Cells, tissues, organs and / or animals having one or more modified genes for enhancing xenograft survival and / or tolerance

By genetic modification of pig cells, tissues and organs, introducing a variety of transgenes and combining CRISPR technology, the genetic incompatibility problem between pigs and humans is solved, the immunological compatibility and survival rate of xenografts are enhanced, and the long-term and stable application of xenografts is achieved.

CN120349970APending Publication Date: 2025-07-22EGENESIS INC +1
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202510368634.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2019-10-18
Filing Date
2020-05-15
Publication Date
2025-07-22

AI Technical Summary

Technical Problem

In the prior art, gene incompatibility between pigs and humans leads to severe immune responses in xenografts, hindering the application of pig cells, tissues and organs in clinical xenografts, and the limitations of large-scale genomic engineering technology hinder the integration of gene modification in individual animals, and failing to achieve long-term xenograft survival.

Method used

By genetic modification of pig cells, tissues and organs, complement response, coagulation response, inflammatory response, immune response and immunomodulatory genes are introduced, including CD46, CD55, CD59, CD39, THBD, TFPI, A20, HO-1, HLA-E, B2M, PD-L1 and other transgenes, combined with CRISPR editing technology and vectors, the integration and expression of multiple transgenes are achieved to enhance immunologic compatibility.

Benefits of technology

It enhances the immunological compatibility of pig cells, tissues and organs in xenografts, reduces immune responses, improves survival and tolerance of xenografts, reduces liver damage and coagulation abnormalities, and provides the potential for clinical application.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_5
    Figure SMS_5
Patent Text Reader

Abstract

The present disclosure relates to cells, tissues, organs and / or animals having one or more modified genes for enhancing xenograft survival and / or tolerance. In addition, the present disclosure relates to methods of making and using the cells, tissues, organs and / or animals having one or more of the modified genes.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] This application is a divisional application of the patent application with the application date of May 15, 2020, application number 202080050306.1, and title "Cells, Tissues, Organs, and / or Animals with One or More Modified Genes for Enhancing Xenograft Survival and / or Tolerance".

[0002] Cross - reference to related applications

[0003] For all purposes, the entire disclosures of PCT / CN19 / 87310 filed on May 16, 2019, PCT / CN19 / 87314 filed on May 16, 2019, PCT / CN19 / 112038 filed on October 18, 2019, and PCT / CN19 / 112039 filed on October 18, 2019 are incorporated herein by reference in their entirety.

[0004] Cross - reference to sequence listing

[0005] The content of the text file submitted electronically herewith is incorporated herein by reference in its entirety: a computer-readable format copy of the sequence listing (file name: EGEN_037_00WO_SeqList_ST25.txt, recording date: May 14, 2020, file size: 189 kilobytes). Background Art

[0006] Over the past few decades, the shortage of human organs and tissues for transplantation has become increasingly severe and is one of the most important unmet medical needs. Xenotransplantation has the potential to supply transplant organs for patients with chronic organ failure almost without limit. The organ size and physiological similarities, combined with genetic engineering to eliminate molecular incompatibilities, have made pigs the preferred donor for renal xenotransplantation. Preclinical studies have shown that porcine kidney xenotransplantation can extend the life of non-human primate recipients by several weeks to several months (Higginbotham 2015, Iwase 2015b). However, due to the evolutionary distance between pigs and humans, pig organs trigger rejection by the human immune system in multiple forms, including (i) hyperacute rejection; (ii) acute humoral rejection, consisting of dysregulated thrombomodulation and type II endothelial cell (EC) activation accompanied by leukocyte recruitment; (iii) thrombotic microangiopathy, consisting of intravascular thrombosis with platelet consumption and EC activation, fibrin deposition, and thrombosis due to the lack of thrombomodulation, and (iv) chronic vascular disease. These adverse events are at least partially due to the molecular incompatibilities between the donor and the recipient, particularly with respect to genes involved in the complement, coagulation, inflammation, and immune response systems. The clinical use of xenogeneic organs (e.g., porcine) is hindered by these immunological incompatibilities, which have thus far prevented the use of porcine cells, tissues, and vascularized porcine organs in clinical xenotransplantation.

[0007] Over the past two decades, several genetic modifications that reduce the interspecies incompatibility between pigs and humans have been identified. However, these previously identified genetic modifications have not achieved long-term xenograft survival. In addition, the technical limitations of large-scale genome engineering have hindered the integration of these modifications in individual animals. SUMMARY OF THE INVENTION

[0008] There is a need to develop porcine cells, tissues, organs, and / or porcine animals with novel combinations of genetic modifications for xenotransplantation and to develop related methods.

[0009] Accordingly, the present disclosure provides cells, tissues, organs, and animals comprising genetic modifications that result in enhanced immunological compatibility, as well as vectors and methods for producing these cells, tissues, organs, and animals, and the use of these cells, tissues, organs, and animals in allotransplantation. In certain embodiments, the genetic modifications that cause enhanced immunological compatibility include one or more complement response genes (interchangeably referred to herein as complement toxicity genes), coagulation response genes (interchangeably referred to herein as coagulation genes), inflammatory response genes (interchangeably referred to herein as apoptosis / inflammation genes), immune response genes (interchangeably referred to herein as cytotoxic genes), and / or immunomodulatory genes.

[0010] In some aspects, the present disclosure provides isolated cells, tissues, organs, and animals that comprise multiple transgenes of at least two types selected from inflammatory response transgenes, immune response transgenes, immune regulatory transgenes, or combinations thereof. In some aspects, the present disclosure provides isolated cells, tissues, organs, or animals that comprise multiple transgenes, wherein the multiple transgenes comprise at least one inflammatory response transgene, at least one immune response transgene, and at least one immune regulatory transgene. In some embodiments, the multiple transgenes comprise at least three transgenes selected from inflammatory response transgenes, immune response transgenes, immune regulatory transgenes, or combinations thereof. In some embodiments, the inflammatory response transgenes are selected from tumor necrosis factor alpha-induced protein 3 (A20), heme oxygenase (HO-1 or HMOX1), cluster of differentiation 47 (CD47), and combinations thereof. In some embodiments, the immune response transgenes are selected from human leukocyte antigen-E (HLA-E), beta-2 microglobulin (B2M), and combinations thereof. In some embodiments, the immune regulatory transgenes are selected from programmed death ligand 1 (PD-L1), Fas ligand (FasL), and combinations thereof. In some embodiments, the multiple transgenes further comprise at least one coagulation response transgene. In some embodiments, the coagulation response transgenes are selected from cluster of differentiation 39 (CD39), thrombomodulin (THBD, TBM or TM), tissue factor pathway inhibitor (TFPI), and combinations thereof. In some embodiments, the multiple transgenes further comprise at least one complement response transgene. In some embodiments, the complement response transgenes are selected from human membrane cofactor protein (hCD46 or simply CD46); human complement decay-accelerating factor (hCD55 or simply CD55), human MAC inhibitor factor (hCD59 or simply CD59), and combinations thereof.

[0011] In one aspect, the present disclosure provides isolated cells, tissues, organs, and animals that comprise one or more transgenes, each independently selected from complement response transgenes (e.g., CD46, CD55, CD59); coagulation response transgenes (e.g., CD39, THBD or TBM, TFPI); inflammatory response transgenes (e.g., A20, HO-1, CD47); immune response transgenes (e.g., HLA-E, B2M); and / or immune regulatory transgenes (e.g., PD-L1, FasL). In certain embodiments, the cell, tissue, organ, or animal can further comprise one or more additional transgenes from other gene classes.

[0012] In certain embodiments, the isolated cells, tissues, organs, and animals provided herein comprise one or more complement response transgenes selected from hCD46, hCD55, and hCD59. In some of these embodiments, the expression of one or more of the complement response transgenes is driven by a ubiquitous promoter.

[0013] In certain embodiments, the isolated cells, tissues, organs, and animals provided herein comprise one or more blood coagulation response transgenes selected from CD39, THBD, and TFPI. In some of these embodiments, the expression of one or more of the blood coagulation response transgenes is driven by a tissue-specific promoter. In certain of these embodiments, the tissue-specific promoter is an endothelium-specific promoter, and in certain of these embodiments, the endothelium-specific promoter is a low-expression endothelium-specific promoter.

[0014] In certain embodiments, the isolated cells, tissues, organs, and animals provided herein comprise one or more inflammatory response transgenes selected from A20, HO-1, and CD47. In some of these embodiments, the expression of one or more of the inflammatory response transgenes is driven by a ubiquitous promoter, a tissue-specific promoter (such as an endothelium-specific promoter), or any combination thereof.

[0015] In certain embodiments, the isolated cells, tissues, organs, and animals provided herein comprise one or more immune response transgenes selected from HLA-E and B2M. In some of these embodiments, the expression of one or more of the immune response transgenes is driven by a ubiquitous promoter.

[0016] In certain embodiments, the isolated cells, tissues, organs, and animals provided herein comprise one or more immunomodulatory transgenes, including but not limited to PD-L1, FasL, or both.

[0017] Expression of at least six of these transgenes at clinically effective levels in said cells, tissues, organs or animals results in enhanced immunological compatibility. Thus, in certain embodiments, the isolated cells, tissues, organs and animals provided herein contain six or more transgenes, such as 6, 7, 8, 9, 10, 11 or 12 transgenes, selected from complement response, coagulation response, inflammatory response, immune genes and immunomodulatory transgenes. In some of these embodiments, the cells, tissues, organs or animals may contain at least one transgene from each category. In other embodiments, certain categories of transgenes may be excluded. In certain embodiments, the complement response, coagulation response, inflammatory response, immune response and / or immunomodulatory transgenes may all be expressed simultaneously at detectable and / or clinically effective levels. In other embodiments, only a specific subset of transgenes may be expressed at clinically effective levels at certain time points or in response to certain signals. In these embodiments, the expression of one or more of said transgenes may drop below detectable and / or clinically effective levels at certain time points.

[0018] In certain embodiments, the isolated cells, tissues, organs and animals provided herein contain the transgenes CD46, CD55, HLA-E, CD47, CD39, THBD and TFPI.

[0019] In certain embodiments, the isolated cells, tissues, organs and animals provided herein contain the transgenes CD46, CD55, CD59, HLA-E, B2M, CD47, CD39, THBD and TFPI.

[0020] In certain embodiments, the isolated cells, tissues, organs and animals provided herein contain the transgenes CD46, CD55, CD59, HLA-E, B2M, CD47, CD39, THBD, TFPI, A20, PD-L1 and HO-1.

[0021] The proteins or genes referred to herein may be those according to the following table. The sequences are incorporated by reference.

[0022]

[0023]

[0024] In certain embodiments, the isolated cells, tissues, organs, and animals disclosed herein further comprise one or more modifications to genes responsive to complement, genes involved in the blood clotting response, genes involved in the inflammatory response, genes involved in the immune response, and / or genes involved in immune regulation. For example, in certain embodiments in which the cell, tissue, organ, or animal is a pig, the cell, tissue, organ, or animal may comprise alterations to the von Willebrand factor (vWF) gene, including, in some cases, alterations that result in humanization of the gene.

[0025] In certain embodiments, the cells, tissues, organs, and animals disclosed herein further comprise one or more modifications to other classes of genes. These modifications can include, for example, deletion or excision (i.e., knockout) of all or part of the gene, or any other inactivation, disruption, or alteration. For example, in certain embodiments, the cells, tissues, organs, and animals may comprise a knockout, inactivation, or disruption of asialoglycoprotein receptor 1 (ASGR1). In certain embodiments, the cells, tissues, organs, and animals may be genetically modified to exhibit a reduced carbohydrate antigen response. For example, the cell, tissue, organ, or animal may comprise a knockout, inactivation, or disruption of one or more carbohydrate antigen-producing genes (e.g., glycoprotein α-galactosyltransferase 1 (GGTA), β1,4-N-acetylgalactosaminyltransferase 2 (B4GalNT2), cytidine monophosphate-N-acetylneuraminic acid hydroxylase (CMAH)).

[0026] In certain embodiments, the isolated cells, tissues, organs, and animals provided herein comprise the transgenes CD46, CD55, HLA-E, CD47, CD39, THBD, and TFPI, and further comprise a knockout, inactivation, or disruption of GGTA, B4GalNT2, and CMAH. In certain embodiments, the isolated cells, tissues, organs, and animals further comprise the transgenes CD59 and B2M, and in some of those embodiments, the isolated cells, tissues, organs, and animals further comprise the transgenes A20, PD-L1, and HO-1. In certain embodiments, these cells, tissues, organs, and animals exhibit enhanced immunocompatibility, including a reduced carbohydrate antigen response and enhanced blood clotting, complement, inflammatory, and / or immune responses.

[0027] In some embodiments, the isolated cells, tissues, organs, and animals provided herein are porcine, i.e., porcine cells, porcine tissues, porcine organs, or pigs or their progeny. In certain of these embodiments, the cells, tissues, organs, or animals are free of porcine endogenous retroviruses (“PERV-free”). In certain of these embodiments, the PERV-free cells, tissues, organs, or animals do not produce xenotropic PERV virions. In certain of these embodiments, the PERV-free cells, tissues, organs, or animals do not produce PERV virions. In certain of these embodiments, the PERV-free cells, tissues, organs, or animals do not produce infectious PERV virions. In certain of these embodiments, the PERV-free cells, tissues, organs, and animals comprise the transgenes CD46, CD55, HLA-E, CD47, CD39, THBD, and TFPI, and optionally further comprise a knockout, inactivation, or disruption of GGTA, B4GalNT2, and / or CMAH. In other embodiments, the PERV-free cells, tissues, organs, and animals comprise the transgenes CD46, CD55, CD59, HLA-E, B2M, CD47, CD39, THBD, and TFPI, and optionally further comprise a knockout, inactivation, or disruption of GGTA, B4GalNT2, and / or CMAH. In still other embodiments, the PERV-free cells, tissues, organs, and animals comprise the transgenes CD46, CD55, CD59, HLA-E, B2M, CD47, CD39, THBD, TFPI, A20, PD-L1, and HO-1, and optionally further comprise a knockout, inactivation, or disruption of GGTA, B4GalNT2, or CMAH.

[0028] In certain embodiments of the isolated cells and tissues provided herein, the cells or tissues are kidney or liver cells or tissues. In certain embodiments of the isolated organs provided herein, the organ is a kidney or a liver.

[0029] In another aspect, the present disclosure provides a vector comprising a plurality of transgenes of at least two types selected from inflammatory response transgenes, immune response transgenes, immunomodulatory transgenes, or combinations thereof. In some embodiments, the plurality of transgenes comprises three types selected from inflammatory response transgenes, immune response transgenes, immunomodulatory transgenes, or combinations thereof. In some aspects, the present disclosure provides a vector comprising a plurality of transgenes, wherein the plurality of transgenes comprises at least one inflammatory response transgene, at least one immune response transgene, and at least one immunomodulatory transgene. In some embodiments, the inflammatory response transgene is selected from A20, HO-1, CD47, and combinations thereof. In some embodiments, the immune response transgene is selected from HLA-E, B2M, and combinations thereof. In some embodiments, the immunomodulatory transgene is selected from PD-L1, FasL, and combinations thereof. In some embodiments, the plurality of transgenes further comprises at least one coagulation response transgene. In some embodiments, the coagulation response transgene is selected from CD39, THBD, TFPI, and combinations thereof. In some embodiments, the plurality of transgenes further comprises at least one complement response transgene. In some embodiments, the complement response transgene is selected from CD46, CD55, CD59, and combinations thereof.

[0030] In other aspects, the present disclosure provides vectors for genetically modifying cells, tissues, organs, or animals to produce the cells, tissues, organs, or animals provided herein, including, for example, vectors for inserting (i.e., knocking in) one or more complement response, coagulation response, inflammatory response, immune response, and / or immunomodulatory transgenes. In certain of these embodiments, the vector comprises at least 6, 7, 8, 9, 10, 11, or 12 of the transgenes. In some of these embodiments, at least six of the transgenes are expressed from a single locus. Also provided herein are other components for genetically modifying cells, tissues, organs, or animals to produce the cells, tissues, organs, or animals provided herein, including, for example, CRISPR-based editing components such as guide RNA (gRNA) or endonucleases.

[0031] In certain embodiments, the vectors provided herein comprise the transgenes CD46, CD55, HLA-E, CD47, CD39, THBD, and TFPI. In certain of these embodiments, the vector further comprises the transgenes CD59 and B2M. In certain of these embodiments, the vector further comprises the transgenes A20, PD-L1, and HO-1, and in certain of these embodiments, the vector comprises the components as Figures 17 - 20 , Figure 31 or Figures 48 - 50 shown. In certain embodiments, the vector comprises a sequence as shown in any of SEQ ID NO: 212-214.

[0032] In certain embodiments, the present disclosure also provides methods for generating the isolated cells, tissues, organs, and animals provided herein. In some of these embodiments, the methods include introducing one or more of the vectors provided herein. Accordingly, in certain embodiments, the cells, tissues, organs, and animals provided herein contain one or more of the vectors disclosed herein.

[0033] In some embodiments, the methods disclosed and described herein include single-copy polycistronic transgene integration by transposition, single / double allelic locus-specific integration by recombinase-mediated cassette exchange (RMCE), genome replacement, endogenous gene humanization, or any combination thereof.

[0034] In certain embodiments of the methods provided herein, wherein the cells, tissues, organs, and animals generated are pigs, the methods further include knocking out or otherwise disrupting or inactivating one or more PERV genes, such as PERVpol, and in some of these embodiments, the resulting pig cells, tissues, organs, or animals are PERV-free.

[0035] In another aspect, the present disclosure provides transgenic pig livers having reduced liver damage and / or stable clotting when exposed to non-pig blood, wherein reduced liver damage is evaluated by determining the levels of bile production, one or more metabolic enzymes, and / or one or more serum electrolytes, and wherein stable clotting is evaluated by determining the levels of prothrombin time (PT) and international normalized ratio (PT-NIR), fibrinogen level (FIB), and / or lower activated partial thromboplastin time (APTT). In some embodiments, the metabolic enzymes are selected from alanine aminotransferase (ALT), aspartate aminotransferase (AST), and albumin (ALB). In some embodiments, the serum electrolytes are potassium (K) and / or sodium (Na).

[0036] In some embodiments, the transgenic pig livers disclosed and described herein contain native metabolic enzymes selected from alanine aminotransferase (ALT), aspartate aminotransferase (AST), and albumin (ALB).

[0037] This application also includes the following embodiments.

[0038] 1. An isolated cell, tissue, organ, or animal comprising a plurality of transgenes of at least two types selected from inflammatory response transgenes, immune response transgenes, immune regulatory transgenes, and combinations thereof.

[0039] 2. An isolated cell, tissue, organ or animal comprising a plurality of transgenes, wherein the plurality of transgenes comprises at least one inflammation response transgene, at least one immune response transgene and at least one immune regulatory transgene.

[0040] 3. The isolated cell, tissue, organ or animal according to embodiment 1 or 2, wherein the inflammation response transgene is selected from TNF α-induced protein 3 (A20), heme oxygenase (HO-1), cluster of differentiation 47 (CD47) and combinations thereof.

[0041] 4. The isolated cell, tissue, organ or animal according to embodiment 1 or 2, wherein the immune response transgene is selected from human leukocyte antigen-E (HLA-E), β-2 microglobulin (B2M) and combinations thereof.

