present invention also provides a kit for detecting chicken infectious anemia virus based on a direct ELISA method, which includes the above monoclonal antibody as a coating antibody and also includes other direct ELISA detection reagents.
[0018] The present invention also provides the use of the above-mentioned kit, the above-mentioned monoclonal antibody or the above-mentioned kit in screening SPF chickens free of chicken infectious anemia virus.
[0019] The present invention also provides the use of the above-mentioned kit, the above-mentioned monoclonal antibody or the above-mentioned kit in preparing any one of the following reagents, including: a reagent for detecting the safety of live avian vaccines, a reagent for detecting whether live avian vaccines are contaminated with exogenous viruses, a reagent for detecting the safety of virus seeds, and a reagent for detecting whether virus seeds are contaminated with exogenous viruses.
[0020] Beneficial effects: By analyzing the genomic structure and proteins of the non-enveloped DNA virus CIAV, the present invention finds that all currently known CIAVs are of one serotype, and each strain has good conservation in terms of antigenicity. Gene sequence alignment shows that the VP2 gene is highly conserved in each strain and plays an important regulatory role in the infection and replication of CIAV. The present invention selects a fragment of the full-length VP2 protein and synthesizes the recombinant VP2 protein. When the recombinant VP2 protein is used as the coating antigen for detecting CIAV antibodies, it has good reactogenicity, specificity, sensitivity and repeatability. It can be used for clinical detection of CIAV serum antibodies, screening of SPF chickens, detection of exogenous virus antibodies in live avian vaccines or virus seeds, and epidemiological investigations, etc., so as to prevent and control the spread of CIAV infection. Description of the Drawings
[0021] Figure 1 It is a diagram of small-scale protein expression in Example 2; wherein, M represents Marker; 1 represents the non-induced control (BL21); 2 represents IPTG induction (BL21);
[0022] Figure 2 It is a diagram of large-scale protein expression in Example 2; M represents Marker; 1 represents the supernatant after sonication; 2 represents the precipitate after sonication;
[0023] Figure 3 It is a diagram of protein purification in Example 2; M represents Marker; 1 represents the protein before purification; 2 represents the protein after purification;
[0024] Figure 4 It is a diagram of protein immunoblot identification in Example 2; M represents Marker; 1 represents the purified protein. Detailed Embodiments
[0025] The present invention provides a recombinant VP2 protein of chicken infectious anemia virus, and the recombinant VP2 protein includes any one of the following: (A1) a protein with the amino acid sequence shown in SEQ ID No. 1;
[0026] (A2) A protein obtained by substituting, deleting, and / or adding one or several amino acid residues to the protein described in (A1), which has an identity of more than 80% with the protein shown in (A1) and has the function of targeting antibodies against chicken infectious anemia virus;
[0027] (A3) A fusion protein obtained by linking a protein tag to the N-terminus and / or C-terminus of the protein described in (A1) or the protein described in (A2).
[0028] The protein tag in the present invention refers to a polypeptide or protein that is fused and expressed together with the target protein by using in vitro DNA recombination technology for the purpose of facilitating the expression, detection, tracing, and / or purification of the target protein. The protein tag can be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.
[0029] The identity referred to in the present invention means the identity of amino acid sequences. The identity of amino acid sequences can be determined by using homology search sites on the Internet, such as the BLAST web page on the NCBI home page website. The identity of more than 80% described in the present invention can be at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 95%, 96%, 98%, 99%, or 100% identity.
[0030] In one embodiment of the present invention, the amino acid sequence of the recombinant VP2 protein is as shown in SEQ ID No.1:
[0031] MHGNGGQPAAGGSESALSREGQPGPSGAAQGQVISNERSPRRYSTRTINGVQATNKFTAVPNPSLQRDPDWYRWNYNHSIAVWLRECSRSHAKICNCGQFRKHWFQECAGLEDRSTQASLEEAILRPLRVQGKRAKRKLDYHYSQPTPNRKKVYKTVRWQDELADREADFPPSEEDAGTSSSEVDEDINFDIGGDSGIVDELLGRPFTTPAPVRIV.
[0032] The present invention also provides a gene encoding the above recombinant VP2 protein.
[0033] In a preferred embodiment of the present invention, the gene includes any one of the following:
[0034] (B1) A gene with a nucleotide sequence as shown in SEQ ID No.2;
[0035] (B2) A gene obtained by substituting, deleting, and / or adding one or several nucleotides to the gene described in (B1), having an identity of more than 80% with the gene shown in (B1) and encoding the VP2 protein described in claim 1;
[0036] (B3) A fusion gene obtained by connecting the coding gene of a protein tag to the 3'-end and / or 5'-end of the gene described in (B1) or the gene described in (B2).
[0037] In the gene of the present invention, those skilled in the art can easily mutate the nucleotide sequence encoding the recombinant VP2 protein of the present invention by using known methods, such as directed evolution or point mutation. Those nucleotides that have been artificially modified and have an identity of 80% or more with the nucleotide sequence of the recombinant VP2 described in the present invention, as long as they encode the protein VP2 and have the function of the protein VP2, are all derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention. The identity of 80% or more of the gene of the present invention can be 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.
[0038] In one embodiment of the present invention, the nucleotide sequence of the gene is shown in SEQ ID No.2:
[0039] ATGCACGGGAACGGCGGACAACCGGCCGCTGGGGGCAGTGAATCGGCGCTTAGCCGAGAGGGGCAACCTGGGCCCAGCGGAGCCGCGCAGGGGCAAGTAATTTCAAATGAACGCTCTCCAAGAAGATACTCCACCAGGACCATCAACGGTGTTCAGGCCACCAACAAGTTCACGGCCGTCCCCAACCCCTCACTGCAGAGAGATCCGGATTGGTATCGCTGGAATTACAATCACTCTATCGCTGTGTGGCTGCGCGAATGCTCGCGCTCCCACGCTAAGATCTGCAACTGCGGACAATTCAGAAAACACTGGTTTCAAGAATGTGCCGGACTTGAGGACCGATCAACCCAAGCCTCCCTCGAAGAAGCGATCCTGCGACCCCTCCGAGTACAGGGTAAGCGAGCTAAAAGAAAGCTTGATTACCACTACTCCCAGCCGACCCCGAACCGCAAGAAGGTGTATAAGACTGTGAGATGGCAAGACGAGCTCGCAGACCGAGAGGCCGATTTTCCGCCTTCAGAAGAGGACGCTGGCACCAGCTCAAGCGAAGTCGACGAAGATATAAATTTCGACATCGGAGGAGACAGCGGTATCGTAGACGAGCTTTTAGGAAGGCCTTTCACAACCCCCGCCCCGGTACGTATAGTG。
[0040] The present invention also provides the use of the above-mentioned recombinant VP2 protein in the preparation of a coating antigen for chicken infectious anemia virus antibodies.
[0041] The coating antigen of the present invention can be used to detect CIAV antibodies based on the ELISA antibody detection method, without cross-reacting with other virus antibodies, is convenient and efficient, has strong operability, and has high specificity and sensitivity.
[0042] The present invention also provides a kit for screening chicken infectious anemia virus based on the indirect ELISA method, including the above-mentioned recombinant VP2 protein as a coating antigen, and also including other indirect ELISA detection reagents.
[0043] In the present invention, the ELISA kit further includes an enzyme-linked immunosorbent assay (ELISA) plate, a coating solution, a blocking solution, a positive serum control, a negative serum control, an enzyme-labeled secondary antibody, a sample diluent, a washing solution, a TMB chromogenic solution, and a reaction termination solution. Among them, the coating solution is a carbonate buffer solution; the washing solution and the sample diluent are both PBST; the enzyme-labeled secondary antibody is a horseradish peroxidase-labeled donkey anti-chicken IgG antibody; the blocking solution is 10% rabbit serum; the positive serum control is an SPF chicken serum sample obtained by immunizing with CIAV; the negative serum control is an SPF chicken serum sample not infected with CIAV.
[0044] In one embodiment of the present invention, a method for detecting CIAV antibodies using the kit to screen for CIAV includes the following steps:
[0045] S1: Dilute the CIAV VP2 protein with the coating solution to a concentration of 2.5 μg / mL, add 50 μL per well into the ELISA plate, and place the ELISA plate at 37°C for coating for 3 hours;
[0046] S2: Remove the coating solution in S1, wash 3 times with the PBST washing solution, 250 μL per well, pat dry, and then add the blocking solution, 50 μL per well, and incubate at 37°C for 60 min;
[0047] S3: Remove the blocking solution in S2, wash 3 times with the PBST washing solution, 250 μL per well, pat dry, and then add the serum sample to be tested diluted 1:40 with the sample diluent, 50 μL per well, and incubate at 37°C for 60 min;
[0048] S4: Remove the serum sample in S3, wash 4 times with the PBST washing solution, 250 μL per well, pat dry, and then add the enzyme-labeled secondary antibody diluted 1:8000 with the sample diluent, 50 μL per well, and incubate at 37°C for 60 min;
[0049] S5: Remove the enzyme-labeled secondary antibody in S4, wash 4 times with the PBST washing solution, 250 μL per well, pat dry, then add the TMB chromogenic solution, 100 μL per well, place in the dark at room temperature for reaction for 10 min, and then add the termination solution, 50 μL per well to terminate the reaction;
[0050] S6: Measure the OD 450 value of the liquid in the ELISA plate wells on an enzyme-linked immunosorbent assay reader. When the OD 450 value of the sample to be tested ≥ 0.27, the test result is determined to be positive; when the OD 450 value of the sample to be tested < 0.27, the test result is negative.