[0042] 5. The isolated cell, tissue, organ or animal according to any one of embodiments 1 or 2, wherein the immune regulatory transgene is selected from programmed death ligand 1 (PD-L1), Fas ligand (FasL) and combinations thereof.

[0043] 6. The isolated cell, tissue, organ or animal according to embodiment 1 or 2, wherein the plurality of transgenes further comprises at least one coagulation response transgene.

[0044] 7. The isolated cell, tissue, organ or animal according to embodiment 6, wherein the coagulation response transgene is selected from cluster of differentiation 39 (CD39), thrombomodulin (THBD), tissue factor pathway inhibitor (TFPI) and combinations thereof.

[0045] 8. The isolated cell, tissue, organ or animal according to embodiment 1 or 2, wherein the plurality of transgenes further comprises at least one complement response transgene.

[0046] 9. The isolated cell, tissue, organ or animal according to embodiment 8, wherein the complement response transgene is selected from human membrane cofactor protein (hCD46), human complement decay-accelerating factor (hCD55), human MAC inhibitor factor (hCD59) and combinations thereof.

[0047] 10. An isolated cell, tissue, organ or animal comprising six or more transgenes, the transgenes being independently selected from complement response transgenes, coagulation response transgenes, inflammation response transgenes, immune response transgenes and immune regulatory transgenes.

[0048] 11. The isolated cell, tissue, organ or animal according to embodiment 10, wherein the isolated cell, tissue, organ or animal comprises 9, 10, 11 or 12 transgenes.

[0049] 12. The isolated cell, tissue, organ or animal according to embodiment 10, wherein the complement response transgene is selected from human membrane cofactor protein (hCD46), human complement decay-accelerating factor (hCD55), human MAC inhibitor factor (hCD59), and combinations thereof.

[0050] 13. The isolated cell, tissue, organ or animal according to embodiment 10, wherein the coagulation response transgene is selected from cluster of differentiation 39 (CD39), thrombomodulin (THBD), tissue factor pathway inhibitor (TFPI), and combinations thereof.

[0051] 14. The isolated cell, tissue, organ or animal according to embodiment 10, wherein the inflammatory response transgene is selected from TNF α-induced protein 3 (A20), heme oxygenase (HO-1), cluster of differentiation 47 (CD47), and combinations thereof.

[0052] 15. The isolated cell, tissue, organ or animal according to embodiment 10, wherein the immune response transgene is selected from human leukocyte antigen-E (HLA-E), β-2 microglobulin (B2M), and combinations thereof.

[0053] 16. The isolated cell, tissue, organ or animal according to any one of embodiments 10, wherein the immune regulatory transgene is selected from programmed death ligand 1 (PD-L1), Fas ligand (FasL), and combinations thereof.

[0054] 17. The isolated cell, tissue, organ or animal according to any one of embodiments 10-16, wherein the six or more transgenes are selected from hCD46, hCD55, hCD59, HLA-E, B2M, CD47, CD39, THBD, TFPI, A20, PD-L1, and HO-1.

[0055] 18. The isolated cell, tissue, organ or animal according to embodiment 17, wherein the cell, tissue, organ or animal comprises the hCD46, hCD55, hCD59, CD39, THBD, TFPI, A20, HO-1, CD47, HLA-E, B2M, and PD-L1 transgenes or the THBD, TFPI, CD39, CD46, CD55, CD59, CD46, HO-1, A20, B2M, HLA-E SCT, and CD47 transgenes.

[0056] 19. The isolated cell, tissue, organ or animal according to embodiment 18, which comprises Figures 17 - 20 , Figure 31 or Figures 47 - 49a vector in one of them.

[0057] 20. The isolated cell, tissue, organ or animal according to any one of embodiments 10-19, wherein the at least six transgenes are expressed from a single locus.

[0058] 21. The isolated cell, tissue, organ or animal according to any one of embodiments 10-20, wherein the at least six transgenes are expressed at a clinically effective level.

[0059] 22. The isolated cell, tissue, organ or animal according to any one of embodiments 10-21, which further comprises a genetically modified von Willebrand factor (vWF) gene.

[0060] 23. The isolated cell, tissue, organ or animal according to embodiment 22, wherein the modified vWF gene is humanized.

[0061] 24. The isolated cell, tissue, organ or animal according to any one of embodiments 10-23, which further comprises a deletion, disruption or inactivation of asialoglycoprotein receptor 1 (ASGR1).

[0062] 25. The isolated cell, tissue, organ or animal according to any one of embodiments 1-24, which further comprises a deletion, disruption or inactivation of one or more carbohydrate antigen genes.

[0063] 26. The isolated cell, tissue, organ or animal according to embodiment 25, wherein the one or more carbohydrate antigen genes are selected from glycoprotein α-galactosyltransferase 1 (GGTA), β1,4 N-acetylgalactosaminyltransferase 2 (B4GalNT2), cytidine monophosphate-N-acetylneuraminic acid hydroxylase (CMAH).

[0064] 27. The isolated cell, tissue, organ or animal according to any one of embodiments 1-26, wherein the isolated cell, tissue, organ or subject is a porcine cell, porcine tissue, porcine organ, pig or its offspring.

[0065] 28. The isolated cell, tissue, organ or animal according to embodiment 27, wherein the isolated cell, tissue, organ or animal is a PERV-free porcine cell, PERV-free porcine tissue or PERV-free pig.

[0066] 29. The isolated cell, tissue, organ or animal according to any one of embodiments 1-28, wherein the organ is a kidney or a liver.

[0067] 30. A vector comprising a plurality of transgenes of at least two types selected from inflammatory response transgenes, immune response transgenes, immune regulatory transgenes, and combinations thereof.

[0068] 31. A vector comprising a plurality of transgenes, wherein the plurality of transgenes includes at least one inflammatory response transgene, at least one immune response transgene, and at least one immune regulatory transgene.

[0069] 32. The vector according to embodiment 30 or 31, wherein the inflammatory response transgene is selected from TNF α-induced protein 3 (A20), heme oxygenase (HO-1), cluster of differentiation 47 (CD47), and combinations thereof.

[0070] 33. The vector according to any one of embodiments 30-32, wherein at least partial expression of the inflammatory response transgene is driven by a tissue-specific promoter, a ubiquitous promoter, or any combination thereof.

[0071] 34. The vector according to embodiment 33, wherein the tissue-specific promoter is an endothelium-specific promoter.

[0072] 35. The vector according to embodiment 30 or 31, wherein the immune response transgene is selected from human leukocyte antigen-E (HLA-E), β-2 microglobulin (B2M), and combinations thereof.

[0073] 36. The vector according to any one of embodiments 30, 31, or 35, wherein at least partial expression of the immune response transgene is driven by a ubiquitous promoter.

[0074] 37. The vector according to embodiment 30 or 31, wherein the immune regulatory transgene is selected from programmed death ligand 1 (PD-L1), Fas ligand (FasL), and combinations thereof.

[0075] 38. The vector according to embodiment 30 or 31, wherein the plurality of transgenes further includes at least one coagulation response transgene.

[0076] 39. The vector according to embodiment 38, wherein the coagulation response transgene is selected from cluster of differentiation 39 (CD39), thrombomodulin (THBD), tissue factor pathway inhibitor (TFPI), and combinations thereof.

[0077] 40. The vector according to embodiment 38 or 39, wherein at least partial expression of the coagulation response transgene is driven by a tissue-specific promoter.

[0078] 41. The vector according to embodiment 40, wherein the tissue-specific promoter is an endothelium-specific promoter.

[0079] 42. The vector according to embodiment 41, wherein the endothelial-specific promoter is a low-expression endothelial-specific promoter.

[0080] 43. The vector according to embodiment 30 or 31, wherein the plurality of transgenes further comprises at least one complement response transgene.

[0081] 44. The vector according to embodiment 43, wherein the complement response transgene is selected from human membrane cofactor protein (hCD46), human complement decay-accelerating factor (hCD55), human MAC inhibitor factor (hCD59), and combinations thereof.

[0082] 45. The vector according to embodiment 43 or 44, wherein the expression of at least a portion of the complement response transgene is driven by a ubiquitous promoter.

[0083] 46. A vector comprising six or more transgenes, each independently selected from complement response transgenes, blood coagulation response transgenes, inflammatory response transgenes, immune response transgenes, and immunomodulatory transgenes.

[0084] 47. The vector according to embodiment 46, wherein the vector comprises 9, 10, 11, or 12 transgenes.

[0085] 48. The vector according to embodiment 46, wherein the complement response transgene is selected from human membrane cofactor protein (hCD46), human complement decay-accelerating factor (hCD55), human MAC inhibitor factor (hCD59), and combinations thereof.

[0086] 49. The vector according to any one of embodiments 46-48, wherein the expression of at least a portion of the complement response transgene is driven by a ubiquitous promoter.

[0087] 50. The vector according to embodiment 46, wherein the blood coagulation response transgene is selected from cluster of differentiation 39 (CD39), thrombomodulin (THBD), tissue factor pathway inhibitor (TFPI), and combinations thereof.

[0088] 51. The vector according to any one of embodiments 43-50, wherein the expression of at least a portion of the blood coagulation response transgene is driven by a tissue-specific promoter.

[0089] 52. The vector according to embodiment 51, wherein the tissue-specific promoter is an endothelial-specific promoter.

[0090] 53. The vector according to embodiment 52, wherein the endothelial-specific promoter is a low-expression endothelial-specific promoter.

[0091] 54. The vector according to embodiment 46, wherein the inflammatory response transgene is selected from TNF α-induced protein 3 (A20), heme oxygenase (HO-1), cluster of differentiation 47 (CD47), and combinations thereof.

[0092] 55. The vector according to any one of embodiments 46-54, wherein at least partial expression of the inflammatory response transgene is driven by a tissue-specific promoter, a ubiquitous promoter, or any combination thereof.

[0093] 56. The vector according to embodiment 55, wherein the tissue-specific promoter is an endothelium-specific promoter.

[0094] 57. The vector according to embodiment 46, wherein the immune response transgene is selected from human leukocyte antigen-E (HLA-E), β-2 microglobulin (B2M), and combinations thereof.

[0095] 58. The vector according to any one of embodiments 46-57, wherein at least partial expression of the immune response transgene is driven by a ubiquitous promoter.

[0096] 59. The vector according to embodiment 46, wherein the immunomodulatory transgene is selected from programmed death ligand 1 (PD-L1), Fas ligand (FasL), and combinations thereof.

[0097] 60. The vector according to any one of embodiments 46-59, wherein the six or more transgenes are selected from hCD46, hCD55, hCD59, HLA-E, B2M, CD47, CD39, THBD, TFPI, A20, PD-L1, and HO-1.

[0098] 61. The vector according to embodiment 60, wherein the vector comprises the hCD46, hCD55, hCD59, CD39, THBD, TFPI, A20, HO-1, CD47, HLA-E, B2M, and PD-L1 transgenes or the THBD, TFPI, CD39, CD46, CD55, CD59, CD46, HO-1, A20, B2M, HLA-E SCT, and CD47 transgenes.

[0099] 62. The vector according to embodiment 61, which comprises Figures 17 - 20 , Figure 31 or Figures 47 - 49 one of the vectors therein.

[0100] 63. The vector according to any one of embodiments 46-62, wherein the at least six transgenes are expressed from a single locus.

[0101] 64. A method of generating an isolated cell, tissue, or animal according to any one of embodiments 1 to 29.

[0102] 65. The method according to embodiment 64, comprising single-copy polycistronic transgene integration by transposition, single / double allelic site-specific integration by recombinase-mediated cassette exchange (RMCE), genomic replacement, endogenous gene humanization, or any combination thereof.

[0103] 66. A transgenic pig liver having reduced liver damage and / or stable blood clotting upon exposure to non-porcine blood,

[0104] wherein the reduced liver damage is evaluated by determining the level of one or more of bile production, one or more metabolic enzymes, and one or more serum electrolytes, and

[0105] wherein the stable blood clotting is evaluated by determining the level of one or more of prothrombin time (PT) and international normalized ratio (PT-NIR), fibrinogen level (FIB), and lower activated partial thromboplastin time (APTT).

[0106] 67. The transgenic pig liver according to embodiment 66, wherein the metabolic enzyme is selected from alanine aminotransferase (ALT), aspartate aminotransferase (AST), and albumin (ALB).

[0107] 68. The transgenic pig liver according to embodiment 66 or 67, wherein the serum electrolyte is potassium (K) and / or sodium (Na).

[0108] 69. An isolated pig cell, tissue, organ, or animal, the isolated pig cell, tissue, organ, or animal:

[0109] (a) contains multiple transgenes selected from inflammatory response transgenes, immune response transgenes, immune regulation transgenes, and any combination thereof, and

[0110] (b) is substantially free of the production of xenotropic porcine endogenous retrovirus (PERV) virions.

[0111] 70. An isolated pig cell, tissue, organ, or animal, the isolated pig cell, tissue, organ, or animal:

[0112] (a) contains multiple transgenes, wherein the multiple transgenes include at least one inflammatory response transgene, at least one immune response transgene, and at least one immune regulation transgene, and

[0113] (b) substantially no production of xenotropic porcine endogenous retrovirus (PERV) virions.

[0114] 71. The isolated porcine cell, tissue, organ or animal according to embodiment 69 or 70, wherein the isolated porcine cell, tissue, organ or animal is substantially free of the enzymatic activity of PERV polymerase (pol).

[0115] 72. The isolated porcine cell, tissue, organ or animal according to embodiment 69 or 70, wherein the isolated porcine cell, tissue, organ or animal is substantially free of the expression of functional full-length PERV pol protein.

[0116] 73. The isolated porcine cell, tissue, organ or animal according to embodiment 69 or 70, wherein the coding sequences of at least about 97% of the genomic PERV pol copies are disrupted.

[0117] 74. The isolated porcine cell, tissue, organ or animal according to embodiment 69 or 70, wherein the coding sequences of substantially all genomic PERV pol copies are disrupted.

[0118] 75. The isolated porcine cell, tissue, organ or animal according to embodiment 69 or 70, wherein the coding sequences of at least about 97% of the PERV pol mRNAs transcribed from genomic PERV pol copies are disrupted.

[0119] 76. The isolated porcine cell, tissue, organ or animal according to any one of embodiments 73-75, wherein the disruption comprises at least one frameshift insertion / deletion (indel) at at least one nucleotide position of the PERV pol coding sequence.

[0120] 77. The isolated porcine cell, tissue, organ or animal according to any one of embodiments 69-76, wherein the isolated porcine cell, tissue, organ or animal expresses functional PERV gag and / or env proteins.

[0121] 78. The isolated porcine cell, tissue, organ or animal according to any one of embodiments 69-77, wherein the isolated porcine cell, tissue, organ or animal contains the complete coding sequences of substantially all genomic copies of the PERV gag and / or env genes.

[0122] 79. The isolated porcine cell, tissue, organ or animal according to any one of embodiments 69-78, wherein the isolated porcine cell, tissue, organ or animal exhibits reduced PERV infectivity towards human cells.

[0123] 80. An isolated porcine cell, tissue, organ, or animal according to embodiment 79, wherein the isolated porcine cell, tissue, organ, or animal exhibits at least 200-fold lower PERV infectivity for human cells compared to wild-type porcine cells.

[0124] 81. An isolated porcine cell, tissue, organ, or animal according to embodiment 79 or 80, wherein the isolated porcine cell, tissue, organ, or animal exhibits reduced PERV infectivity for human cells compared to an isolated porcine cell, tissue, organ, or animal lacking a genomic modification targeting the PERV pol gene or mRNA.

[0125] 82. An isolated porcine cell, tissue, organ, or animal according to any one of embodiments 79-81, wherein PERV infectivity is determined by co-culturing the isolated porcine cell, tissue, organ, or animal or a surgical explant thereof with human cells.

[0126] 83. An isolated porcine cell, tissue, organ, or animal according to any one of embodiments 79-81, which is a porcine animal, wherein PERV infectivity is determined by co-culturing extracellular fluid derived from the porcine animal with human cells.

[0127] 84. An isolated porcine cell, tissue, organ, or animal according to embodiment 82 or 83, wherein PERV infectivity is at least partially determined by analyzing the human cells for the presence of PERV genomic sequences or antigens after co-culture using sequencing, PCR, or immunoassay.

[0128] 85. An isolated porcine cell, tissue, organ, or animal according to any one of embodiments 69-84, wherein the PERV is PERV-A, PERV-B, PERV-A / C, or a recombinant variant thereof.

[0129] 86. An isolated porcine cell, tissue, organ, or animal according to any one of embodiments 69-85, wherein the inflammatory response transgene is selected from TNF α-induced protein 3 (A20), heme oxygenase (HO-1), cluster of differentiation 47 (CD47), and any combination thereof.

[0130] 87. An isolated porcine cell, tissue, organ, or animal according to any one of embodiments 69-86, wherein the immune response transgene is selected from human leukocyte antigen-E (HLA-E), β-2 microglobulin (B2M), and any combination thereof.

[0131] 88. An isolated porcine cell, tissue, organ or animal according to any one of embodiments 69 - 87, wherein the immunomodulatory transgene is selected from programmed death ligand 1 (PD - L1), Fas ligand (FasL), and any combination thereof.

[0132] 89. An isolated porcine cell, tissue, organ or animal according to any one of embodiments 69 - 88, wherein the plurality of transgenes further comprises at least one coagulation response transgene.

[0133] 90. An isolated porcine cell, tissue, organ or animal according to embodiment 89, wherein the coagulation response transgene is selected from cluster of differentiation 39 (CD39), thrombomodulin (THBD), tissue factor pathway inhibitor (TFPI), and any combination thereof.

[0134] 91. An isolated porcine cell, tissue, organ or animal according to any one of embodiments 69 - 90, wherein the plurality of transgenes further comprises at least one complement response transgene.

[0135] 92. An isolated porcine cell, tissue, organ or animal according to embodiment 91, wherein the complement response transgene is selected from human membrane cofactor protein (hCD46), human complement decay - accelerating factor (hCD55), human MAC inhibitor factor (hCD59), and any combination thereof.

[0136] 93. An isolated porcine cell, tissue, organ or animal according to any one of embodiments 69 - 92, wherein the isolated porcine cell, tissue, organ or animal comprises genomic integration of the transgene.

[0137] 94. An isolated porcine cell, tissue, organ or animal according to any one of embodiments 93, wherein the isolated porcine cell, tissue, organ or animal comprises a germline - transmissible genomic integration of the transgene.

[0138] 95. An isolated porcine cell, tissue, organ or animal according to any one of embodiments 69 - 94, wherein the porcine cell, tissue, organ or animal expresses a detectable level of mRNA transcribed from the transgene.

[0139] 96. An isolated porcine cell, tissue, organ or animal according to any one of embodiments 69 - 95, wherein the porcine cell, tissue, organ or animal expresses a detectable level of protein translated from the transgene.

[0140] 97. An isolated porcine cell, tissue, organ, or animal according to any one of embodiments 69-95, wherein the porcine cell, tissue, organ, or animal expresses a therapeutically effective level of a protein translated from mRNA transcribed from the transgene.