[0051] The present invention also provides a monoclonal antibody prepared using the above recombinant VP2 protein.
[0052] The present invention does not particularly limit the preparation method of the monoclonal antibody, and it can be achieved by using the known hybridoma technology in the art.
[0053] The present invention also provides the application of the above monoclonal antibody in the preparation of a coating antibody for chicken infectious anemia virus.
[0054] When the monoclonal antibody is used as the coating antibody, it belongs to direct ELISA detection. The mechanism is to adsorb the known antigen or antibody on the surface of the solid-phase carrier, so that the enzyme-labeled antigen-antibody reaction occurs on the solid surface, and the amount of antigen or antibody is detected by substrate color development. In direct detection, the antigen to be detected is directly fixed on the solid-phase carrier, and then the enzyme-labeled specific antibody is added to form an antigen-enzyme-labeled antibody complex with the antigen. After washing to remove the unbound enzyme-labeled antibody, the substrate is added for color development, and the content of the antigen is judged by the depth of the color.
[0055] The present invention also provides a kit for detecting chicken infectious anemia virus based on the direct ELISA method, including the above monoclonal antibody as the coating antibody and other direct ELISA detection reagents.
[0056] The present invention does not particularly limit the content of the direct ELISA detection kit, and it can be obtained by making simple changes according to the content of the above indirect ELISA detection kit.
[0057] The present invention also provides the application of the above kit, the above monoclonal antibody or the above kit in screening SPF chickens free of chicken infectious anemia virus.
[0058] In one embodiment of the present invention, the specific method for screening SPF chickens free of CIAV contamination includes the following steps:
[0059] Collect the blood of the SPF chicken flock and isolate the serum, and perform CIAV antibody detection according to the above indirect ELISA method. The serum should be negative after CIAV antibody detection, otherwise it indicates that the SPF chicken flock is contaminated with exogenous virus of CIAV and cannot be used for vaccine preparation, serum preparation, etc.
[0060] The present invention also provides the application of the above kit, the above monoclonal antibody or the above kit in the preparation of any one of the following reagents, including: reagents for detecting the safety of live avian vaccines, reagents for detecting whether live avian vaccines are contaminated with exogenous viruses, reagents for detecting the safety of virus seeds, and reagents for detecting whether virus seeds are contaminated with exogenous viruses.
[0061] In one embodiment of the present invention, the detection method of exogenous CIVA in the live avian vaccine or virus seed includes the following steps:
[0062] Use 20 SPF chickens suitable for inoculating live avian vaccines or virus seeds. Each chicken is simultaneously inoculated with 10 vaccine or virus seed doses by eye drop and nasal drip, and 100 vaccine or virus seed doses by intramuscular injection. After 21 days, repeat the inoculation once according to the above method and dose. Blood is collected 42 days after the first inoculation, and serum is separated. CIAV antibody detection is performed according to the above indirect ELISA method. The sera of all 20 chickens should be negative after CIAV antibody detection. Otherwise, it indicates that there is contamination of exogenous CIAV virus in the live avian vaccine or virus seed, which will pose a threat to the safety of the vaccine or virus seed.
[0063] To further illustrate the present invention, the following examples are used to describe in detail a recombinant VP2 protein of chicken infectious anemia virus provided by the present invention and its application in detecting the virus, but they should not be construed as limiting the protection scope of the present invention.
[0064] Example 1 CIAV VP2 protein sequence analysis
[0065] Currently, only one serotype of CIAV strains is known. Download the reference sequences of different CIAV strains from NCBI. Through analysis, it is found that the CIAV VP2 protein has high homology among different strains. The VP2 of the CIAV Hebei2 strain is selected for comprehensive secondary analysis and antigenicity analysis. The results show that the CIAV VP2 protein is highly conserved, with extremely low antigenicity differences, and can be used as an alternative fragment for expressing proteins. Based on the secondary structure analysis and antigenicity of the protein sequence, a nucleotide fragment (648bp) of the full-length VP2 protein is selected, codon-optimized, and then synthesized. EcoRⅠ (GAATTC) and XhoI (CTCGAG) restriction enzyme sites are added to the 5' and 3' ends for vector cloning. The encoded amino acid sequence is shown in SEQ ID No.1, and the sequence after adding the restriction enzyme sites (SEQ ID No.2) is synthesized by Beijing Liuhe Huada Protein R & D Center Co., Ltd.