[0141] 98. An isolated porcine cell, tissue, organ, or animal, the isolated porcine cell, tissue, organ, or animal:

[0142] (a) comprises six or more transgenes, each independently selected from a complement response transgene, a coagulation response transgene, an inflammatory response transgene, an immune response transgene, and an immunomodulatory transgene, and

[0143] (b) is substantially free of the production of xenotropic porcine endogenous retrovirus (PERV) virions.

[0144] 99. An isolated porcine cell, tissue, organ, or animal according to embodiment 98, wherein the isolated porcine cell, tissue, organ, or animal comprises 9, 10, 11, or 12 of the transgenes.

[0145] 100. An isolated porcine cell, tissue, organ, or animal according to embodiment 98 or 99, wherein the complement response transgene is selected from human membrane cofactor protein (hCD46), human complement decay-accelerating factor (hCD55), human MAC inhibitor factor (hCD59), and combinations thereof.

[0146] 101. An isolated porcine cell, tissue, organ, or animal according to embodiment 100, wherein at least a portion of the transcription of the complement response transgene is under the transcriptional control of a ubiquitous promoter.

[0147] 102. An isolated porcine cell, tissue, organ, or animal according to any one of embodiments 98-101, wherein the coagulation response transgene is selected from cluster of differentiation 39 (CD39), thrombomodulin (THBD), tissue factor pathway inhibitor (TFPI), and combinations thereof.

[0148] 103. An isolated porcine cell, tissue, organ, or animal according to any one of embodiments 98-102, wherein at least a portion of the transcription of the coagulation response transgene is under the transcriptional control of a tissue-specific promoter.

[0149] 104. An isolated porcine cell, tissue, organ, or animal according to embodiment 103, wherein the tissue-specific promoter is an endothelium-specific promoter.

[0150] 105. The isolated porcine cell, tissue, organ or animal according to embodiment 104, wherein the endothelial-specific promoter is a low-expression endothelial-specific promoter.

[0151] 106. The isolated porcine cell, tissue, organ or animal according to any one of embodiments 98-105, wherein the inflammation response transgene is selected from TNF α-induced protein 3 (A20), heme oxygenase (HO-1), cluster of differentiation 47 (CD47), and combinations thereof.

[0152] 107. The isolated porcine cell, tissue, organ or animal according to any one of embodiments 98-106, wherein at least a portion of the transcription of the inflammation response transgene is driven by a tissue-specific promoter, a ubiquitous promoter, or any combination thereof.

[0153] 108. The isolated porcine cell, tissue, organ or animal according to embodiment 107, wherein the tissue-specific promoter is an endothelial-specific promoter.

[0154] 109. The isolated porcine cell, tissue, organ or animal according to any one of embodiments 98-108, wherein the immune response transgene is selected from human leukocyte antigen-E (HLA-E), β-2 microglobulin (B2M), and combinations thereof.

[0155] 110. The isolated porcine cell, tissue, organ or animal according to any one of embodiments 98-109, wherein at least a portion of the expression of the immune response transgene is driven by a ubiquitous promoter.

[0156] 111. The isolated porcine cell, tissue, organ or animal according to any one of embodiments 98-110, wherein the immune regulatory transgene is selected from programmed death ligand 1 (PD-L1), Fas ligand (FasL), and combinations thereof.

[0157] 112. The isolated porcine cell, tissue, organ or animal according to any one of embodiments 98-111, wherein the six or more transgenes are selected from hCD46, hCD55, hCD59, HLA-E, B2M, CD47, CD39, THBD, TFPI, A20, PD-L1, and HO-1.

[0158] 113. An isolated porcine cell, tissue, organ or animal according to any one of embodiments 98-112, wherein the cell, tissue, organ or animal comprises hCD46, hCD55, hCD59, CD39, THBD, TFPI, A20, HO-1, CD47, HLA-E, B2M and PD-L1 transgenes or THBD, TFPI, CD39, CD46, CD55, CD59, CD46, HO-1, A20, B2M, HLA-E SCT and CD47 transgenes.

[0159] 114. An isolated porcine cell, tissue, organ or animal according to any one of embodiments 98-113, wherein the transgene is expressed from a single locus.

[0160] 115. An isolated porcine cell, tissue, organ or animal according to any one of embodiments 98-114, wherein the transgene is transcribed into no more than 3 cis-acting units.

[0161] 116. An isolated porcine cell, tissue, organ or animal according to embodiment 115, wherein the cis-acting unit comprises coding sequences of at least 3 different transgenes, wherein the at least 3 different transgenes are separated by the coding sequence of porcine teschovirus 2A (P2A) peptide.

[0162] 117. An isolated cell, tissue, organ or animal according to any one of embodiments 69-116, which further comprises a deletion, disruption or inactivation of one or more genes producing xeno-carbohydrate antigens.

[0163] 118. An isolated cell, tissue, organ or animal according to embodiment 117, wherein the one or more genes producing xeno-carbohydrate antigens are selected from glycoprotein α-galactosyltransferase 1 (GGTA), β1,4 N-acetylgalactosaminyltransferase 2 (B4GalNT2), cytidine monophosphate-N-acetylneuraminic acid hydroxylase (CMAH).

[0164] 119. An isolated cell, tissue, organ or animal according to embodiment 118, which comprises a deletion, disruption or inactivation of 2 copies of GGTA, 4 copies of B4GALNT2 or 2 copies of CMAH or any combination thereof.

[0165] 120. An isolated porcine cell, tissue, organ or animal, the isolated porcine cell, tissue, organ or animal:

[0166] (a) comprises six or more transgenes, each of the transgenes being independently selected from complement response transgenes, coagulation response transgenes, inflammatory response transgenes, immune response transgenes and immune regulation transgenes,

[0167] (b) substantially no production of xenotropic porcine endogenous retrovirus (PERV) virions, and

[0168] (c) deletion, disruption or inactivation of 2 copies of GGTA, 4 copies of B4GALNT2, or 2 copies of CMAH, or any combination thereof.

[0169] 121. An isolated porcine cell, tissue, organ or animal according to any one of embodiments 69-120, wherein the cell, tissue, organ or animal exhibits reduced binding to human antibodies upon exposure to human blood or a fraction thereof.

[0170] 122. An isolated porcine cell, tissue, organ or animal according to embodiment 121, wherein the cell, tissue, organ or animal exhibits at least about a 5-fold reduction in binding to human antibodies upon exposure to human blood or a fraction thereof.

[0171] 123. An isolated porcine cell, tissue, organ or animal according to embodiment 121, wherein the cell, tissue, organ or animal exhibits at least about a 10-fold reduction in binding to human antibodies upon exposure to human blood or a fraction thereof.

[0172] 124. An isolated porcine cell, tissue, organ or animal according to any one of embodiments 121-123, wherein the antibody is an IgM antibody.

[0173] 125. An isolated porcine cell, tissue, organ or animal according to any one of embodiments 121-123, wherein the antibody is an IgG antibody.

[0174] 126. An isolated porcine cell, tissue, organ or animal according to any one of embodiments 69-125, wherein the cell, tissue, organ or animal exhibits reduced natural killer (NK) cell cytotoxicity upon exposure to human blood.

[0175] 127. An isolated porcine cell, tissue, organ or animal according to embodiment 126, wherein the cell, tissue, organ or animal exhibits at least about a 20% reduction in natural killer (NK) cell cytotoxicity upon exposure to human blood.

[0176] 128. An isolated porcine cell, tissue, organ or animal according to any one of embodiments 69-127, wherein the cell, tissue, organ or animal exhibits reduced complement toxicity upon exposure to complement from human blood.

[0177] 129. The isolated porcine cells, tissues, organs, or animals according to embodiment 128, wherein the cells, tissues, organs, or animals exhibit at least about 5-fold reduced complement toxicity when exposed to human complement from human blood.

[0178] 130. The isolated porcine cells, tissues, organs, or animals according to any one of embodiments 69 - 129, wherein the cells, tissues, organs, or animals exhibit reduced TAT complex formation when exposed to human blood.

[0179] 131. The isolated porcine cells, tissues, organs, or animals according to embodiment 130, wherein the cells, tissues, organs, or animals exhibit at least about 3-fold reduced TAT complex formation when exposed to human blood.

[0180] 132. The isolated porcine cells, tissues, organs, or animals according to embodiment 130, wherein the cells, tissues, organs, or animals exhibit at least about 10-fold reduced TAT complex formation when exposed to human blood.

[0181] 133. The isolated porcine cells, tissues, organs, or animals according to any one of embodiments 69 - 132, which are animals that exhibit a normal blood cell count of white blood cells, platelets, monocytes, neutrophils, eosinophils, or any combination thereof.

[0182] 134. The isolated porcine cells, tissues, organs, or animals according to any one of embodiments 69 - 133, which are animals that exhibit normal liver function, as evaluated by serum alkaline phosphatase level, aspartate aminotransferase level, alanine aminotransferase level, ALT / AST level, cholesterol, total bilirubin, triglyceride, or albumin / globulin level, or any combination thereof.

[0183] 135. The isolated porcine cells, tissues, organs, or animals according to any one of embodiments 69 - 134, which are animals that exhibit normal heart function, as evaluated by serum creatine kinase level, creatine kinase - MB level, lactate dehydrogenase level, or any combination thereof.

[0184] 136. The isolated porcine cells, tissues, organs, or animals according to any one of embodiments 69 - 135, which are animals that exhibit normal kidney function, as evaluated by serum creatinine level, urea level, or a combination thereof.

[0185] 137. The isolated porcine cells, tissues, organs, or animals according to any one of embodiments 69 - 136, which are animals that exhibit normal blood clotting function, as evaluated by thrombin time, prothrombin level, or a combination thereof.

[0186] 138. An isolated porcine cell, tissue, organ or animal according to any one of embodiments 69 - 137, which is an animal capable of transmitting the following to a progeny animal:

[0187] (a) Deletion, disruption or inactivation of one or more xeno - carbohydrate antigen - producing genes, said genes including alpha - galactosyltransferase 1 (GGTA), beta1,4 N - acetylgalactosaminyltransferase 2 (B4GalNT2) or cytidine monophosphate - N - acetylneuraminic acid hydroxylase (CMAH) or a combination thereof;

[0188] (b) The transgene;

[0189] (c) Absence of the production of xenotropic porcine endogenous retrovirus (PERV) virions; or

[0190] (d) Any combination thereof;

[0191] wherein (a) - (d) are transmitted by normal Mendelian inheritance. BRIEF DESCRIPTION OF THE DRAWINGS

[0192] Figures 1A - 1C is a graph showing the genotyping results of complement factor 3 knockout (“C3 - KO”) pigs. Figure 1A Shows the size of the introduced deletion. Figure 1B Shows the location of the indel. Figure 1C Lists the sequences of the indels generated (SEQ ID NO: 253 - 289).

[0193] Figure 2 is a block diagram depicting a strategy for major histocompatibility complex class I (“MHC class I”) replacement, wherein the locus containing the SLA - 1, SLA - 2 and SLA - 3 genes is flanked by loxP sites.

[0194] Figure 3A and Figure 3B is a graph showing the genotyping results of major histocompatibility complex (MHC) class II knockout (“MHCII - KO”) pigs, particularly the DQA gene of the MHCII gene. Figure 3A Shows the location and size of an indel having two 1bp insertions at positions 126 and 127 of the amplicon. Figure 3B Shows the location of one of the insertions.

[0195] Figure 4A and Figure 4B is a graph showing the genotyping results of another MHC class II - KO pig genotype, particularly the DRA gene of the MHCII gene. Figure 4AShows the position and size of an indel with a 1 two-bp insertion at positions 106 and 107 of the amplicon. Figure 4B Shows the position of one of the insertions (SEQ ID NO: 290 - 327).

[0196] Figure 5 Includes six graphs showing the results of fluorescence-activated cell sorting (FACS) analysis of MHCII-KO pigs (“H3-9P01”) and wild-type (“WT”) pigs.

[0197] Figure 6 Is a series of images depicting one or more phenotypes associated with the MHCII-KO phenotype.

[0198] Figure 7 Is a series of block diagrams showing the protocol for altering the PD-L1 gene.

[0199] Figure 8 Is a graph showing PD-L1 expression as measured by qPCR using two amplicons.

[0200] Figure 9 Is a sequence listing showing the alignment of porcine (SEQ ID NO: 329) and human (SEQ ID NO: 328) vWF proteins. The A1 domain is highlighted in a box, while potential glycosylation sites in the flanking regions are marked with a line. Human-specific residues missing in pvWF are marked with a horizontal line. The humanized A1 and flanking regions are marked with a semi-bracket.

[0201] Figure 10 Depicts the design of a homology-directed repair (“HDR”) vector targeting pvWF and two sgRNAs (SEQ ID NO: 5 and 6).

[0202] Figure 11 Shows the screening results of HDR via SphI and BspEI digestion.

[0203] Figure 12A and Figure 12B Shows the Figure 11 Sequencing results (SEQ ID NO: 330 - 333) of a biallelic HDR clone obtained from (where vWF was targeted). The chromatograms of the two sequencing results are illustrated with an overlapping sequence in one line. The humanized A1 and flanking regions are marked with a semi-bracket.

[0204] Figure 13 Is a graph depicting species-specific platelet aggregation responses of platelets isolated from WT (porcine A1 domain) or HDR-targeted (human A1 domain) pigs induced by shear stress and monitored by light transmission.

[0205] Figure 14 It is a schematic diagram of the porcine MHC class I locus. All classical MHC I genes are color-coded. The unique flanking regions of the UTRs adjacent to the MHC I genes are marked with green brackets. Four highly active sgRNAs (SEQ ID NO: 1-4) selected from these regions are also shown.

[0206] Figure 15 Depicts the fragment deletion of the classical MHC I cluster induced by the sgRNAs in Figure 14 . Figure 15 A shows the PCR amplicons of the unique regions of MHC I 5′, 3′, and 5′-3′ deletions junctions in the sgRNA-transfected cell population. Figure 15 B shows that TOPO cloning was performed on the 5′-3′ junction PCR, and the sequencing results were aligned with the predicted MHC I 5′-3′ junction generated by MHC5′_sg1 and MHC3′_sg2 (SEQ ID NO: 335-343).

[0207] Figure 16 Shows the enrichment of MHC I-negative cells using a porcine-specific SLA-1 antibody.

[0208] Figure 17 Shows a transgenic expression vector for expressing multiple transgenes (e.g., humanized transgenes) according to the embodiments disclosed and described herein. Payload 5 (Porcine 2.1): 12 transgenes, ubiquitously expressed.

[0209] Figure 18 Shows a transgenic expression vector for expressing multiple transgenes (e.g., humanized transgenes) according to the embodiments disclosed and described herein. Payload 9 (Porcine 2.2): 12 transgenes, endothelium-specific.

[0210] Figure 19 Shows a transgenic expression vector for expressing multiple transgenes (e.g., humanized transgenes) according to the embodiments disclosed and described herein. Payload 10 (Porcine 2.3): 12 transgenes, endothelium / islet-specific.

[0211] Figure 20 Shows a transgenic expression vector for expressing multiple transgenes (e.g., humanized transgenes) according to the embodiments disclosed and described herein. Payload 10-Exo (Porcine 2.4): 12 transgenes, endothelium / islet-specific, with pancreatic exocrine ablation.

[0212] Figure 21 Is a schematic diagram showing the pedigree of the genetically engineered donor pigs described herein.

[0213] Figure 22It is shown that genetically engineered porcine fibroblasts with enhanced compatibility with human tissues exhibit a significantly reduced binding affinity for human antibodies.

[0214] Figure 23 Shows tissue-specific mRNA expression from the primary porcine fibroblasts or endothelial cells described herein. Figure 23 A is a schematic diagram of a transgenic construct assembled using molecular cloning techniques. The CD46, CD55, and CD59 cassettes were placed under the control of the ubiquitous EF1α promoter, the HLA-E, B2M, and CD47 cassettes were placed under the control of the ubiquitous CAG promoter, the A20, PD-L1, HO-1 cassettes were placed under the control of the islet-specific NeuroD promoter, and the THBD, TFPI, and CD39 cassettes were placed under the control of the endothelial-specific ICAM2 promoter. The transgenic construct was electroporated into primary porcine fibroblasts ( Figure 23 B) or the immortalized porcine aortic endothelial cell line (PEC-A) ( Figure 23 C), and mRNA expression was determined by qRT-PCR.

[0215] Figure 24 Depicts transgenic protein expression in porcine 2.0 (“3KO + 12TG”) spleen and fibroblasts.

[0216] Figure 25 It is shown that genetically engineered porcine fibroblasts with enhanced compatibility with human cells exhibit significantly lower levels of complement-mediated cell death.

[0217] Figure 26 It is shown that porcine fibroblasts genetically engineered to express human HLA-E exhibit reduced sensitivity to NK-mediated lysis.

[0218] Figure 27 It is shown that endothelial cells derived from GGTAKO + CD55KI pigs exhibit reduced formation of the thrombin-antithrombin III (TAT) complex.

[0219] Figure 28 It is shown that livers isolated from 4 - 7 pigs and perfused with human blood have increased bile production compared to wild-type (WT) livers.

[0220] Figure 29 It is shown that livers isolated from 4 - 7 pigs and perfused with human blood have improved liver function as evaluated by markers of liver injury and serum electrolyte levels compared to WT livers.

[0221] Figure 30 It is shown that livers isolated from 4 - 7 pigs and perfused with human blood have improved clotting compared to WT livers.

[0222] Figure 31 Shows a transgenic expression vector according to the embodiments disclosed and described herein. Payload 13 (Porcine 2.5): 10 transgenes, bicistronic.

[0223] Figures 32A - 32B Indicates that host monkeys transplanted with kidneys isolated from donor pigs of Payload 9 ( Figure 32A ) and Payload 10 ( Figure 32B ) exhibited stable serum creatinine levels.

[0224] Figures 33A - 33B Shows the hematocrit levels in host monkeys transplanted with kidneys isolated from donor pigs of Payload 9 ( Figure 33A ) and Payload 10 ( Figure 33B ).

[0225] Figures 34A - 34B Shows the platelet counts in host monkeys transplanted with kidneys isolated from donor pigs of Payload 9 ( Figure 34A ) and Payload 10 ( Figure 34B ).

[0226] Figures 35A - 35B Shows the fluctuations in white blood cell (WBC) counts in host monkeys transplanted with kidneys isolated from donor pigs of Payload 9 ( Figure 35A ) and Payload 10 ( Figure 35B ).

[0227] Figure 36 Shows RNAseq expression data, which shows the expression of complement and cytotoxicity genes in samples collected from Payload 9 and Payload 10 pigs.

[0228] Figure 37 Shows FACS data, which shows the expression of complement and cytotoxicity proteins in samples collected from Payload 5, Payload 9, and Payload 10 pigs.

[0229] Figure 38 A- Figure 38 I shows the clinical laboratory after porcine-to-baboon orthotopic liver xenotransplantation (OLTx).

[0230] Figure 39 A- Figure 39 F are representative images of H+E-stained liver samples from OLTx.

[0231] Figure 40 A- Figure 40 E shows the clinical laboratory after ex vivo xenoperfusion of genetically modified porcine livers with human whole blood.

[0232] Figure 41 A- Figure 41H is a representative image of H&E staining of a xenoperfused pig liver.