[0066] Example 2 Construction of recombinant expression plasmid and expression and purification of VP2 protein
[0067] 1. Construction of recombinant expression plasmid
[0068] EcoRⅠ and Xho I restriction enzyme sites are introduced at the 5' and 3' ends of SEQ ID No.2 in Example 1 for the preparation of recombinant expression plasmids.
[0069] The SEQ ID No.2 sequence and plasmid pET28a after adding EcoRⅠ and XhoI restriction enzyme cleavage sites were double digested with restriction endonucleases EcoRⅠ and XhoI respectively. After ligating the purified and recovered fragments with the enzyme digestion products of the expression vector using the DNA Ligation Kit, a recombinant expression plasmid was obtained and transformed into competent cells (BL21).
[0070] 2. Small-scale expression of the CIAV-VP2 recombinant protein
[0071] The transformed BL21 clones identified as positive by PCR were picked into 1.5 mL of LB liquid medium containing kanamycin resistance (50 μg / mL) and cultured at 37 °C with a rotation speed of 200 r / min; cultured until the OD 600 of the LB culture broth was 0.6 - 0.8.
[0072] Isopropyl β-D-1-thiogalactopyranoside (IPTG) with a final concentration of 0.5 mM was added to the cultured bacterial solution for induction. The induction temperature was 37 °C, the rotation speed was 200 r / min, and the time was 2 h. 1 mL of the induced bacterial solution was taken and centrifuged at 12000 r / min for 1 min. The supernatant was discarded, and the precipitate was dispersed with 50 μL of 10 mM Tris-HCl (pH 8.0) solution. An equal volume of 2×loading buffer was added, and after maintaining at 100 °C for 5 min, electrophoresis detection was carried out.
[0073] The results were as Figure 1 shown. A specific target band of the recombinant CIAV VP2 protein appeared at approximately 28 KD in size, indicating the successful expression of the CIAV VP2 protein.
[0074] 3. Large-scale expression of the CIAV-VP2 recombinant protein
[0075] The transformed BL21 obtained in step 1 was identified by PCR, and the positive BL21 was cultured. The cultured bacterial solution was transferred to 250 mL of LB liquid medium with kanamycin resistance (50 μg / mL) at a volume ratio of 1:50 and cultured with shaking at 37 °C and a rotation speed of 200 r / min until the OD 600= 0.6 - 0.8. Add IPTG with a final concentration of 0.5 mM to the cultured LB liquid medium for induction. The induction temperature is 37 °C and the induction time is 3 h. Centrifuge the induced product to collect bacteria at a centrifugation speed of 8000 r / min for 6 min. Discard the supernatant after centrifugation to obtain the bacterial cells; subject the obtained bacterial cells to ultrasonic disruption. The specific process is as follows: The obtained bacterial cells are dispersed with 30 mL of 10 mM Tris-HCl (pH 8.0) solution and then subjected to ultrasonic disruption. The power of ultrasonic disruption is 500 W, and ultrasonic disruption is performed 180 times, 5 s each time, and the next ultrasonic disruption is carried out after an interval of 5 s.
[0076] The product obtained by ultrasonic disruption is subjected to electrophoresis detection. The specific process is as follows: Take 100 μL of the ultrasonicated bacterial suspension, centrifuge it at a speed of 12000 r / min for 10 min, and retain 50 μL of the supernatant and the obtained precipitate after centrifugation. The obtained precipitate is dispersed with 50 μL of 10 mM Tris-HCl (pH 8.0) solution. Take the solutions obtained after dispersing the supernatant and the precipitate respectively for SDS-PAGE detection, and the results are as Figure 2 shown. A large amount of target protein is detected in the precipitate, indicating that the expression form of this recombinant bacterium is inclusion body expression.
[0077] Purify the well-expressed CIAV-VP2 protein in the above-mentioned bacterial cell precipitate as follows: Resuspend the precipitate obtained by ultrasonic centrifugation with 20 - 30 mL of 10 mM Tris-HCl (pH 8.0) solution and let it stand for 10 min; centrifuge at 12000 r / min for 10 min, and transfer the supernatant to another tube for storage. For the precipitate, resuspend the precipitate with 20 - 30 mL of 10 mM Tris-HCl (pH 8.0) solution and let it stand for 10 min; centrifuge at 12000 r / min for 10 min, discard the supernatant to obtain the first precipitate; for the first precipitate, repeat the above steps of resuspension and centrifugation once to obtain the second precipitate. First, add a small amount of 10 mM Tris-HCl (pH value 8.0) solution to resuspend the second precipitate, then add 5 - 10 mL of 10 mM Tris-HCl (pH 8.0) solution containing 8 M urea to dissolve the protein, centrifuge at 12000 r / min for 10 min, collect the supernatant, and take 50 μL of the sample for SDS-PAGE electrophoresis detection ( Figure 3 ). Using BSA (bovine serum albumin) as a standard, estimate the purified protein concentration > 0.5 mg / mL and the purity > 85% by SDS-PAGE gel scanning analysis. The purified protein is detected by Western-Blot ( Figure 4 ), and it is determined to be the CIAV-VP2 recombinant protein, named CIAV-VP2.
[0078] Example 3 Determination of the Optimal Reaction Conditions for Establishing the ELISA Method
[0079] 1. Determination of the optimal VP2 coating concentration and the optimal working concentration of antibodies
[0080] The purified VP2 protein was diluted with coating solution to 5 μg / mL, 2.5 μg / mL and 1.25 μg / mL, added to the ELISA plate, 50 μL / well, and incubated at 37°C for 3 h; the coating solution was discarded, washed three times with PBST, and patted dry; blocked with 10% rabbit serum 50 μL / well at 37°C for 1 h. Discard the blocking solution, wash with PBST 3 times, and pat dry; dilute the standard positive control serum and negative control serum in a gradient of 1:40, 1:80, and 1:160, add 50μL / well to the ELISA plate, and incubate at 37℃ for 1h to perform the square array test; discard the serum, wash with PBST 4 times, and pat dry; add 1:8000 enzyme-labeled secondary antibody, incubate at 37℃ for 1h; discard the enzyme-labeled secondary antibody, wash with PBST 4 times, and pat dry; add 100μL TMB colorimetric solution to each well, and color at room temperature in the dark for 10min; add 50μL stop solution to terminate the reaction, and immediately use an ELISA reader to measure OD 450 Value. According to OD 450 The optimal working concentrations of the coated antigen and antibody were determined by the values and P / N values. The results are shown in Tables 1 and 2. When the antigen coating concentration was 2.5 μg / mL and the antibody dilution was 1:40, the OD of the positive control serum was 450 The value is close to 1.0, and the P / N value is the largest. Therefore, the optimal coating concentration of ELISA antigen is determined to be 2.5 μg / mL, and the optimal serum dilution is determined to be 1:40.
[0081] Table 1 Detection results of the optimal working concentrations of coated VP2 antigen and antibody (OD 450 value)
[0082]
[0083] Table 2 Detection results of optimal working concentrations of coated VP2 antigen and antibody (P / N value)
[0084]
[0085] 2. Determination of the optimal dilution of enzyme-labeled secondary antibody
[0086] The ELISA plate was coated with the optimal concentration of VP2 antigen, and the positive and negative sera were diluted to the optimal dilution.
[0087] The enzyme-labeled secondary antibody was diluted to 1:4000, 1:8000, 1:6000 and 1:20000, and each dilution was repeated twice. The optimal working concentration of the enzyme-labeled secondary antibody was determined by the OD450nm value and the P / N value. The results are shown in Tables 3 and 4. When the concentration of the enzyme-labeled secondary antibody was 1:8000, the P / N was the largest.
[0088] Table 3 Detection Results of the Optimal Dilution Ratio of Enzyme-Labeled Secondary Antibody (OD 450 value)
[0089]
[0090] Table 4 Detection Results of the Optimal Dilution Ratio of Enzyme-Labeled Secondary Antibody (P / N value)
[0091] Enzyme-labeled secondary antibody dilution 1:4000 1:8000 1:16000 1:20000 P / N value 5.8910 9.2158 7.6538 6.0246
[0092] 3. Determination of the Optimal Coating Conditions and Time
[0093] Coat the enzyme-labeled plate with VP2 protein at the optimal concentration, set 3 coating conditions, incubate at 37 °C for 3 h; coat overnight at 4 °C; incubate at 37 °C for 1 h and then coat overnight at 4 °C. Set 2 replicates for each coating condition. Dilute the negative and positive sera and the enzyme-labeled secondary antibody at the optimal dilution ratio, and determine the optimal coating conditions and time of the antigen through the OD 450 value and P / N value. The results are shown in Table 5 and Table 6. The optimal coating condition is to coat at 37 °C for 3 h.