[0233] Figure 42 It was shown that, relative to GalTKO.hCD55 lungs, the increase in pulmonary vascular resistance (PVR) was significantly attenuated and delayed in the 'untreated' pig 2.0 ("3KO+12TG") lungs perfused with human blood.

[0234] Figure 43 A- Figure 43 D shows the binding of a panel of human sera to human T cells ( Figure 43 A) and B cells ( Figure 43 C), indicating that high PRA sera are more likely to stain human cells than low PRA, and the binding of a panel of human sera to pig T cells ( Figure 43 B) and B cells ( Figure 43 D). Sera from both low PRA and high PRA patients showed high levels of binding to pig targets.

[0235] Figure 44 A panel of high PRA human sera is shown, which showed a significantly reduced level of binding to genetically modified porcine aortic endothelial cells (porcine 2.0 ("3KO+12TG") pAEC) compared to wild-type cells (WT pAEC). The porcine 2.0 cells lack aGal, Neu5Gc, and Sda.

[0236] Figure 45 A- Figure 45 C shows the staining of porcine 2.0 ("3KO+12TG") pAEC with sera taken from xenograft recipient animals at different time points from the kidney ( Figure 45 A), heart ( Figure 45 B), and liver ( Figure 45 C). Serum samples collected after transplantation showed reduced levels of binding, especially after liver xenotransplantation.

[0237] Figure 46 A- Figure 46 C shows the binding of human sera to wild-type (WT) and porcine 2.0 ("3KO+12TG") pAEC ( Figure 46 A), the binding of human sera ( Figure 46 B) or cynomolgus monkey sera ( Figure 46 C) to pAEC before and after IdeS treatment. IdeS effectively reduced the binding of human and cynomolgus monkey IgG, while having no effect on the binding of intact IgM.

[0238] Figure 47 Transgene expression vectors (SEQ ID NO: 344 and 345) according to the embodiments disclosed and described herein are shown. Payload 12F: 12 transgenes.

[0239] Figure 48 Shows a transgenic expression vector according to the embodiments disclosed and described herein. Payload 12G: 12 transgenes.

[0240] Figure 49 Shows a transgenic expression vector according to the embodiments disclosed and described herein. Payload 13A: 10 transgenes.

[0241] Figure 50 Shows RNAseq results indicating the expression of complement and cytotoxicity genes.

[0242] Figure 51A Shows the protocols for CRISPR gene knockout and PiggyBac integration. CRISPR / Cas9 targeting 2 copies of the GGTA1 gene, 2 copies of the CMAH gene, and 4 copies of the B4GALNT2 gene was used to generate 3KO, and CRISPR / Cas9 targeting the PERV copies in Pig 2.0 (“3KO + 9TG”) was used to generate PERV-KO cells. PiggyBac-mediated random integration was used to insert 9 transgenes into the porcine genome. The transgenes are expressed in 3 cassettes, where each cassette expresses 3 genes linked by the porcine 2A (P2A) peptide.

[0243] Figure 51B Shows the sequencing results of GGTA1 (SEQ ID NO: 346 - 348), CMAH (SEQ ID NO: 349 - 351), and B4GALNT2 (SEQ ID NO: 352 - 356) knockout. Whole genome sequencing analysis revealed that in Pig 2.0 (3KO + 9TG) and Pig 3.0 (3KO + 9TG), i) the GGTA1 gene has a -10bp deletion in one allele and a transgenic vector insertion in the other gene, ii) the CMAH gene has a -391bp deletion in one allele and a 2bp (AA) insertion in the other allele, and iii) B4GALNT2 has -13, -14, -13, -14 in each of the 4 alleles of the B4GALNT2 gene. All modifications occurred at the gRNA target sites, indicating that the modifications were mediated by the target activity of the CRISPR / Cas9 used.

[0244] Figure 51CSequencing analysis results of PERV knockout are shown. Raw reads of Pig 2.0 (3KO + 9TG) (approx. 2,000X) and 3.0 (approx. 20,000X) are shown below the schematic PERV gene structure. Reads are grouped by their sequence composition and shown proportionally to their coverage. Vertical red, blue, green, and orange lines in the coverage tracks represent single nucleotide changes from the reference allele to T, C, A, and G, respectively.

[0245] Figure 51D PCR analysis of 9TG integration is shown. Transgene integration in Pig 2.0 (3KO + 9TG) and Pig 3.0 (3KO + 9TG) has been verified by PCR at the genomic DNA (gDNA) level. The PCR gel image shows the presence of 9 human transgenes in gDNA from fetal fibroblasts of Pig 2.0 and Pig 3.0, while WT pig fetal fibroblasts and the NTC (no gDNA added) group were used as negative controls.

[0246] Figure 51E Normal karyotypes of Pig 2.0 (3KO + 9TG) and 3.0 (3KO + 9TG) cells are shown. Karyotype analysis of Pig 2.0 (A) and Pig 3.0 (B) fibroblasts was performed using Giemsa staining-based G-banding technique. Metaphase spreads were analyzed using SmartType software. Both Pig 2.0 and Pig 3.0 showed normal [36 + XY] karyotypes.

[0247] Figure 52A A heatmap of the expression of 9 transgenes is shown. Transgene expression was measured by RNA-Seq in HUVEC endothelial cells, PUVEC endothelial cells, Pig 2.0 (3KO + 9TG) PUVEC endothelial cells, Pig 2.0 ear fibroblasts, and Pig 3.0 fetal fibroblasts. Each row represents a transgene, and each column represents a sample. Expression levels are color-coded in blue-yellow-red to represent low-medium-high. The tissue type and payload information for each sample are marked as a color bar at the top of the heatmap.

[0248] Figure 52B Analysis of 3KO and 9TG expression by FACS is shown. Gene modifications (KO and TG) in Pig 2.0 (3KO + 9TG) and Pig 3.0 (3KO + 9TG) have been verified by FACS at the protein level. Overall, Pig 2.0 and Pig 3.0 PUVEC showed comparable TG expression levels to human endogenous (HUVEC), except for hCD39 (higher than human endogenous) and hTHBD (lower than human endogenous).

[0249] Figure 52CShows the immunofluorescence analysis of 3KO and 9TG expression. The genetic modifications (KO and TG) of pig 2.0 (3KO + 9TG) and pig 3.0 (3KO + 9TG) have been verified at the protein level by immunofluorescence (IF) in frozen kidney sections.

[0250] Figure 53A Shows the binding of human antibodies to pig 2.0 (3KO + 9TG) and 3.0 (3KO + 9TG) cells. Compared to their WT counterparts, pig 2.0 and pig 3.0 PUVEC substantially reduced the binding of antibodies to human IgG and IgM. Antibody binding of pooled human serum to PUVEC and HUVEC (positive control) was measured by FACS respectively. Error bars represent mean ± s.d. (n = 3).

[0251] Figure 53B Shows the complement toxicity to WT pigs, pig 2.0 (3KO + 9TG), pig 3.0 (3KO + 9TG) and HUVEC cells. Compared to HUVEC, pig 2.0 and pig 3.0 PUVEC showed comparable antibody-dependent complement toxicity, which was significantly lower compared to WT PUVEC. Error bars represent mean ± s.d. (n = 4).

[0252] Figure 53C Shows the NK-mediated cytotoxicity to WT pigs, pig 2.0 (3KO + 9TG), pig 3.O (3KO + 9TG) and HUVEC cells. Compared to their WT counterparts, pig 2.0 and pig 3.0 PUVEC showed significantly reduced NK-mediated cytotoxicity. Error bars represent mean ± s.d 。 (n = 3).

[0253] Figure 53D Shows the phagocytosis of human macrophages on pig 2.0 (3KO + 9TG) and 3.0 (3KO + 9TG) splenocytes. Pig 2.0 and pig 3.0 splenocytes showed reduced phagocytosis by the human macrophage cell line. CFSE-labeled pig 2.0 and pig 3.0 splenocytes (target cells, T) were incubated with CD11b-labeled human macrophage cell line (effector cells, E) at 37 °C for 4 hours respectively. Conducted at 2 different E:T ratios, namely 1:1 and 1:5. Phagocytosis of CFSE-labeled targets was measured by FACS, where the area of non-phagocytic macrophages is shown in the upper left quadrant (Q1), while the area of phagocytic macrophages is shown in the upper right quadrant (Q2). Phagocytic activity was calculated as Q2 / (Q1 + Q2) x 100%.

[0254] Figure 53EShows the levels of thrombin - antithrombin (TAT) formation in WT pigs, Pig 2.0 (3KO + 9TG), Pig 3.0 (3KO + 9TG), and HUVEC cells. After incubation with whole human blood for the designated time, Pig 2.0 and Pig 3.0 PUVEC mediated very low levels of thrombin - antithrombin (TAT) formation, which was comparable to HUVEC but significantly lower than WT PUVEC. Error bars represent mean ± s.d. (n = 4).

[0255] Figure 53F Shows the ADPase activity of CD39 transgene. Compared with WT PUVEC and HUVEC, Pig 2.0 (3KO + 9TG) and Pig 3.0 (3KO + 9TG) PUVEC showed significantly higher CD39 ADPase biochemical activity. (A) In Pig 2.0 and Pig 3.0, the expression of human transgenic CD39 mRNA was higher than that of endogenous CD39. (B) FACS revealed that Pig 2.0 and Pig 3.0 had higher human CD39 protein expression than WT PUVEC and HUVEC. (C) When incubated with ADP, Pig 2.0 and Pig 3.0 PUVEC had significantly higher ADPase biochemical activity of CD39, as measured by phosphate concentration. The higher CD39 ADPase biochemical activity was consistent with its higher CD39 protein expression levels in Pig 2.0 and Pig 3.0. Error bars represent standard deviation (n = 6).

[0256] Figure 53G Shows the TFPI function in 3.0 cells. In vitro, activated Pig 2.0 (3KO + 9TG) and Pig 3.0 (3KO + 9TG) PUVEC expressed human TFPI on the cell surface and showed significantly higher binding ability to human Xa compared with WT PUVEC and HUVEC. (A) RNA - Seq revealed that Pig 2.0 PUVEC expressed more human TFPI than the endogenous level of TFPI in HUVEC and the level of porcine TFPI in WT PUVEC (n = 2). (B) In vitro, compared with WT PUVEC and HUVEC, activated Pig 2.0 PUVEC showed significantly higher Xa - binding ability. Left panel: Standard curve measuring the linear regression between the concentration of human recombinant TFPI (rTFPI) protein and the level of unbound Xa. Right panel: The TFPI - Xa binding ability in Pig 2.0 EC, WT PUVEC, and HUVEC with and without PMA activation was measured by projecting the tTFPI level from the unbound Xa level using the standard curve on the left. PMA (1 μM): PUVEC and HUVEC were activated with PMA for 6 hours, which led to the translocation of hTFPI from the cytosol to the cell membrane. Error bars represent standard deviation (n = 4).

[0257] Figure 54A 、Figure 54B , Figure 54C , Figure 54D and Figure 54E show the normal phenotypes of pigs 1.0 and 2.0 pigs (3KO + 9TG). In terms of complete blood count (A), liver (B), heart (C), and kidney function (D), as well as coagulation function (E), pigs 1.0 and 2.0 showed similar pathophysiology compared to WT pigs. The sample numbers of pigs 1.0, 2.0, and WT pigs were 18, 16, and 21, respectively. "No sig" indicates that there was no statistical significance among pigs 1.0, 2.0, and the WT group by the student's t-test.

[0258] Figure 55 show the Mendelian inheritance of PERV-KO. The genetic modification of PERV-KO can be inherited following Mendelian genetics during natural mating production. The x-axis represents the total number of shifted bases calculated as the sum of insertions minus the sum of deletions. The y-axis represents the percentage of reads. Red and green indicate frameshift or non-frameshift, respectively. A pig 1.0 pig was mated with a wild-type Bama pig, and 11 piglets were produced. The liver, kidney, and heart tissues of one offspring piglet were analyzed together with the parental fibroblasts by high-throughput DNA sequencing to evaluate the inheritance of the PERV-KO modification. 100% of the PERV copies of pig 1.0 were to be knocked out, while approximately 80% of the PERV copies in WT pigs had the same size as the WT length (insertion - deletion = 0). Notably, some of the PERV copies in the WT samples may be non-functional or carry KO. In contrast, the liver, kidney, and heart of the offspring pigs only had approximately 50% of the PERV copies carrying the knockout. The patterns were similar among tissues, indicating that the PERV-KO modification was stably inherited following Mendelian genetics among different tissues.

[0259] Figure 56A , Figure 56B and Figure 56CThe Mendelian inheritance of the 9TG construct and 3KO throughout the breeding period is shown. As verified at the genomic DNA (A), mRNA (B), and protein levels (C), the gene modifications (3KO and 9TG) of this iteration of Pig 2.0 can be passed on to the next generation following Mendelian genetics through natural mating. We mated 9 WT pigs with Pig 2.0 and 11 3KO pigs with Pig 2.0 separately, and the presence of 3KO and 9TG was detected in the F1 offspring. (A) For 9TG, approximately half of the offspring of Pig 2.0 x WT pigs and Pig 2.0 x 3KO pigs carried the transgene in their genomes. For GGTA1, CMAH, and B4GALNT2, all the offspring of Pig 2.0 X WT pigs were heterozygous knockouts, and all the offspring of Pig 2.0 X 3KO pigs were homozygous knockouts. Notably, B4GALNT2 was analyzed to have four alleles due to the inclusion of its highly homologous pseudogene. (B) Approximately half (5 / 11) of the offspring of Pig 2.0 X 3KO pigs carried the mRNA corresponding to 9TG in their mRNA transcripts. 。 (C) FACS analysis verified the inheritance of 3KO and 9TG in Pig 2.0 X 3KO and Pig 2.0 X WT pigs as a reduction or absence of cell surface glycans or the presence of human proteins. Detailed Description

[0260] I. Definitions

[0261] The terms "pig," "swine," and "porcine" are used interchangeably herein and refer to any animal related to various breeds of the domestic pig species Sus scrofa.

[0262] When used to refer to a fragment or derivative of a protein or polypeptide, the term "bioactive" means that the fragment or derivative retains at least one measurable and / or detectable biological activity of the reference full-length protein or polypeptide. For example, a bioactive fragment or derivative of a CRISPR / Cas9 protein may be able to bind a gRNA, sometimes also referred to herein as a single-guide RNA (sgRNA), bind a target DNA sequence when complexed with the guide RNA, and / or cleave one or more DNA strands.

[0263] As used herein, the terms "treatment", "treating", "alleviate", etc. when used in the context of a disease, injury or disorder generally mean obtaining a desired pharmacological and / or physiological effect, and can also be used to refer to improving, alleviating and / or reducing the severity of one or more symptoms of the treated condition. In terms of completely or partially delaying the onset or recurrence of a disease, disorder or its symptoms, the effect can be prophylactic, and / or in terms of partially or completely curing a disease or disorder and / or an adverse effect attributable to the disease or disorder, the effect can be therapeutic. As used herein, "treatment" encompasses any treatment of a disease or disorder in a mammal, particularly a human, and includes: (a) preventing the occurrence of a disease or disorder in a subject who may be susceptible to the disease or disorder but has not been diagnosed as having the disease or disorder; (b) inhibiting a disease or disorder (e.g., preventing its progression); or (c) alleviating a disease or disorder (e.g., causing the disease or disorder to subside, thereby improving one or more symptoms).

[0264] As used herein, the term "simultaneously" refers to an event that occurs at the same time as another event, such as occurring within seconds, milliseconds, microseconds or less compared to the occurrence of another event.

[0265] As used herein, the term "knockout" ("KO") or "knocking out" refers to the deletion, inactivation or ablation of a gene or a defective gene in a pig or other animal or any cell in a pig or other animal. As used herein, KO can also refer to a method by which a deletion, inactivation or ablation of a gene or a part thereof has been performed or has been carried out.

[0266] As used herein, the term "knockin" ("KI") or "knocking in" refers to the addition, substitution or mutation of one or more nucleotides of a gene in a pig or other animal or any cell in a pig or other animal. As used herein, KI can also refer to a method by which an addition, substitution or mutation of one or more nucleotides of a gene or a part thereof has been performed or has been carried out.

[0267] II. Cells, tissues, organs, and animals

[0268] Porcine xenografts are widely compatible with human organ size and physiology and are ethically acceptable to the general population in the United States. However, porcine tissues used in xenotransplantation trigger a series of complex events leading to graft rejection, including: hyperacute rejection due to the presence of preformed antibodies against porcine antigens, complement activation and hypercoagulable states, and enhanced innate and adaptive immune responses due to molecular incompatibilities. The present disclosure uses genetic engineering methods to address the current drawbacks of xenotransplantation.

[0269] Specifically, there are many immune and functional challenges related to innate and adaptive immune functions. Complement- and coagulation-mediated dysfunctions are caused by the molecular incompatibility between porcine donor tissues and human physiology and result in acute xenograft failure. Preformed antibodies against the α-1,3-galactosyl-galactose (αGal) epitope initiate hyperacute graft rejection by activating the complement. Genetic inactivation of the glycoprotein α-1,3-galactosyltransferase 1 gene (GGTA1) can reduce this rapid graft destruction. The protective effect is further improved by the overexpression of human complement regulatory proteins (hCRP) CD46 (membrane cofactor protein), CD55 (complement decay-accelerating factor), and CD59 (MAC-inhibitory protein) genes.

[0270] Most non-Gal xenoreactive antibodies recognize sialic acid N-glycolylneuraminic acid (Neu5Gc), which is synthesized by the cytidine monophosphate-N-acetylneuraminic acid hydroxylase (CMAH) gene. This gene is inactive in humans, and thus, porcine Neu5Gc is immunogenic in humans. Therefore, porcine CMAH may have to be inactivated for clinical success in xenotransplantation. Although the expression of complement regulators and the knockout of GGTA1 (GTKO) reduce hyperacute rejection, these genetic modifications do not affect acute vascular rejection (AVR).

[0271] Coagulation dysfunctions, including thrombotic microangiopathy and systemic consumptive coagulopathy, persist even in the presence of GTKO and hCRP overexpression, mainly due to the molecular incompatibility of the coagulation system between pigs and non-human primates (NHPs).

[0272] Although others have attempted to generate transgenic pigs for safe xenotransplantation, due to the limitations of construct capacity and transcriptional interference between transgenes, these transgenic pigs carry only a limited number of transgenes. These methods have proven insufficient to overcome xenograft incompatibility. For example, U.S. Patent Publication No. 2018 / 0249688 utilized polycistronic expression vectors with different transgene combinations. Importantly, these polycistronic vectors contained only 4 transgenes and were used to generate pigs with 6 genetic modifications, including the KO of αGal (GTKO). In the present disclosure, a combination of KO, KI, and genomic replacement strategies was utilized. For the first time, PERV-free pigs expressing more than 6 transgenes from a single locus were generated.

[0273] The examples described and disclosed herein demonstrate that porcine complement factors can be KO'd, and live pigs can be produced having one or more modified MHC class I genes, inactivation of MHC class II genes, KI of PD-L1 to reduce adaptive immunity-based rejection, modified porcine vWF to regulate platelet aggregation, and deletion of porcine MHC class I genes. These examples provide a platform for achieving a greater number of genetic modifications within the same pig. Through this work, porcine cells were genetically modified with more than six transgenes to generate immunocompatible cells, tissues, organs, pigs, and progeny. Using CRISPR-Cas9, multiple genes, including GGTA1, CMAH, and B4GALNT2, were functionally knocked out to eliminate glycans recognized by preformed human anti-pig antibodies. In addition, nine or twelve human transgenes were integrated into a single multi-transgene cassette in the porcine genome. Specifically, pigs were generated by using CRISPR-mediated non-homologous end joining (NHEJ) to disrupt three major xeno-carbohydrate antigen-producing genes ("3KO"; GGTA1, B4GALNT2, and CMAH), and combining it with PiggyBAC-mediated random integration of nine transgenes, CD46, CD55, CD59, CD39, CD47, HLA-E, B2M, THBD, and TFPI, or twelve transgenes (CD46, CD55, CD59, HLA-E, B2M, CD47, CD39, THBD, TFPI, A20, PD-L1, and HO-1) into the porcine genome. A further advancement was the use of source donor pigs with 3KO and 9T or 12TG modifications in a PERV-free background. From there, the source donor pigs were also genetically engineered to carry additional genetic modifications, particularly including humanization of the vWF gene and deletion or disruption of the asialoglycoprotein receptor 1 (ASGR1) and endogenous B2M genes.

[0274] The present disclosure provides cells, tissues, organs, and animals having multiple modified genes, and methods of producing them. In some embodiments, the cells, tissues, organs are obtained from or are animals. In some embodiments, the animals are mammals. In some embodiments, the mammals are non-human mammals such as horses, primates, pigs, cows, sheep, goats, dogs, or cats. In some embodiments, the mammals are pigs.

[0275] The modification of genes according to the present disclosure is used to improve the molecular compatibility between the donor and the recipient and reduce adverse events, including hyperacute rejection, acute humoral rejection, thrombotic microangiopathy, and chronic vasculopathy. For example, hyperacute rejection occurs within a very short time span, typically within minutes to hours after transplantation, and is caused by preformed antibodies that activate complement and the transplanted endothelial cells, leading to procoagulant changes, which result in hemostasis and ultimately the destruction of the transplanted organ. In certain embodiments, the cells, tissues, organs, and animals exhibit reduced hyperacute rejection.

[0276] In some embodiments, the present disclosure provides one or more cells, tissues, organs, or animals having multiple modified genes. In some embodiments, the cells, tissues, organs, or animals have been genetically modified such that multiple genes have been added, deleted, inactivated, disrupted, a portion thereof has been excised, or the gene sequence has been altered. In some embodiments, the cells, tissues, organs, or animals have 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 modified genes. In some embodiments, the 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 modified genes are expressed from a single locus. In some embodiments, the 5, 10, or 12 modified genes are expressed from a single locus. In some embodiments, the 12 modified genes are expressed from a single locus. In some embodiments, the cells, tissues, organs, or animals have more than 20, more than 15, more than 10, more than 5, more than 3, or 2 modified genes. In some embodiments, the cells, tissues, organs, or animals have more than 10, more than 5, more than 3, more than 2, or more than 1 modified gene. In some embodiments, the cells, tissues, organs, or animals have one copy of the modified gene, and in other embodiments, the cells, tissues, organs, or animals have more than one copy of the one or more modified genes, such as more than 2, more than 3, more than 4, more than 5, more than 6, more than 7, more than 8, more than 9, more than 10, more than 15, more than 20, more than 25, more than 30, more than 35, more than 40, more than 50, more than 60, more than 70, more than 80, more than 90, or more than 100 copies of the modified gene. In some embodiments, the cell has from 100 copies to about 1 copy, 90 copies to about 1 copy, 80 copies to about 1 copy, about 70 copies to about 1 copy, 60 copies to about 1 copy, about 50 copies to about 1 copy, about 40 copies to about 1 copy, about 30 copies to about 1 copy, about 20 copies to about 5 copies, about 15 copies to about 10 copies, or about 5 copies to about 1 copy of one or more modified genes.

[0277] In some embodiments, the present disclosure provides one or more cells, tissues, organs, or animals having multiple copies of one or more modified genes. For example, the cells, tissues, organs, or animals can have 2, 3, 4, 5, 6, 7, 8, 9, about 10, about 15, about 20, about 25, about 30, or more copies of one or more modified genes.

[0278] In some embodiments, the one or more cells are primary cells. In some embodiments, the one or more cells are somatic cells. In some embodiments, the one or more cells are postnatal cells. In some embodiments, the one or more cells are adult cells (e.g., adult ear fibroblasts). In some embodiments, the one or more cells are fetal / embryonic cells (e.g., embryonic blastomeres). In some embodiments, the one or more cells are germline cells. In some embodiments, the one or more cells are oocytes. In some embodiments, the one or more cells are stem cells. In some embodiments, the one or more cells are cells from a primary cell line. In some embodiments, the one or more cells are selected from: epithelial cells, liver cells, granulosa cells, adipocytes. In certain embodiments, the one or more cells are fibroblasts. In some embodiments, the fibroblasts are female fetal fibroblasts. In some embodiments, the one or more cells are in vitro. In some embodiments, the one or more cells are in vivo. In some embodiments, the one or more cells are single cells. In some embodiments, the one or more cells are members of a cell colony. In some embodiments, the one or more cells are porcine cells. Non-limiting examples of breeds from which the porcine cells are derived or originated include any of the following pig breeds: American Landrace, American Yorkshire, Aksai Black Pied pig, Angeln saddleback, Appalachian English, Arapawa Island, Auckland Island, Australian Yorkshire, Babi Kampung pig, Ba Xuyen, Bantu, Basque, Bazna, BeijingBlack, Belarus Black Pied, Belgian Landrace, Bengali Brown Shannaj, Bentheim Black Pied, Berkshire (Berkshire pig), Bisaro, Bangur, BlackSlavonian, Black Canarian, Breitovo pig, British Landrace, British Lop, British Saddleback, Bulgarian White, Cambrough pig, Cantonese, Celtic, Chato Murciano, Chester White, Chiangmai Blackpig, Choctaw Hog, Creole, Czech Improved White, Danish Landrace, Danish Protest, Dermantsi Pied, Li Yan pig, Duroc, Dutch Landrace, East Landrace, East Balkan pig, EastBalkan), Essex pig, Estonian Bacon pig, Fengjing pig, Finnish Landrace, Forest Mountain pig, French Landrace, Gascon pig, German Landrace, Gloucestershire Old Spots, Gottingen minipig, Grice pig, Guinea Hog, Hampshire pig, Hante pig, Hereford pig, Hezuo pig, Hogan Hog, Huntington Black Hog, Iberian pig, Italian Landrace, Japanese Landrace, Jeju Black pig, Jinhua pig, Kakhetian pig, Kele pig, Kemerovo pig, Korean Native pig, Krskopolje pig, Kunekune pig, Lamcombe pig, Large Black pig, Large Black-White pig, Large White pig, Latvian White pig, Leicoma pig, Lithuanian Native pig, Lithuanian White pig, Lincolnshire Curly-Coated pig, Livny pig, Malhado de Alcobaca pig, Mangalitsa pig, Meishan pig, Middle White pig, Minzhu pig, Minokawa Buta pig, MongCai pig, Mora Romagnola pig, Moura pig, Mukota pig, Mulefoot pig, Murom pig, Myrhorod pig, Nero dei Nebrodi pig, Neijiang pig, New Zealand pig, NewZealand), Ningxiang pig, North Caucasian pig, North Siberian pig, Norwegian Landrace, Norwegian Yorkshire, Ossabaw Island pig, Oxford Sandy and Black, Pakchong 5 pig, Philippine Native pig, Pietrain, Poland-China pig, Red Wattle pig, Saddleback pig, Semirechensk pig, Siberian Black Pied pig, Small Black pig, Small White pig, Spots pig, Surabaya Babi pig, Swabian-Hall pig, Swedish Landrace, Swallow Belied Mangalitza, Taihu pig, Tamworth pig, Thuoc Nhieu pig, Tibetan pig, Tokyo-X pig, Tsivilsk pig, Turopolje pig, Ukrainian Spotted Steppe pig, Ukrainian White Steppe pig, Urzhum pig, Vietnamese Potbelly pig, Welsh pig, Wessex Saddleback pig, West French White pig, Windsnyer pig, Wuzhishan pig, Yanan pig, Yorkshire pig and Yorkshire Blue and White pig. In some embodiments, the porcine cells are Yorkshire and Yucatan porcine cells.

[0279] In some embodiments, the cells, tissues, organs or animals of the present disclosure have been genetically modified such that one or more genes have been modified by addition, deletion, inactivation, disruption, excision of portions thereof, or portions of the gene sequence have been altered.

[0280] In some embodiments, the cells, tissues, organs, or animals of the present disclosure comprise one or more mutations that inactivate one or more genes. In some embodiments, the cells, tissues, organs, or animals comprise one or more mutations or epigenetic changes that result in reduced or eliminated expression of one or more genes having the one or more mutations. In some embodiments, the one or more genes are inactivated by genetic modification of the nucleic acids present in the cells, tissues, organs, or animals. In some embodiments, inactivation of the one or more genes is confirmed by an assay. In some embodiments, the assay is an infectivity assay, reverse transcriptase PCR assay, RNA-seq, real-time PCR, or ligation PCR mapping assay.

[0281] Specific genotype

[0282] To ensure that the cells, tissues, organs, and animals of the present disclosure are safe and effective for human clinical use, the cells, tissues, organs, and animals of the present disclosure (e.g., donor pigs) have been genetically engineered to have enhanced complement (i.e., complement toxicity), coagulation, inflammation (i.e., apoptosis / inflammation), immunity (i.e., cytotoxicity), and / or immune regulatory systems to render them compatible in the human body. A novel combination of knockout (KO), knock-in (KI) (also referred to herein as transgenic (TG)), and / or genome replacement strategies provides enhanced complement, coagulation, inflammation, immunity, and / or immune regulatory systems.

[0283] For example, cells, tissues, organs, and animals lacking major xeno-carbohydrate antigen expression due to gene KO reduce or eliminate humoral rejection during xenotransplantation. The three major xeno-carbohydrate antigens include those produced by the glycosyltransferase / glycohydrolase GGTA1, CMAH, and B4GALNT2. The purpose of the loss of function of these genes is to reduce and / or eliminate the binding of pre-formed anti-pig antibodies to the endothelial cells of pig grafts.

[0284] Insertion of key complement, coagulation, inflammation, immunity, and / or immune regulatory factors into one or more genomic loci, such as safe harbor genomic loci (such as AAVS1), will help to regulate the human complement system as well as natural killer (NK), macrophage, and T cell functions. Non-limiting examples include overexpression of hCD46, hCD55, and hCD59 by KI to inhibit the human complement cascade; humanization of vWF to prevent unregulated platelet sequestration and thrombotic microangiopathy, such as by humanizing the A1 domain and / or flanking regions of the porcine vWE sequence; KI of B2M-HLA-E SCT to provide protection against human NK cell cytotoxicity and humanization of porcine cells; and KI of CD47, CD39, THBD, TFPI, A20 to act as immunosuppressants, immunomodulators, and / or anticoagulants.

[0285] In some embodiments, the cells, tissues, organs, or animals of the present disclosure have been genetically modified such that one or more genes have been modified by addition, deletion, inactivation, disruption, excision of portions thereof, or portions of the gene sequences have been altered. In some embodiments, the present disclosure provides isolated cells, tissues, organs, or animals having multiple modified genes. In some embodiments, the modified genes include one or more of the following: α1,3-galactosyltransferase (GGTA), β-1,4-N-acetyl-galactosaminyltransferase 2 (B4GalNT2), cytidine monophosphate-N-acetylneuraminic acid hydroxylase (CMAH), THBD, TFPI, CD39, HO-1, CD46, CD55, CD59, major histocompatibility complex class I E single-chain trimer (HLA-E SCT), A20, PD-L1, CD47, swine leukocyte antigen 1 (SLA-1), SLA-2, SLA-3, vWF, B2M, DQA, DRA, and CD47.

[0286] In some embodiments, the modified gene is GGTA, B4GalNT2, cMAH, or any combination thereof. In some embodiments, the GGTA, B4GalNT2, and / or CMAH are genetically KO. In some embodiments, the modified gene is THBD, TFPI, CD39, HO-1, or any combination thereof. In some embodiments, the THBD, TFPI, CD39, and / or HO-1 are genetically KI. In some embodiments, the modified gene is CD46, CD55, CD59, B2M-HLA-E SCT, A20, PD-L1, CD47, or any combination thereof. In some embodiments, the CD46, CD55, CD59, B2M-HLA-E SCT, A20, PD-L1, and / or CD47 are genetically KI. In some embodiments, the modified gene is SLA-1, SLA-2, SLA-3, B2M, or any combination thereof. In some embodiments, the modified gene is DQA and / or DRA. In some embodiments, the modified gene is PD-L1, exogenous vWF, HLA-E, HLA-G, B2M, CIITA-DN, and / or any combination thereof. In some embodiments, the modified gene is TBM, PD-L1, HLA-E, CD47, or any combination thereof. In some embodiments, the TBM, PD-L1, HLA-E, and / or CD47 are genetically KI. In some embodiments, the modified gene is the MHC-I genes SLA-1, SLA-2, and SLA-3, the MHC-II genes DQA and DRA, endogenous vWF, CD9, asialoglycoprotein receptor, at least one complement inhibitor gene (e.g., C3, CD46, CD55, and CD59), and any combination thereof. In some embodiments, the CD46, CD55, and / or CD59 are genetically KI.

[0287] In one embodiment, the cells, tissues, organs, or animals of the present disclosure have been genetically modified with a transgenic expression vector comprising B2M, HLA-E SCT, CD47, THBD, TFPI, CD39, A20, PD-L1, FasL, CD46, CD55, CD59, or any combination thereof. In one embodiment, the cells, tissues, organs, or animals of the present disclosure have been genetically modified with a transgenic expression vector comprising each of B2M, HLA-E SCT, CD47, THBD, TFPI, CD39, A20, PD-L1, FasL, CD46, CD55, and CD59. One embodiment of the transgenic expression vector is in Figure 17Depicted in. In one embodiment, the cells, tissues, organs, or animals of the present disclosure have been further genetically modified to have reduced or no expression of GGTA, B4GalNT2, CMAH, or any combination thereof, for example, by gene KO modification.

[0288] In one embodiment, the cells, tissues, organs, or animals of the present disclosure have been genetically modified with a transgenic expression vector comprising B2M, HLA-E SCT, CD47, THBD, TFPI, CD39, A20, PD-L1, HO-1, CD46, CD55, CD59, or any combination thereof. In one embodiment, the cells, tissues, organs, or animals of the present disclosure have been genetically modified with a transgenic expression vector comprising each of B2M, HLA-E SCT, CD47, THBD, TFPI, CD39, A20, PD-L1, HO-1, CD46, CD55, and CD59. One embodiment of the transgenic expression vector is depicted in Figure 18 Depicted in. In one embodiment, the cells, tissues, organs, or animals of the present disclosure have been further genetically modified to have reduced or no expression of GGTA, B4GalNT2, CMAH, or any combination thereof, for example, by gene KO modification.

[0289] In one embodiment, the cells, tissues, organs, or animals of the present disclosure have been genetically modified with a transgenic expression vector comprising B2M, HLA-E SCT, CD47, PD-L1, HO-1, THBD, TFPI, CD39, A20, CD46, CD55, CD59, or any combination thereof. In one embodiment, the cells, tissues, organs, or animals of the present disclosure have been genetically modified with a transgenic expression vector comprising each of B2M, HLA-E SCT, CD47, PD-L1, HO-1, THBD, TFPI, CD39, A20, CD46, CD55, and CD59. One embodiment of the transgenic expression vector is depicted in Figure 19 Depicted in. In one embodiment, the cells, tissues, organs, or animals of the present disclosure have been further genetically modified to have reduced or no expression of GGTA, B4GalNT2, CMAH, or any combination thereof, for example, by gene KO modification.

[0290] In one embodiment, the cells, tissues, organs, or animals of the present disclosure have been genetically modified with a transgenic expression vector comprising CD46, CD55, CD59, A20, THBD, TFPI, CD39, HO-1, 2xFKBP (a fusion of FK506-binding proteins), h-caspase 8, PD-L1, B2M, HLA-E SCT, CD47, or any combination thereof. In one embodiment, the cells, tissues, organs, or animals of the present disclosure have been genetically modified with a transgenic expression vector comprising each of CD46, CD55, CD59, A20, THBD, TFPI, CD39, HO-1, 2xFKBP, h-caspase 8, PD-L1, B2M, HLA-E SCT, and CD47. One embodiment of the transgenic expression vector is depicted in Figure 20 In one embodiment, the cells, tissues, organs, or animals of the present disclosure have been further genetically modified to have reduced or no expression of GGTA, B4GalNT2, CMAH, or any combination thereof, for example, by gene KO modification.

[0291] The cells, tissues, organs, or animals of the present disclosure can be genetically modified by any method. Non-limiting examples of suitable methods for the knockout (KO), knock-in (KI), and / or genome replacement strategies disclosed and described herein include CRISPR-mediated genetic modification using Cas9, Cas12a (Cpf1), or other CRISPR endonucleases, Argonaute endonucleases, transcription activator-like (TAL) effector and nucleases (TALENs), zinc finger nucleases (ZFNs), expression vectors, transposon systems (e.g., PiggyBac transposase), or any combination thereof.

[0292] The cells, tissues, organs, or animals of the present disclosure may be further modified to be PERV-free. The cells, tissues, organs, or animals of the present disclosure may be further modified to render PERV copies non-functional in their genomes. The cells, tissues, organs, or animals of the present disclosure may be further modified to functionally inactivate PERV copies in their genomes. PERV represents a risk factor if porcine cells, tissues, or organs are transplanted into human recipients. PERV is released from normal porcine cells and is infectious. PERV-A and PERV-B are polyphilic viruses that infect cells of several species, including humans (e.g., they are xenotropic); while PERV-C is an amphotropic virus that only infects porcine cells. Non-limiting methods for rendering PERV copies non-functional are disclosed and described in Niu 2017 and WIPO Publication No. WO2018 / 195402, both of which are incorporated herein by reference in their entirety. In some embodiments, pigs are genetically engineered to be PERV-A, PERV-B, or PERV-C-free (or any combination thereof).

[0293] In some embodiments, additional genes of the cells, tissues, organs, or animals of the present disclosure have been modified by adding, deleting, inactivating, disrupting, excising portions thereof, or portions of the gene sequences have been altered. In some embodiments, the modified genes include deletion of one or more of the following genes: MHC-I genes SLA-1, SLA-2, and SLA-3, MHC-II genes DQA and DRA, endogenous vWF, CD9, asialoglycoprotein receptor, and C3, and expression of one or more of the following transgenes: PD-L1, exogenous vWF, HLA-E, HLA-G, B2M, and CIITA-DN. In some embodiments, the modified genes include deletion of one or more of the following genes: alpha-galactosyltransferase 1, beta1,4 N-acetylgalactosaminyltransferase, and cytidine monophosphate-N-acetylneuraminic acid hydroxylase, and expression of one or more of the following transgenes: CD46, CD55, CD59, CD47, HO-1, A20, TNFR1-Ig, CD39, THBD, TFPI, EPCR, PD-1, CTLA-Ig, CD73, SOD3, CXCL12, FasL, CXCR3, CD39L1, GLP-1R, M3R, IL35, IL12A, and EB13. In some embodiments, the modified genes are CD46, CD55, CD59, CD47, HO-1, A20, TNFR1-Ig, CD39, THBD, TFPI, EPCR, PD-1, CTLA-Ig, CD73, SOD3, CXCL12, FasL, CXCR3, CD39L1, GLP-1R, M3R, IL35, IL12A, and EB13.