[0094] Table 5 Detection Results of the Optimal Coating Conditions (OD 450 value)
[0095]
[0096] Table 6 Detection Results of the Optimal Coating Conditions (P / N value)
[0097]
[0098] 4. Selection of the Optimal Blocking Solution
[0099] Coat the enzyme-labeled plate with VP2 protein at the optimal concentration, coat at 37 °C for 3 h, after washing, use 5% skim milk, 1% gelatin, 10% horse serum, 1% BSA, 10% rabbit serum and 10% sheep serum as blocking solutions respectively, do 2 replicates for each well, dilute the negative and positive sera and the enzyme-labeled secondary antibody at the optimal dilution ratio, and determine the optimal blocking solution through the OD 450 value and P / N value. The results are shown in Table 7 and Table 8. When blocking with 10% rabbit serum, the P / N value is the largest, so 10% rabbit serum is selected as the optimal blocking solution.
[0100] Table 7 Determination of the Optimal Blocking Solution (OD 450 value)
[0101]
[0102]
[0103] Table 8 Determination of the Optimal Blocking Solution (OD 450 value)
[0104] Blocking solution 5% skim milk 1% gelatin 10% horse serum 1% BSA 10% rabbit serum 10% sheep serum P / N value 1.4164 5.1626 5.2445 2.5632 10.156 5.4137
[0105] 5. Determination of the color development time
[0106] Add the TMB color development solution and incubate in the dark at room temperature for 10 min, 20 min, and 30 min respectively. Set 2 replicates for each color development time for negative and positive sera. Determine the optimal color development time through the OD 450 value and the P / N value. The results are shown in Tables 9 and 10. When the color development is carried out at room temperature for 10 min, the P / N value is the largest. Therefore, the optimal TMB color development time is 10 min.
[0107] Table 9 Determination of TMB color development (OD 450 value)
[0108]
[0109] Table 10 Determination of the optimal color development time (P / N value)
[0110] Room temperature display time 10 min 20 min 30 min P / N value 10.2682 7.4003 6.3920
[0111] Example 4 Indirect ELISA Kit for Detecting CIAV Antibody
[0112] The method for detecting CIAV antibody using the ELISA kit of Example 3 includes the following steps:
[0113] S1: Dilute the CIAV VP2 protein with the coating solution to a concentration of 2.5 μg / mL, add 50 μL / well into the enzyme-linked immunosorbent assay (ELISA) plate, and place the ELISA plate at 37 °C for coating for 3 hours;
[0114] S2: Remove the coating solution in S1, wash 3 times with PBST washing solution, 250 μL / well, pat dry, then add the blocking solution, 50 μL / well, and incubate at 37 °C for 60 min;
[0115] S3: Remove the blocking solution in S2, wash 3 times with PBST washing solution, 250 μL / well, pat dry, then add the serum sample to be detected diluted 1:40 with the sample diluent, 50 μL / well, and incubate at 37 °C for 60 min;
[0116] S4: Remove the serum sample in S3, wash 4 times with PBST washing solution, 250 μL / well, pat dry, then add the enzyme-labeled secondary antibody diluted 1:8000 with the sample diluent, 50 μL / well, and incubate at 37 °C for 60 min;
[0117] S5: Remove the enzyme-labeled secondary antibody in S4, wash 4 times with PBST washing solution, 250 μL per well. After patting dry, add TMB chromogenic solution, 100 μL per well, and place it in the dark at room temperature for 10 min. Then add the stop solution, 50 μL per well to terminate the reaction.
[0118] S6: Measure the OD 450 value of the liquid in the wells of the enzyme-labeled plate on the enzyme-labeling instrument. When the OD 450 value of the test sample ≥ 0.27, the test result is judged as positive; when the OD 450 value of the test sample < 0.27, the test result is negative.
[0119] Determination of the positive and negative critical value: Detect 49 negative sera, repeat 2 wells for each sample, and the test results are shown in Table 11. Calculate the average value (X) and standard deviation (SD) of the OD 450 value of the negative serum samples. The calculation formula is threshold = X + 3SD. The OD 450 threshold of ELISA is calculated to be 0.27. When the OD 450 value of the test sample ≥ 0.27, the result is judged as positive; when the OD 450 value of the test sample < 0.27, the result is judged as negative.
[0120] Table 11 Determination of the test results of 49 negative sera and the critical value
[0121]
[0122] Example 5 Specificity test of indirect ELISA for detecting CIAV antibodies
[0123] Use the established indirect ELISA method to detect the positive sera of known pathogens such as infectious bronchitis virus (IBV), infectious bursal disease virus (IBDV), infectious laryngotracheitis virus (ILTV), egg drop syndrome virus (EDSV), Newcastle disease virus (NDV), Marek's disease virus (MDV), avian reovirus, etc. at the same time, set up CIAV positive and negative control sera to determine whether there is cross-reaction and analyze the specificity of this kit. The results are shown in Table 12. The OD 450 values are all less than 0.27, judged as negative, indicating that there is no cross-reaction between the VP2 protein and the positive sera of the above viruses, and the indirect ELISA kit has good specificity.
[0124] Table 12 Specificity test results of the CIAV indirect ELISA antibody detection method
[0125] Sample <![CDATA[OD 450 value]]> Judgment Positive for infectious bronchitis virus of chicken 0.1941 Negative Positive for infectious bursal disease virus of chicken 0.2049 Negative Positive for infectious laryngotracheitis virus of chicken 0.1439 Negative Positive for egg drop syndrome virus of chicken 0.1604 Negative Positive serum for Newcastle disease virus of chicken 0.1749 Negative Positive serum for Marek's disease virus of chicken 0.1698 Negative Positive serum for avian reovirus 0.1449 Negative
[0126] Example 6 Sensitivity Test of Indirect ELISA for Detecting CIAV Antibodies
[0127] Take 3 positive serum samples, serially dilute the serum from 1:40 to 2560, and perform the detection according to the detection method in Example 3. The results show that for different positive sera, after dilution to 1:320, they are still detected as positive, indicating that the sensitivity of the VP2-coated antigen is high.
[0128] Example 7 Concordance Rate Test of Indirect ELISA for Detecting CIAV Antibodies
[0129] The indirect ELISA kit of the present invention is used to detect 134 clinical serum samples. Compared with the commercial kit, the sensitivity, specificity, and concordance rate of this kit and the commercial kit are analyzed.
[0130] Relative sensitivity (%) = Number of positives / (Number of positives + Number of false negatives) × 100%
[0131] Relative specificity (%) = Number of negatives / (Number of negatives + Number of false positives) × 100%
[0132] Total concordance rate (%) = (Number of positives + Number of negatives) / Total number of detections × 100%.
[0133] As shown in Tables 13 and 14, the indirect ELISA kit of the present invention is used to detect 134 clinical serum samples, including 31 positive samples and 103 negative samples. Using the commercial kit to detect 134 clinical serum samples, including 35 positive samples and 99 negative samples. It can be seen that the relative sensitivity of the indirect ELISA method of the present invention is 88.6%, the relative specificity is 96.1%, and the total concordance rate is 97.0%. The sensitivity and specificity of the indirect ELISA kit of the present invention are relatively high, and it has a high concordance rate with the existing commercial kits.
[0134] Table 13 Detection Results of CIAV Indirect ELISA Antibody Detection Kit and Commercial Kit
[0135]
[0136]
[0137]
[0138] Table 14 Concordance Rate of Detection Results of CIAV Indirect ELISA Antibody Detection Kit and Commercial Kit
[0139]
[0140] Example 8 Repeatability Test of Indirect ELISA for Detecting CIAV Antibodies
[0141] According to the detection method of Example 3, within-batch and between-batch repeatability tests were carried out. The ELISA plates were coated with VP2 protein of the same batch, and positive and negative sera with 4 different antibody titers were detected respectively. Each sample was repeated in 3 parallel wells, and the OD of each well was measured. 450 value, the standard deviation of each sample was calculated, and then the within-batch coefficient of variation (CV) of each sample was calculated. CV = (standard deviation SD / mean value Mean) × 100%. Under the same test environment, ELISA plates were coated with VP2 protein at 3 different time periods, and positive and negative sera with 4 different antibody titers were detected respectively. Each sample was repeated in 3 parallel wells, and the OD of each well was measured. 450 value, the standard deviation of each sample was calculated, and then the between-batch coefficient of variation (CV) of each sample was calculated. CV = (standard deviation SD / mean value Mean) × 100%. The results are shown in Table 15 and Table 16. The coefficients of variation of the within-batch and between-batch repeatability tests are both less than 10%, indicating that the detection method has good repeatability and stable results.