[0294] In some embodiments, the cells, tissues, organs, or animals of the present disclosure have been genetically modified such that one or more genes have been modified by addition, deletion, inactivation, disruption, excision of portions thereof, portions of the gene sequence have been altered, or a transgene or portions thereof have been introduced. In some embodiments, the present disclosure provides isolated cells, tissues, organs, or animals having one or more modified genes. In some embodiments, the modified gene is a MHC class I gene. In some embodiments, the modified MHC class I gene comprises one or more of the following: SLA-1, SLA-2, SLA-3, and B2M. In some embodiments, the modified gene is SLA-1, SLA-2, and / or SLA-3. In some embodiments, the modified gene is B2M. In some embodiments, the modified MHC class I gene comprises one or more of the following: SLA-1, SLA-2, SLA-3, and B2M. In some embodiments, the modified B2M, SLA-1, SLA-2, and / or SLA-3 gene and / or portions thereof are replaced with a human HLA-E gene, a human HLA-G gene, a human B2M gene, and / or a human (dominant negative mutant class II transactivator) CIITA-DN gene and / or portions thereof. In some embodiments, the modified gene is conditionally and / or inducibly modified. In some embodiments, a conditional promoter and / or an inducible promoter is used to conditionally and / or inducibly modify the one or more modified genes. In some embodiments, the isolated cells, tissues, organs, or animals comprise a conditional alteration of the B2M, SLA-1, SLA-2, or SLA-3 gene or any combination thereof, and at least partial replacement of the conditionally altered gene with a human HLA-E gene, a human HLA-G gene, a human B2M gene, and / or a human CIITA-DN gene.

[0295] In some embodiments, the cells, tissues, organs, or animals of the present disclosure have been genetically modified such that one or more genes have been modified by addition, deletion, inactivation, disruption, excision of portions thereof, portions of the gene sequence have been altered, or a transgene or portions thereof have been introduced. In some embodiments, the present disclosure provides isolated cells, tissues, organs, or animals having one or more modified genes. In some embodiments, the modified gene is a MHC class II gene. In some embodiments, the modified MHC class II gene is DRQ, DRA, or any combination thereof. In some embodiments, DRQ and / or DRA are modified by addition, deletion, inactivation, disruption, excision of portions thereof, and portions of the gene sequence have been altered. In some embodiments, the modified gene is conditionally and / or inducibly modified. In some embodiments, a conditional promoter and / or an inducible promoter are used for conditional and / or inducible modification of the one or more modified genes. In some embodiments, the isolated cells, tissues, organs, or animals comprise a conditional alteration of the DRQ and / or DRA gene or any combination thereof.

[0296] In some embodiments, the cells, tissues, organs or animals of the present disclosure have been genetically modified such that one or more genes have been modified by addition, deletion, inactivation, disruption, excision of portions thereof, portions of the gene sequence have been altered, or a transgene or portions thereof have been introduced. In some embodiments, the present disclosure provides isolated cells, tissues, organs or animals having a modified vWF gene. In some embodiments, the modified gene is the vWF gene and vWF-related genes. In some embodiments, the modified vWF gene and / or portions thereof are replaced with the human vWF gene and / or portions thereof. In some embodiments, the modified vWF gene, modified vWF-related genes and / or one or more portions thereof are replaced with the human vWF gene, one or more human vWF-related genes and / or portions thereof. In some embodiments, the modified vWF gene and / or vWF-related genes are conditionally and / or inducibly modified. In some embodiments, a conditional promoter and / or an inducible promoter are used to conditionally and / or inducibly modify the one or more modified genes. In some embodiments, the isolated cells, tissues, organs or animals comprise a conditional alteration of vWF, vWF-related genes, one or more portions thereof or any combination thereof, and replacement of the conditionally altered genes with the human vWF gene, at least a portion of the human vWF gene, one or more other human vWF-related genes, at least a portion of one or more human vWF-related genes or any combination thereof. In some embodiments, the vWF gene is modified using a gRNA designed to initiate HDR replacement in the endogenous porcine genome and to cleave near the region to be replaced with the human sequence. Non-limiting examples of suitable gRNAs are any one or more of SEQ ID NO: 5-157.

[0297] In some embodiments, the cells, tissues, organs, or animals of the present disclosure have been genetically modified such that one or more genes have been modified by addition, deletion, inactivation, disruption, excision of portions thereof, portions of the gene sequence have been altered, or a transgene or portions thereof have been introduced. In some embodiments, the cells, tissues, organs, or animals of the present disclosure have been genetically modified by introducing one or more exogenous genes or portions thereof (such as a transgene) into the cells, tissues, organs, or animals. In some embodiments, the present disclosure provides isolated cells, tissues, organs, or animals having one or more modified genes. In some embodiments, the modified gene is a programmed death gene. In some embodiments, the modified gene is PD-L1. In some embodiments, the cells, tissues, organs, or animals are modified to express an exogenous PD-L1 gene or portions thereof, such as a transgene. In some embodiments, the modified gene is conditionally and / or inducibly modified. In some embodiments, a conditional promoter and / or an inducible promoter is used to conditionally and / or inducibly modify the one or more modified genes. In some embodiments, the isolated cells, tissues, organs, or animals include a conditional alteration of PD-L1. In some embodiments, the PD-L1 comprises the sequence described in SEQ ID NO: 211 or any variant or portion thereof.

[0298] In some embodiments, the cells, tissues, organs, or animals of the present disclosure have been genetically modified such that one or more genes have been modified by addition, deletion, inactivation, disruption, excision of portions thereof, portions of the gene sequence have been altered, or a transgene or portions thereof have been introduced. In some embodiments, the present disclosure provides isolated cells, tissues, organs, or animals having one or more modified genes. In some embodiments, the modified gene is a complement gene. In some embodiments, the modified gene is C3. In some embodiments, C3 is modified by addition, deletion, inactivation, disruption, excision of portions thereof, and portions of the gene sequence have been altered. In some embodiments, the modified C3 gene and / or complement-related genes are conditionally and / or inducibly modified. In some embodiments, a conditional promoter and / or an inducible promoter is used to conditionally and / or inducibly modify the one or more modified genes. In some embodiments, the isolated cells, tissues, organs, or animals include a conditional alteration of C3, complement-related genes, one or more portions thereof, or any combination thereof. In some embodiments, the C3 gene is modified using gRNA. Non-limiting examples of suitable gRNAs include any one or more of SEQ ID NOs: 158 - 210.

[0299] In some embodiments, the modified gene is a knockout of C3. In some embodiments, the modified gene is a knock-in of PD-L1. In some embodiments, the modified gene is a humanized vWF of porcine vWF. In some embodiments, the modified gene is a conditional knock-in of MHC-I genes SLA-1, SLA-2, and SLA-3.

[0300] In some embodiments, the host does not or substantially does not elicit an immune response against the genetically modified cells, tissues, or organs.

[0301] In some embodiments, the present disclosure provides nucleic acids obtained from any of the cells disclosed herein. In some embodiments, one or more nucleic acids in the cells are genetically modified such that one or more genes in the cells are altered or, alternatively, the genome of the cells is modified. In some embodiments, the gene or a portion thereof is genetically modified using any gene modification system known in the art and / or disclosed herein. In some embodiments, the gene modification system is a TALEN, a zinc finger nuclease, and / or a CRISPR-based system. In some embodiments, the gene modification system is a CRISPR-Cas9 system. In some embodiments, the gene modification system is a type II, class II CRISPR system. In some embodiments, the gene modification system is a type II, class V CRISPR system. In some embodiments, the cells are genetically modified such that one or more genes or portions thereof in the cells are inactivated and further the cells are genetically modified such that the expression of one or more genes or portions thereof (which would induce an immune response if the cells (or a tissue or organ cloned / derived from the cells) were transplanted into a human body) is reduced. In some embodiments, the cells are genetically modified to increase the expression of one or more human genes or portions thereof. In some embodiments, the cells are genetically modified to increase the expression of one or more humanized genes or portions thereof. In some embodiments, the cells are genetically modified such that one or more genes or portions thereof in the cells are inactivated and further the cells are genetically modified such that the expression of one or more genes (which would suppress an immune response if the cells (or a tissue or organ cloned / derived from the cells) were transplanted into a human body) is increased. In some embodiments, the cells are genetically modified such that one or more genes or portions thereof in the cells are inactivated and further the cells are genetically modified such that the expression of one or more genes (which would induce an immune response if the cells (or a tissue or organ cloned / derived from the cells) were transplanted into a human body) is reduced and further the cells are genetically modified such that the expression of one or more genes (which would suppress an immune response if the cells (or a tissue or organ cloned / derived from the cells) were transplanted into a human body) is increased.

[0302] In some embodiments, the present disclosure provides embryos cloned from genetically modified cells. In some embodiments, one or more genetically modified nucleic acids are extracted from the genetically modified cells and cloned into different cells. For example, in somatic cell nuclear transfer, the genetically modified nucleic acid from the genetically modified cell is introduced into an enucleated oocyte. In some embodiments, the oocyte can be enucleated by performing partial zona pellucida dissection near the polar body and then extruding the cytoplasm at the dissection site. In some embodiments, a genetically modified cell is injected into the enucleated oocyte arrested at metaphase II using an injection pipette with a sharp beveled tip. An oocyte arrested at metaphase II is commonly referred to as an "egg". In some embodiments, an embryo is produced by fusing and activating the oocyte. Such an embryo may be referred to herein as a "genetically modified embryo". In some embodiments, the genetically modified embryo is transferred to the oviduct of a recipient female pig. In some embodiments, the genetically modified embryo is transferred to the oviduct of a recipient female pig 20 to 24 hours after activation. See, for example, Cibelli 1998 and U.S. Patent No. 6,548,741. In some embodiments, pregnancy of the recipient female is checked approximately 20 - 21 days after transfer of the genetically modified embryo.

[0303] In some embodiments, the genetically modified embryo is grown into a postnatal genetically modified animal. In some embodiments, the postnatal genetically modified animal is a neonatal genetically modified animal. In some embodiments, the genetically modified pig is a juvenile genetically modified animal. In some embodiments, the genetically modified animal is an adult genetically modified animal (e.g., greater than 5 - 6 months). In some embodiments, the genetically modified animal is a female genetically modified animal. In some embodiments, the animal is a male genetically modified animal. In some embodiments, the genetically modified animal is bred with a non-genetically modified animal. In some embodiments, the genetically modified animal is bred with another genetically modified animal. In some embodiments, the genetically modified pig is bred with another genetically modified animal having reduced or no active virus. In some embodiments, the genetically modified animal is bred with a second genetically modified animal that has been genetically modified such that cells, tissues, or organs from the second genetically modified animal are less likely to induce an immune response if transplanted into a human.

[0304] In some embodiments, the genetically modified animal is an animal having one or more modified genes, and maintains the expression or inactivation level of the same or similar one or more modified genes for at least one month, at least 6 months, at least 1 year, at least 5 years, at least 10 years after pregnancy. In some embodiments, the genetically modified animal remains genetically modified even after being born from a non-viral inactivated surrogate or after being in a facility / space with other non-viral inactivated animals, and has one or more modified genes as a genetically modified pig.

[0305] In some embodiments, the present disclosure provides cells, tissues or organs obtained from any of the postnatal genetically modified pigs described herein. In some embodiments, the cells, tissues or organs are selected from the group consisting of liver, kidney, lung, heart, pancreas, muscle, blood and bone. In certain embodiments, the organ is the liver, kidney, lung or heart. In some embodiments, the cells from the postnatal genetically modified pigs are selected from: islets of Langerhans, lung epithelial cells, cardiomyocytes, skeletal muscle cells, smooth muscle cells, liver cells, non-parenchymal liver cells, gallbladder epithelial cells, gallbladder endothelial cells, bile duct epithelial cells, bile duct endothelial cells, liver vascular epithelial cells, hepatic vascular endothelial cells, sinusoidal cells, choroid plexus cells, fibroblasts, supporting cells, neuronal cells, stem cells and adrenal chromaffin cells. In some embodiments, the genetically modified organ, tissue or cell has been separated from its natural environment (i.e., separated from the pig in which it was growing). In some embodiments, separation from the natural environment means overall physical separation from the natural environment, e.g., removal from the genetically modified donor animal, and alteration of the relationship of the genetically modified organ, tissue or cell with the neighboring cells with which it was in direct contact (e.g., by dissociation).

[0306] III. Methods for generating cells, tissues, organs, or animals

[0307] The present disclosure provides methods for generating any cell, tissue, organ or animal having one or more modified genes disclosed herein. In some embodiments, the present disclosure provides methods for inactivating, deleting or otherwise disrupting one or more genes or portions thereof in any cell disclosed herein, the method comprising administering to the cell a gene editing agent specific for the gene, wherein the agent disrupts the transcription and / or translation of the gene. In some embodiments, the agent targets the start codon of the gene and inhibits the transcription of the gene. In some embodiments, the agent targets an exon in the gene, and the agent induces a frameshift mutation in the gene. In some embodiments, the agent introduces an inactivating mutation into the gene. In some embodiments, the agent inhibits the transcription of the gene.

[0308] In some embodiments, the present disclosure provides methods for altering one or more genes or portions thereof in vivo, the methods comprising administering to the cell a gene editing agent specific for the gene, wherein the agent alters the sequence of the gene, such as by humanizing the gene or otherwise altering the native (e.g., wild-type) sequence of the gene.

[0309] In some embodiments, the present disclosure provides methods for expressing one or more genes or portions thereof, such as transgenes (e.g., non-native genes), the methods comprising administering to the cell a gene editing agent specific for the transgene, wherein the agent introduces the sequence of the transgene. In some embodiments, the agent is a nucleic acid sequence, such as a plasmid, vector, etc. In some embodiments, the nucleic acid sequence comprises one or more nucleic acid sequences, such as a promoter, a transgene, and / or additional genes. In some embodiments, the nucleic acid sequence or portions thereof are derived from one or more species and / or one or more sources. In some embodiments, the species is the species that will receive the genetically modified cell, tissue, or organ. In some embodiments, the species is human. In other embodiments, the species is non-human, such as a mammal, an animal, a bacterium, and / or a virus.

[0310] In some embodiments, any agent disclosed herein is a polynucleotide. In some embodiments, the polynucleotide encodes one or more of the nucleases and / or nickases and / or RNA or DNA molecules described herein. In some embodiments, the polynucleotide agent is introduced into one or more cells. In some embodiments, the polynucleotide is introduced into the one or more cells in such a way that the one or more cells transiently express the polynucleotide. In some embodiments, the polynucleotide is introduced into the one or more cells in such a way that the one or more cells stably express the polynucleotide. In some embodiments, the polynucleotide is introduced in such a way that it is stably incorporated into the cell genome. In some embodiments, the polynucleotide is introduced together with one or more transposable elements. In some embodiments, the transposable element is a polynucleotide sequence encoding a transposase. In some embodiments, the transposable element is a polynucleotide sequence encoding a PiggyBac transposase. In some embodiments, the transposable element is inducible. In some embodiments, the transposable element is doxycycline-inducible. In some embodiments, the polynucleotide further comprises an optional marker. In some embodiments, the optional marker is a puromycin resistance marker. In some embodiments, the optional marker is a fluorescent protein (e.g., GFP).

[0311] In some embodiments, the reagent is a nuclease or nickase that targets DNA in a cell. In some embodiments, the reagent specifically targets a gene and inhibits its expression. In some embodiments, the reagent comprises a transcriptional repressor domain. In some embodiments, the transcriptional repressor domain is a Krüppel-associated box (KRAB).

[0312] In some embodiments, the reagent is any programmable nuclease. In some embodiments, the reagent is a native homing meganuclease. In some embodiments, the reagent is a TALEN-based reagent, a ZFN-based reagent, or a CRISPR-based reagent, or any bioactive fragment, fusion, derivative, or combination thereof. CRISPR-based reagents include, for example, class 2 type II and type V systems, including various species variants of Cas9 and Cpf1. In some embodiments, the reagent is a deaminase or a nucleic acid encoding a deaminase. In some embodiments, cells are genetically engineered to stably and / or transiently express a TALEN-based reagent, a ZFN-based reagent, and / or a CRISPR-based reagent.

[0313] IV. Therapeutic methods

[0314] In some embodiments, any genetically modified cell, tissue, or organ disclosed herein can be used to treat a subject of a different species from the genetically modified cell. In some embodiments, the present disclosure provides methods of transplanting any genetically modified cell, tissue, or organ described herein into a subject in need thereof. In some embodiments, the subject is a human. In some embodiments, the subject is a non-human primate.

[0315] In some embodiments, the genetically modified organ for use in any method disclosed herein can be selected from the heart, lung, liver, eye, pituitary gland, thyroid gland, parathyroid gland, esophagus, thymus, adrenal gland, appendix, bladder, gallbladder, small intestine, large intestine, small intestine, kidney, pancreas, spleen, stomach, skin, and / or prostate of a genetically modified pig. In some embodiments, the genetically modified tissue for use in any method disclosed herein can be selected from cartilage (e.g., esophageal cartilage, knee cartilage, ear cartilage, nose cartilage), muscle (such as but not limited to smooth muscle and heart (e.g., heart valve)), tendon, ligament, bone (e.g., bone marrow), cornea, middle ear, and vein of a genetically modified pig. In some embodiments, the genetically modified cells for use in any method disclosed herein include blood cells, skin follicles, hair follicles, and / or stem cells. The compositions of the present disclosure can also be administered to any part of an organ or tissue (e.g., part of the eye, such as the cornea).

[0316] In some embodiments, a heart, lung, liver, kidney, pancreas, or spleen is isolated from a pig that has been genetically modified to comprise (a) a deletion or disruption of GGTA1, CMAH, and B4GALNT2; (b) the addition of CD46, CD55, CD59, CD39, CD47, A20, PD-L1, HLA-E, B2M, THBD, TFPI, and HO transgenes (e.g., their human or humanized copies) expressed from a single polytransgenic cassette in the pig genome; and (c) a functional deletion of all PERV copies. In some embodiments, a heart, lung, liver, kidney, pancreas, or spleen is isolated from a pig that has been genetically modified to comprise (a) a functional disruption of GGTA1, CMAH, and B4GALNT2; (b) the addition of CD46, CD55, CD59, CD39, CD47, A20, PD-L1, HLA-E, B2M, THBD, TFPI, and HO transgenes (e.g., their humanized copies) expressed from a single polytransgenic cassette in the pig genome; and (c) a functional inactivation of all PERV copies. In certain embodiments, the pig has been further genetically modified to have a humanized vWF, a deletion of ASGR1, and / or a deletion of the B2M gene.

[0317] In some embodiments, once xenotransplanted into a human or non-human primate, the xenotransplanted organ (e.g., heart, lung, liver, kidney, pancreas, spleen) exhibits sustained function for more than about 300 days, more than about 1 year, more than about 1.5 years, more than about 2 years, more than about 2.5 years, more than about 3 years, more than about 3.5 years, more than about 4 years, more than about 4.5 years, more than about 5 years, more than about 5.5 years, more than about 6 years, more than about 6.5 years, more than about 7 years, more than about 7.5 years, more than about 8 years, more than about 8.5 years, more than about 9 years, more than about 9.5 years, or more than about 10 years.

[0318] In some embodiments, the present disclosure provides treatment of a subject having a disease, disorder, or injury that results in impaired, insufficient, or absent function of an organ, tissue, or cell. In some embodiments, the subject has suffered an injury or trauma (e.g., a car accident) that damages one or more cells, tissues, or organs of the subject. In some embodiments, the subject has suffered a burn from fire or acid. In some embodiments, the subject has a disease or disorder that results in impaired, insufficient, or absent function of an organ, tissue, or cell. In some embodiments, the subject has an autoimmune disease. In some embodiments, the disease is selected from: heart disease (e.g., atherosclerosis), dilated cardiomyopathy, severe coronary artery disease, scarred heart tissue, congenital defects of the heart, type I or type II diabetes, hepatitis, cystic fibrosis, cirrhosis, kidney failure, lupus, scleroderma, IgA nephropathy, polycystic kidney disease, myocardial infarction, emphysema, chronic bronchitis, bronchiolitis obliterans, pulmonary hypertension, congenital diaphragmatic hernia, congenital surfactant protein B deficiency, and congenital cystic emphysematous lung disease, primary biliary cholangitis, sclerosing cholangitis, biliary atresia, alcoholism, Wilson's disease, hemochromatosis, and / or alpha-1 antitrypsin deficiency.

[0319] In some embodiments, any genetically modified cell, tissue, and / or organ of the present disclosure is separated from the genetically modified donor and administered to a non-donor subject host. As used herein, "administering" or "administration" includes, but is not limited to, introducing, applying, injecting, implanting, grafting, suturing, and transplanting. According to the present disclosure, the genetically modified cell, tissue, and / or organ can be administered by a method or route that causes the organ, tissue, cell, or composition of the present disclosure to localize at the desired site. The organ, tissue, cell, or composition of the present disclosure can be administered to a subject by any suitable route that results in delivery of the cell to the desired location in the subject, where at least a portion of the cell remains viable. In some embodiments, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% of the cells (whether administered alone or as part of a tissue or organ) remain viable after administration to the subject. Methods of administering the organ, tissue, cell, or composition of the present disclosure are well known in the art. In some embodiments, the cell, tissue, and / or organ is transplanted into the host. In some embodiments, the cell, tissue, and / or organ is injected into the host. In some embodiments, the cell, tissue, and / or organ is transplanted onto the surface of the host (e.g., bone or skin).

[0320] In some embodiments, a heart, lung, liver, kidney, pancreas, or spleen that has been genetically modified to contain: a deletion or disruption of GGTAl, CMAH, and B4GALNT2; the expression of CD46, CD55, CD39, CD47, HLA-E, THBD, and TFPI from a single polytransgenic cassette in the porcine genome and optionally one or more of CD59, B2M, A20, PD-L1, and HO-1; and the deletion of all PERV copies is transplanted into a host. In some embodiments, a heart, lung, liver, kidney, pancreas, or spleen that has been genetically modified to contain: a deletion of GGTA1, CMAH, and B4GALNT2; the expression of CD46, CD55, CD39, CD47, HLA-E, THBD, and TFPI from a single polytransgenic cassette in the porcine genome and optionally one or more of CD59, B2M, A20, PD-L1, and HO-1; and the functional inactivation of all PERV copies is transplanted into a host. In some embodiments, the transplanted heart, lung, liver, kidney, pancreas, spleen, or a portion thereof survives and functions for a period of about 1 day, about 1 week, about 2 weeks, about 3 weeks, about 1 month, about 2 months, about 3 months, about 4 months, about 5 months, about 6 months, about 9 months, about 1 year, about 2 years, about 3 years, about 4 years, about 5 years, about 6 years, about 7 years, about 8 years, about 9 years, about 10 years, or longer.

[0321] In some embodiments, it will be necessary to protect the genetically modified one or more cells, one or more tissues, or one or more organs from the immune system of the host to which the genetically modified one or more cells, one or more tissues, or one or more organs are administered. For example, in some embodiments, the genetically modified one or more cells, one or more tissues, or one or more organs are administered with a matrix or coating (e.g., gelatin) to protect the genetically modified one or more cells, one or more tissues, or one or more organs from the immune response from the host. In some embodiments, the matrix or coating is a biodegradable matrix or coating. In some embodiments, the matrix or coating is natural. In other embodiments, the matrix or coating is synthetic.

[0322] In some embodiments, the genetically modified one or more cells, one or more tissues, or one or more organs are administered together with an immunosuppressive compound. In some embodiments, the immunosuppressive compound is a small molecule, a peptide, an antibody, and / or a nucleic acid (e.g., an antisense or siRNA molecule). In some embodiments, the immunosuppressive compound is a small molecule. In some embodiments, the small molecule is a steroid, an mTOR inhibitor, a calcineurin inhibitor, an anti-proliferative agent, or an IMDH inhibitor. In some embodiments, the small molecule is selected from corticosteroids (e.g., prednisone, budesonide, prednisolone), calcineurin inhibitors (e.g., cyclosporine, tacrolimus), mTOR inhibitors (e.g., sirolimus, everolimus), IMDH inhibitors (azathioprine, leflunomide, mycophenolate mofetil), antibiotics (e.g., actinomycin D, anthracyclines, mitomycin C, bleomycin, mithramycin), and methotrexate, or a salt or derivative thereof. In some embodiments, the immunosuppressive compound is a polypeptide selected from CTLA4, anti-b7 antibody, abatacept, adalimumab, anakinra, certolizumab, etanercept, golimumab, infliximab, ixekizumab, natalizumab, rituximab, secukinumab, tocilizumab, ustekinumab, vedolizumab, basiliximab, daclizumab, and muromonab.

[0323] In some embodiments, the genetically modified one or more cells, one or more tissues, or one or more organs to be administered to a subject have been further genetically modified such that they are less likely to induce an immune response in the subject. In some embodiments, the genetically modified one or more cells, one or more tissues, or one or more organs have been further genetically modified such that they do not express functional immune-stimulatory molecules.

[0324] The following examples are provided to illustrate the present disclosure and are for illustrative purposes only and should not be construed as limiting the scope of the present disclosure.

[0325] Examples

[0326] The present disclosure has now been generally described and will be more readily understood with reference to the following examples, which are included only for the purpose of illustrating certain aspects and embodiments of the present disclosure and are not intended to limit the present disclosure. For example, the specific constructs and experimental designs disclosed herein represent exemplary tools and methods for validating proper function. Thus, it will be readily apparent that any of the specific constructs and experimental plans disclosed can be substituted within the scope of the present disclosure.

[0327] Example 1: Knockout of porcine complement component 3 (C3) to inhibit the complement system

[0328] The highly conserved region of C3 was selected, and two sgRNAs targeting the C3 domain were designed. The sequences of these two gRNA sequences are TCTCCAGACGCAGGACGTTG (SEQ ID NO: 158) and GGAGGCCCACGAAGGGCAAG (SEQ ID NO: 159). Using a Neon transfection machine and reagent, C3 sgRNA was transiently transfected into porcine fetal fibroblasts together with GGTA sgRNA (GAGAAAATAATGAATGTCAA (SEQ ID NO: 210)) plasmid and cas9 plasmid. Cells lacking C3 ("C3-KO") were selected using the GGTA antibody counterselection method to co-enrich C3-KO cells, which were then subjected to single-cell sorting and genotyping to determine the efficiency of knocking down the C3 target using deep sequencing.

[0329] Among the 156 clones screened, 108 clones were bi-allelic C3-KO. The knockdown efficiency of the bi-allelic C3-KO cells was 69%. The resulting C3-KO cell line has been used to generate pigs using the somatic cell nuclear transfer method. The C3-KO pigs survived for 63 days and died of liver and lung infections. As Figures 1A - 1C shown, the C3-KO pigs were 100% NHEJ knockout. Figure 1A The size of the deletion introduced into C3 is shown, Figure 1B the position of the indel is shown, and Figure 1C the sequence of the indel generated in the C3-KO pigs is shown.

[0330] It is expected that the above C3-KO pigs will not produce any functional C3 protein. Due to the lack of functional C3 protein, the complement system of C3-KO pigs will not be able to be activated, thus reducing the innate immune system of C3-KO pigs. In addition, compared with wild-type pigs, C3-KO pigs are expected to be more susceptible to bacterial and / or viral infections. In addition, it is expected that xenotransplantation of cells, tissues, and / or organs of C3-KO pigs into humans will not activate the human complement system. Therefore, this should minimize the natural immune response to C3-KO pig xenografts.

[0331] Example 2: Pigs with one or more modified MHC class I genes

[0332] The major histocompatibility complex class I allele of pigs was conditionally replaced with the human MHC class I allele ("MHC-I pigs"). For this purpose, the region of the pig genome containing the SLA-1, SLA-2, and SLA-3 genes was replaced with a modified form of the human minor allele HLA-E.

[0333] Figure 2Depicts a scenario of MHC class I replacement strategy: The loci containing the SLA-1, SLA-2, and SLA-3 genes are flanked by loxP sites. After treatment with Cre, SLA-1, SLA-2, and SLA-3 are excised and replaced with human HLA-E, such as various combinations of HLA-E, HLA-G, B2M, and CIITA-DN genes. MHC-I pigs are alive and have severely impaired immune function. Therefore, conditional knockout was used before harvesting cells, tissues, and / or organs, and SLA-1, SLA-2, and SLA-3 genes were replaced with human HLA-E and other human genes, rather than replacing SLA-1, SLA-2, and SLA-3 genes with human genes in a general manner.

[0334] The MHC I region of pigs was sequenced using long-read technology. Probes capturing the SLA-1, SLA-2, and SLA-3 genes were designed and used to capture the MHC-I gene region. PacBio sequencing and 10X sequencing were used to accurately determine the MHC-I gene region. The constructs of SLA-1, SLA-2, and SLA-3 are shown in Figure 9 . Two boxes with loxP sites flanking the MHC-I region were designed. Box 1 contains a promoter, loxP sites, and a selection agent (i.e., puromycin). Box 2 contains a second marker (GFP), loxP sites, and a promoterless gene (including HLA-E, B2M, and CIITA-DN) cassette.

[0335] Box 1 and Box 2 were synthesized from individual components using the Golden Gate assembly strategy (New England BioLabs) and flanked with 800bp homologous sequences corresponding to the insertion sites. Two rounds of consecutive CRISPR-cas9 were used to insert the two sites 17 . Puromycin selection and GFP FACS sorting were used to isolate clones, and ligation PCR was used to verify the insertion.

[0336] Cells were transfected with Cre recombinase, and the expression of Cre recombinase was induced. Single-cell sorting was performed, and the sorted cells were screened using ligation PCR to isolate cells with human MHC-1 biallelic replacement of SLA-1, SLA-2, and SLA-3.

[0337] For in vivo Cre excision, an alternative cassette 1 has been designed that includes Cre recombinase under the control of a tissue-specific or inducible promoter. By using a tissue-specific or inducible promoter, the SLA-1, SLA-2, and SLA-3 genes will be excised in the target cells, tissues, and / or organs, or excision can be induced in animals prior to harvesting the cells, tissues, and / or organs. Pigs in which SLA-1, SLA-2, and SLA-3 are replaced by human MHC-I can be generated by somatic cell nuclear transfer (SCNT), and piglets encoding genes for conditional and / or tissue-specific conditional replacement can be produced.

[0338] Example 3: MHC class II inactivation

[0339] Pigs lacking MHC-II α-chain expression (“MHC-II KO pigs”) are generated by using established gRNA technology to excise the DQA gene and inactivate the DRA gene in porcine cells, and then transferring the porcine cells into a host pig via SCNT. Briefly, after the gRNA was transferred into porcine cells, the genome was sequenced, and variants at the MHC-II locus were identified. Cas9 was delivered to these cells, and then the cells were sorted to isolate single cells. These single cells were sequenced to genotype the targeted DQA and DRA genes. In single cells with inactivated DQA and DRA, embryos were generated after SCNT and then implanted into pigs to produce MHC-II KO pigs. Four weeks after birth, the MHC-II KO pigs remained healthy.

[0340] Figure 3A and Figure 3B The genotype of MHC-II KO is shown based on the DQA gene. MHC-II KO pigs were genotyped by exon-targeted amplification and sequencing of the DQA gene and DRA gene sequencing. As shown in the left figure, the size and location of the indel are in the DRA gene. As shown in the right figure, the inactivation of the DRA gene is due to two single nucleotide insertions at positions 126 and 127 of the DRA amplicon, respectively.

[0341] Figure 4A and Figure 4B Another genotype of MHC-II KO pigs is shown. The DRA genotype was determined using exon-targeted amplification and sequencing of the DRA gene. The exon-targeted region from DRA has been amplified and sequenced. As shown in the left figure, the size and location of the indel are in the DRA gene. As shown in the right figure, the inactivation of the DRA gene is due to two single nucleotide insertions at positions 106 and 107 of the DRA amplicon, respectively.

[0342] Similar to humans lacking MHC-II expression, the CD4 + T cell population of MHC-II KO pigs is reduced. However, the CD8 + T cell population remains intact ( Figure 5 ). In addition, among other issues, MHC-II KO pigs are immunosuppressed, with enhanced autoimmunity and lymphoid defects. These phenotypes are known to be associated with the MHC-II KO phenotype and have been observed in mice lacking MHC-II expression. These similarities confirm that MHC-II KO pigs are effective MHC-II KOs and not active gene modifications ( Figure 6 ).

[0343] Example 4: PD - L1 knock - in to reduce adaptive immunity - based rejection

[0344] The human PD-L1 gene (e.g., PD-L1 transgene) was delivered to the pig genome. See the schematic structure diagram in Figure 7 . The expression of the human PD-L1 transgene was confirmed by qPCR using two different PD-L1 amplicons ( Figure 8 ).

[0345] After xenotransplantation, pig tissues expressing PD-L1 may have reduced rejection by the host (such as humans).

[0346] Example 5: Genetic modification of porcine von Willebrand factor to regulate platelet aggregation

[0347] An HDR vector containing homologous arms from pvWF, the A1 domain, and certain residues in the flanking region from hvWF was designed and constructed. ( Figure 10 ). Two additional sgRNAs were also designed to initiate HDR replacement in the endogenous pig genome and cut near the region to be replaced by the human sequence: TCTCACCTGTGAAGCCTGCG (SEQ ID NO: 5) and CACAGTGACTTGGGCCACTA (SEQ ID NO: 6).

[0348] The HDR vector consists of approximately 1 kb homologous arms from porcine vWF, the human A1 and flanking domains, and inactivated mutations in the sgRNA cleavage sites to prevent sgRNA cleavage of the donor and the modified porcine genome. The HDR vector also contains SphI and BspEI sites near the sgRNA cleavage sites, which can distinguish the HDR vector from the endogenous porcine genome.

[0349] Porcine primary fibroblasts were transfected with 8 μg Cas9, 1 μg sgRNA1, 1 μg sgRNA2, and 10 μg HDR vector using the Neon transfection system (Invitrogen). Two days after transfection, the cells were subjected to single-cell subcloning using FACS. The single cells were cultured for an additional 12 days until the free-form HDR vector disappeared during cell division. The A1 and flanking regions of hvWF were amplified using flanking primers. The PCR products were digested sequentially with SphI and BspEI to screen for clones with HDR replacement, which would add novel SphI and BspEI sites to the PCR products of fragments of 700 bp, 323 bp, and 258 bp sizes after sequential digestion ( Figure 11 ). Complete biallelic HDR eliminated the 1281-bp wild-type product and any partially digested products greater than 700 bp.

[0350] Cells with biallelic HDR were isolated from approximately 150 single-cell colonies ( Figure 11 ). As confirmed by sequencing, both alleles of the porcine A1 domain and flanking regions were replaced with the human counterparts ( Figure 12A and Figure 12B ). The A1 domain is highlighted, while potential glycosylation sites in the flanking regions are underlined. Human-specific residues missing in pvWF are marked with bars, and the humanized A1 domain and flanking regions are marked with half brackets. This isolated cell has been expanded into a cell line and can be used to generate genetically modified pigs by SCNT.

[0351] Cells expressing A1 humanized pvWF had a significantly reduced aggregation response against human platelets during the platelet activation assay ( Figure 13 ). Briefly, the cells were incubated with human platelets, and aggregation was induced by shear stress. Cells expressing A1 humanized pvWF showed a milder and inducible aggregation curve, while cells expressing wild-type pvWF had a stronger aggregation response to human platelets. Therefore, compared to pig organs expressing pvWF, pig organs with A1 hvWF may induce a milder coagulation response in human blood and may improve the vascular incompatibility observed in pig-to-human xenotransplantation.

[0352] Collectively, these data suggest that replacing certain residues in the A1 domain and one or more flanking domains of endogenous porcine pvWF with the corresponding residues from the human counterpart (hvWF) can modulate the platelet aggregation response that occurs during xenotransplantation ( Figure 9 ).

[0353] Example 6: Genomic deletion of porcine classical MHC I antigen to prevent CD8+ T cell activation

[0354] MHC class I molecules play a crucial role in the rejection of allografts through their peptide presentation to CD8+ T cells. Here, it was tested whether the deletion of the entire ~200 kb classical MHC class I locus in porcine primary fibroblasts prevents CD8+ T cell-mediated toxicity in xenotransplantation.

[0355] Classical MHC class I genes encode highly polymorphic proteins that are widely expressed on the cell surface. They present foreign peptides to CD8+ T lymphocytes, leading to the lysis of target cells. Additionally, mismatched MHC I molecules also act as antigens in transplantation. Different strategies have been explored to remove classical MHC I molecules in donor pig organs for xenotransplantation. In one attempt, the Tector group used Cas9 and three sgRNAs to knockout the conserved exon 4 of SLA-1, SLA-2, and SLA-3 molecules (Reyes 2014). However, this exon is also shared by other classical and non-classical MHC I molecules, and it may produce unpredictable off-target effects. Additionally, the remaining exons 1-3 can still exist as cell surface antigens. In another attempt, the heterodimeric chaperone B2M was knocked out using TALEN (Wang 2016). This method may also affect non-classical MHC I molecules, and the remaining MHC I may still present deconstructed proteins on the cell surface. In the case of xenotransplantation, human HLA-E / B2M molecules are usually supplemented in MHC I-deficient cells to prevent NK cell-mediated toxicity. Human B2M may dimerize with porcine SLA and restore its antigenicity in B2M knockout pigs.

[0356] For this example, to specifically and completely remove classical MHC I antigens, the MHC classical class I cluster with unique flanking sequences in the porcine genome was first identified ( Figure 14 ). This ~200 kb cluster contains all eight classical MHC I genes without any other protein-coding genes. Then, sgRNAs (SEQ ID NO 1-4) in the unique flanking regions were identified to induce the deletion of this entire gene cluster. Since the frequency of ~200 kb fragment deletions is relatively low, an enrichment strategy was also designed to isolate biallelic deletion clones.