[0142] Table 15 Results of within-batch repeatability test for different positive and negative serum samples
[0143]
[0144]
[0145] Table 16 Results of between-batch repeatability test for different positive and negative serum samples
[0146]
[0147] Preliminary application of the kit in Example 9
[0148] The kit described in Example 4 was applied to the detection of exogenous viruses in live avian vaccines. Ten key varieties of live avian vaccines produced by domestic production enterprises were selected for CIAV detection, and serological tests for CIAV contamination of the selected live avian vaccines were carried out according to the third part of the Chinese Veterinary Pharmacopoeia (2020 Edition). At the same time, a PBS group was set as a negative control, and a group infected with CIAV (Cux-1 strain) was set as a positive control. According to Table 17, the results of serological tests and the detection using this kit are consistent. None of the selected live avian vaccines are contaminated with CIAV. The negative control is negative for CIAV detection, and the positive control is positive for CIAV detection.
[0149] Table 17 Detection results of domestic enterprise vaccines using the kit of the present invention
[0150]
[0151]
[0152] In summary, in the CIAV ELISA antibody detection kit described in the present invention, based on the fact that the CIAV VP2 protein, as an important immunogenic protein of CIAV, is highly conserved among different strains of CIAV and can simultaneously recognize different strains of CIAV without cross-reacting with viruses such as egg drop syndrome virus (EDSV) of chickens. The kit described in the present invention has good specificity and can be used not only for the detection of exogenous viruses of CIAV in live avian vaccines (chicken inspection method), but also for the clinical detection and epidemiological investigation of CIAV.
[0153] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, rather than all embodiments. People can also obtain other embodiments based on these embodiments without creative efforts, and these embodiments all fall within the protection scope of the present invention.
Claims
1. A recombinant VP2 protein of chicken infectious anemia virus, characterized in that, The recombinant VP2 protein includes any one of the following: (A1) a protein having an amino acid sequence as shown in SEQ ID No. 1; (A2) a protein which is obtained by substituting, deleting and / or adding one or several amino acid residues to the protein described in (A1), has an identity of more than 80% with the protein shown in (A1), and has the function of targeting antibodies against chicken infectious anemia virus; (A3) a fusion protein obtained by linking a protein tag to the N-terminus and / or C-terminus of the protein described in (A1) or the protein described in (A2).
2. A gene encoding the recombinant VP2 protein according to claim 1.
3. The gene according to claim 2, wherein The gene includes any one of the following: (B1) a gene having a nucleotide sequence as shown in SEQ ID No. 2; (B2) a gene which is obtained by substituting, deleting and / or adding one or several nucleotides to the gene described in (B1), has an identity of more than 80% with the gene shown in (B1), and encodes the VP2 protein according to claim 1; (B3) a fusion gene obtained by linking a coding gene of a protein tag to the 3'-end and / or 5'-end of the gene described in (B1) or the gene described in (B2).
4. Use of the recombinant VP2 protein according to claim 1 in the preparation of a coating antigen for chicken infectious anemia virus antibodies.
5. A kit for screening chicken infectious anemia virus based on the indirect ELISA method, characterized in that, It includes using the recombinant VP2 protein according to claim 1 as a coating antigen, and also includes other indirect ELISA detection reagents.
6. A monoclonal antibody prepared by using the recombinant VP2 protein according to claim 1.
7. Use of the monoclonal antibody according to claim 6 in the preparation of a coating antibody for chicken infectious anemia virus.
8. A kit for detecting chicken infectious anemia virus based on the direct ELISA method, characterized in that, It includes using the monoclonal antibody according to claim 6 as a coating antibody, and also includes other direct ELISA detection reagents.
9. Use of the kit according to claim 5, the monoclonal antibody according to claim 6 or the kit according to claim 8 in screening SPF chickens free of chicken infectious anemia virus.
10. Use of the kit according to claim 5, the monoclonal antibody according to claim 6 or the kit according to claim 8 in the preparation of any one of the following reagents, characterized in that, It includes: Reagents for detecting the safety of live avian vaccines, reagents for detecting whether live avian vaccines are contaminated by exogenous viruses, reagents for detecting the safety of virus seeds, and reagents for detecting whether virus seeds are contaminated by exogenous viruses.
Citation Information
Patent Citations
Chicken infectious anemia virus VP1 and VP2 expression genetic recombination fowlpox virus living-vector vaccine
CN109136198A
Construction and application of recombinant virus vector for expressing infectious bursal disease virus VP2 protein
CN115927469A
Anti-chicken infectious anemia virus monoclonal antibody hybridoma cell strain, monoclonal antibody, reagent or kit and application thereof
CN116804186A
Enzyme-linked immuno sorbent assay (ELISA) kit for detecting chicken infectious anemia virus antibody based on virus-like particles and application of enzyme-linked immuno sorbent assay (ELISA) kit
CN116813717A