[0357] Porcine primary fibroblasts were transfected with 1.25 μg of TrueCut Cas9 protein and 7.5 nmol of crRNA / tracrRNA duplex (Invitrogen) using the Neon transfection system (Invitrogen). Three days after transfection, genomic DNA was harvested from the transfected cells and used Figure 15Perform PCR with the specified primer pair shown in A. Detect fragment deletions using primers flanking the expected deletion junctions. Subclone this PCR product using topoisomerase-based cloning (“TOPO cloning”), and perform Sanger sequencing on individual TOPO clones to confirm the sequence of the deletion junction. Align the sequence with the Figure 15 expected junction shown in B. Meanwhile, stain an aliquot of the cells with a porcine-specific SLA-1 antibody. A portion of the MHC I-negative cells is shown in Figure 16 .

[0358] After single-cell subcloning, cells containing biallelic deletions can be used to generate classical MHC I knockout pigs via somatic cell nuclear transfer. It is expected that these pigs will be completely devoid of all classical MHC I molecules and enriched in non-classical MHC I molecules that may be involved in fertility and other physiological functions. The remaining β2M molecules are unlikely to be antigenic because they are non-polymorphic and highly conserved with respect to their human counterparts. Additionally, exogenous expression of human HLA-E / β2M cannot rescue the lack of classical MHC I molecules. Compared to previous reports, the resulting pigs should have the cleanest classical MHC I knockout background.

[0359] Example 7: Generation of immunologically compatible porcine cells, tissues, organs, pigs, and offspring

[0360] Although many attempts have been made by others to generate transgenic pigs for safe xenotransplantation, the number of transgenes carried by the most advanced transgenic pigs for xenotransplantation is also limited to date due to construct compatibility and transcriptional interference between transgenes. Here, a combination of KO, KI, and genomic replacement was used for several iterations to generate donor pigs. Figure 21 The process of donor pig generations by sequential gene editing is outlined. As described below, in the case of Pig 2.0 (3KO + 12TG), these gene edits include three knockouts and 12 transgenic knock-ins that were designed to address immune, coagulation, and species incompatibilities.

[0361] Use CRISPR-Cas9-mediated NHEJ for the functional knockout of three major carbohydrate-producing glycosyltransferase / glycoside hydrolase genes, GGTA1, CMAH, and B4GALNT2. Preformed antibodies against wild-type porcine tissues are a major initial immunological barrier to xenotransplantation, and these three genes have been identified as being primarily responsible for producing the xenoantigens targeted by these antibodies (Byrne 2014, Lai 2002, Lutz 2013, Martens 2017, Tseng 2006). Thus, loss of function of these genes is predicted to largely eliminate the binding of preformed anti-pig antibodies to porcine graft endothelium. This was confirmed by flow cytometry results, which showed reduced binding of host antibodies to target porcine 2.0 (3KO+12TG) fibroblasts ( Figure 22 ). To show reduced antibody binding, genetically engineered porcine fibroblasts were incubated with pooled human serum, and bound human IgM and IgG were detected with conjugated secondary anti-human antibodies and analyzed by flow cytometry. In contrast to wild-type porcine fibroblasts (red contour plot), elimination of these three genes resulted in a significant reduction in antibody binding (green and brown contour plots, approximately 98% reduction).

[0362] Twelve human transgenes (CD46, CD55, CD59, CD39, CD47, A20, PD-L1, HLA-E, B2M, THBD, TFPI, HO-1) were integrated into a single multi-transgene cassette in the porcine genome via PiggyBAC transposon-mediated random integration to generate the first iteration of porcine 2.0 (3KO+12TG) (see Figures 17 - 20 , Figure 31 , Figures 47 - 49 ; SEQ ID NO: 212-214). The transgenes were arranged into 4 different cis-regions with desired ubiquitous or tissue-specific promoters. The transgenes within each cis-region were separated by ribosome-skipping 2A peptides to ensure expression in similar molar ratios. In addition, a combination of cis-elements such as ubiquitous chromatin opening elements (UCOEs) was introduced to prevent transgene silencing; and insulators with strong polyadenylation sites and terminators were introduced to minimize interactions between transgenes and between transgenes and flanking chromosomes.

[0363] qPCR was used to determine transgene expression levels and tissue-specific promoter-driven expression ( Figure 23) and determine the integration sites and copy numbers using inverse PCR-based junction capture. As a proof of principle, all transgenes in adjacent cis-genes showed the desired tissue specificity in fibroblast and endothelial cell lines without detectable transcriptional interference. In addition, all transgenes showed highly consistent expression levels among clones with different genomic integration positions, indicating that transgene expression is independent of the chromosomal background. As expected, six genes inserted under the control of a ubiquitous promoter (including complement regulatory genes (CD46, CD55, and CD59; EF1α promoter) and B2M, HLA-E, and CD47 (CAG promoter)) were expressed in both fibroblasts and endothelial cells. In contrast, six genes (A20, PD-L1, HO1, THBD, TFPI, and CD39) expressed under the regulation of tissue-specific promoters (NeuroD or ICAM2) showed lower expression levels in fibroblasts relative to their expression in endothelial cells. Consistent with the qPCR data, cell surface expression of the proteins was observed from the expression of human transgenes inserted in porcine splenocytes and porcine fibroblasts ( Figure 24 ). Briefly, porcine 2.0 (3KO + 12TG) splenocytes or fibroblasts were isolated, incubated with antibodies recognizing the specific human proteins shown, and the stained cells were analyzed by flow cytometry. In Figure 24 each panel, the left peak represents cells stained with an isotype control, and the right peak represents cells stained with a specific antibody.

[0364] For preclinical experiments, transgenes were knocked in randomly integrated into the genome using PiggyBac transposase, and clones with single-copy integration into intergenic regions with no predictable consequences were used for pig production. For clinical development, homozygous female / male pigs will be generated by bi-allelic site-specific transgene integration into a safe harbor (e.g., the AAVS1 genomic locus) prior to expanding the breeding and production source donor pigs.

[0365] Additional in vitro evaluations of innate and adaptive immune cell functions and complement and coagulation cascades will include antibody reactivity profiling, mixed lymphocyte reaction, complement-dependent cytotoxicity, NK cell cytotoxicity, macrophage phagocytosis, and effects on coagulation factors and platelet aggregation.

[0366] To maintain porcine graft function and protect donor organs from complement-mediated toxicity, human complement regulatory proteins are overexpressed. Briefly, genetically engineered porcine fibroblasts and porcine splenocytes are incubated with 25% human complement for one hour. Cells are stained with propidium iodide and analyzed by flow cytometry to quantify cell death. After culturing with human complement, wild-type fibroblasts and splenocytes exhibit the highest percentage of cell death. 4-7P and 4-7H cells are derived from porcine 2.0 (3KO + 12TG) piglets; 4-7F cells (3KO + 12TG) are derived from porcine 2.0 (3KO + 12TG) fetuses. 3-9 is triple carbohydrate antigen-producing enzyme KO, HLA-DQA KO, HLA-DRA KO, and human complement regulatory factor C3 KO. As Figure 25 shown, porcine fibroblasts and splenocytes engineered to express human CD46, CD55, and CD59 exhibit significantly lower levels of complement-mediated cell death compared to control human fibroblasts.

[0367] Ligation of MHC I on target cells to killer inhibitory receptors (KIR) on natural killer (NK) cells inhibits NK cell-mediated target cell killing. Porcine MHC I cannot transmit signals through human NK KIR, and thus, porcine cells are sensitive to NK cell-mediated target cell killing. To overcome NK-mediated cell death, human HLA-E ligated to the human NK KIR receptor is overexpressed in porcine cells. Seventy percent of WT porcine fibroblasts and K562 cells (a human MHC-deficient cell line) are targeted for killing by NK cells. As Figure 26 shown, human HLA-E+ engineered porcine fibroblasts exhibit significantly reduced NK-mediated cell killing. In contrast, HLA-E+ porcine fibroblasts exhibit significantly reduced NK cell killing, indicating that expression of HLA-E protects these cells from lysis.

[0368] Overexpression of human CD55 in porcine cells reduces complement-mediated toxicity, which may reduce clotting and improve xenograft survival. Activation of clotting ultimately leads to the formation of thrombin, which is inactivated by binding to antithrombin in the stable thrombin-antithrombin (TAT) complex. Briefly, wild-type, CD55 KI+GGTA1-deficient cells, and human endothelial cells are cultured with human blood. Figure 27 shown, human blood alone or human blood incubated with human endothelial cells for 60 min produces approximately 10 ng / mL of TAT protein. In addition, co-culture of human blood with wild-type porcine endothelial cells activates clotting and increases TAT complex formation to 58 ng / mL. In contrast, co-culture with CD55 KI+GGTA-deficient porcine endothelial cells results in a significant reduction in TAT complex formation. These data indicate that human CD55 expression can regulate clotting activation.

[0369] RNAseq was performed on samples isolated from pigs genetically modified with payload 9 or payload 10. The results showed increased expression of several payload immunomodulatory transgenes, namely complement transgenes, as well as cytotoxicity genes (B2M, HLA-E, CD47) ( Figure 36 ).

[0370] Example 8: Potential of antibody and enzyme cleavage to prevent functional binding in xenotransplantation

[0371] Antibody-mediated rejection has historically been the major obstacle to the development of xenotransplantation as a viable treatment for end-stage organ failure. However, recent genetic advances have allowed the development of polygenic knockout pigs that lack established xenogeneic antigen targets. Knockout of aGal, Neu5Gc, and SDa has been associated with improved graft survival. However, further work is needed to fully understand the impact of residual antibodies binding to other xenogeneic antigen targets and whether the removal of these antigens can protect tissues from highly sensitized human sera. Here, it was investigated whether xenogeneic antigen knockout reduced high PRA serum binding and whether enzymatic degradation reduced functional antibody binding.

[0372] Human and porcine PBMCs were collected from peripheral blood using Ficoll separation. Porcine aortic endothelial cells (pAECs) were processed from WT pigs and the genetically modified pig 2.0 (3KO + 12TG) of Example 7. Anonymous high and low PRA serum samples were generously provided by the HLA Laboratory of Massachusetts General Hospital. Serum was collected from cardiac, hepatic, and renal xenograft recipients. Serum antibodies were enzymatically cleaved by IdeS (Genovis Inc.).

[0373] Low PRA human serum showed minimal binding to human PBMC target cells, while high PRA human serum bound to the same human PBMCs at high levels ( Figure 43 A). In contrast, both high and low PRA sera strongly bound porcine PBMCs ( Figure 43 B). High PRA serum also showed significant binding to porcine aortic endothelial cells (pAECs). Genetic modification significantly (>95%) reduced the binding of all human sera ( Figure 44 ). Importantly, in vivo xenotransplantation experiments using cardiac, hepatic, and renal xenografts from pig 2.0 (3KO + 12TG) showed sequestration of porcine-specific antibodies by reducing antibody binding of recipient sera sampled after transplantation ( Figure 45 ). These data suggest the presence of low levels of residual xenogeneic antibodies. Figure 46 A - Figure 46 C show that the IgG-specific protease IdeS effectively reduced the binding of functional IgG from human and cynomolgus monkey sera to background levels.

[0374] Genetic modification to remove known xenoantigen targets reduces the binding of human and primate sera to porcine cells, but retains low levels of xenoantibody binding. High and low PRA sera are similar, suggesting that the binding may be unrelated to HLA-SLA cross-reactivity. IdeS treatment of sera from highly sensitized patients demonstrated a negative cross-match with porcine 2.0 (3KO+12TG) cells. Other methods to protect xeno-graft targets from antibodies with unknown targets are to use additional genetic modifications to prevent downstream sequelae such as complement activation and thrombosis. This data shows for the first time that enzymatic antibody cleavage can successfully reduce the functional binding of residual IgG, suggesting that this treatment may also be a method to reduce the impact of pre-formed xenoantibody binding.

[0375] Example 9: Generation of PERV - free and immunologically compatible porcine cells, tissues, organs, pigs, and offspring

[0376] Porcine organs are considered a favorable resource for xenotransplantation because of their size and function similarity to human organs and the ability to breed pigs in large numbers. However, the potential risk of transmission of porcine endogenous retroviruses (PERVs) and immunological incompatibility have hindered the clinical use of porcine organs. PERVs are gamma-retroviruses found in the genomes of all porcine strains. The porcine genome contains several to dozens of copies of PERV elements (Lee 2011). Different from other animal infectious disease pathogens, PERVs are an integral part of the porcine genome. Therefore, they cannot be eliminated by biosecure breeding (Schuurman 2009). Although no studies have shown PERV transmission to humans in a clinical setting to date, it has been shown that PERVs can infect and replicate in human cells through a "copy and paste" mechanism. In cell culture, it has been shown that virus particles can be released and can infect human cells and randomly integrate into the human genome, preferentially into intragenic regions and active chromatin remodeling regions (Armstrong 1971, Moalic 2006, Niu 2017, Patience 1997). It has also been shown that both PERV-A and PERV-B can infect human cells. Although PERV-C is amphotropic, the recombinant virus type (A / C) exhibits the greatest infectivity. In addition, once PERV adapts to a new host genome environment through an extended LTR sequence, the infectivity potential may increase. PERV can also be horizontally transmitted from infected human cells to other human cells that have no contact with porcine cells. In vivo, in immunocompromised mice, it has been shown that PERV can be transmitted from porcine cells to murine cells (Clémenceau 2002). As reported for other retroviruses, PERV integration may potentially lead to immunodeficiency and tumorigenesis. Recent breakthroughs in genetic engineering have demonstrated the complete inactivation of PERVs in the whole genome of immortalized porcine cell lines (Yang 2015; PCT Publication No. WO 17 / 062723) and the generation of PERV-free pigs (Niu 2017; PCT Publication No. WO 18 / 195402).

[0377] Using the CRISPR-Cas9 technology, complete elimination of all 62 copies of PERV elements from the genome of PK15 porcine kidney epithelial cells (Yang 2015), and complete elimination of all 25 copies from porcine fetal fibroblasts, and subsequently the generation of live pigs with all PERV elements inactivated (Niu 2017) were achieved. This success indicates that it is now possible to derive PERV-free pigs, which can provide a safe donor pool for xenotransplantation.

[0378] To determine whether PERV remains active and propagates in human cells, PERV copy number was monitored for more than 4 months in populations and clones of PERV-infected HEK293T-GFP cells (iHEK293T-GFP). PERV copy number was observed to increase over time as determined by ddPCR (Pinheiro 2012).

[0379] Studies have been conducted to determine whether disruption of all copies of PERV pol in the porcine genome could eliminate in vitro transmission of PERV from pigs to human cells (Niu 2017). No reverse transcriptase activity was detected in the cell culture supernatant of a highly engineered PERV fetal fibroblast clone, indicating that the modified cells produced few, if any, PERV particles. The PK15 clone with >97% PERV pol targeting exhibited up to a 1000-fold reduction in PERV infection, similar to background levels. These results were confirmed by PCR amplification of serial dilutions of human embryonic kidney 293 (HEK293) cells with a history of exposure to the PK15 clone. Total RNA isolated from various tissues of pigs has demonstrated approximately 100% inactivation of PERV at the mRNA level.

[0380] To date, multiple clones with 100% PERV KO have been produced from the Yorkshire breed, and pig cloning is ongoing. PERV-inactivated pig production is robust, and 63 PERV-inactivated piglets have been produced, 47 of which are female and 16 are male. To date, the oldest healthy animal has survived for two years. Currently 43 PERV KO pigs are maturing for breeding. Consistent with the normal karyotype of the cells used for pig cloning, no abnormal chromosomal structural changes were detected in the PERV-inactivated pigs.

[0381] Long-term studies are underway to monitor the effects of PERV inactivation and gene editing in large animals. The technology is being applied to additional pig strains, including both Yorkshire and Yucatan pigs in the United States. The source donor pigs will be genetically engineered in a background line in which all PERV elements are inactivated.

[0382] Iterative forms of PERV-free and immunologically compatible pigs. Studies have been conducted to engineer donor pigs that do not have any active PERVs in their genomes, as well as pigs with enhanced immune, inflammatory, and coagulation systems that are more compatible with human tissues. Regarding the former, in pigs, the functions of all PERVs in the pig genome have been eradicated by using CRISPR-Cas9 engineering to disrupt the catalytic domain of the reverse transcriptase gene (pol) in the PERV element (using methods described, for example, in Niu 2017 and WIPO Publication No. WO 2018 / 195402), and a combination of knockout (KO), knock-in (KI), and genome replacement is used to provide human-compatible organs. Regarding the latter, pigs are generated as described herein in which the three major xeno-carbohydrate antigen-producing genes / enzymes that trigger humoral rejection responses (i.e., GGTA1, CMAH, and β1,4 N-acetylgalactosaminyltransferase 2 (B4GALNT2)) have been genetically inactivated. The loss of function of these genes is expected to largely eliminate the binding of pre-formed anti-pig antibodies to the endothelial cells of pig grafts. In addition, key immunomodulatory factors are inserted at a single locus within the PERV-free pig genome to regulate, for example, the human complement system (hCD46, hCD55, and hCD59), the coagulation system (e.g., hCD39, hTHBD, and hTFPI), the inflammatory response (e.g., hA-20, hCD47, and hHO-1), and NK (e.g., PD-L1) and T cell responses (e.g., hHLA-E, hB2M). Single-copy polycistronic transgene integration by transposition is used to knock in these humanized genes.

[0383] It is expected that pigs that are both PERV-free and carry an immunocompatibility payload can be produced, and such pigs will have multiple desirable characteristics. To achieve this goal, donor pigs have been generated through multiple iterations of genetic modification. Figure 21The process of generating donor pigs through sequential gene editing is outlined. In the first iteration, porcine fibroblasts of Pig 1.0 were genetically engineered using CRISPR-Cas9-mediated non-homologous end joining (NHEJ) to functionally delete or inactivate all PERV copies from the genome. Pig 2.0 was generated by CRISPR-mediated NHEJ to delete three major xeno-carbohydrate antigen-producing genes (3KO; GGTA1, B4GALNT2, and CMAH), and combined with PiggyBAC-mediated random integration of up to 12 selected transgenes or knock-ins selected from CD46, CD55, CD59, HLA-E, B2M, CD47, CD39, THBD, TFPI, A20, PD-L1, and HO-1, which modify various components of the xenoimmune response into the porcine genome. For the Pig 3.0 iteration, source donor pigs were then generated in a PERV-free background to carry 3KO and up to 12 designated transgenes. It is expected that the next generation of source donor pigs (Pig 3.1, 3.2, etc.) will be genetically engineered to carry additional modifications such as humanization of the vWF gene and deletion of the asialoglycoprotein receptor 1 (ASGR1) and the endogenous B2M gene.

[0384] Once PERV-free 3KO+TG pigs (Pig 3.0, Figure 21 ) are genetically engineered, these pigs will be crossbred to produce offspring and / or the drifting, driving, parturition, and / or vocalization of pigs.

[0385] Cell engineering and SCNT to produce pigs. 3.0 incorporates immunocompatibility payloads, xenoantigen disruption, and PERV disruption

[0386] To produce PERV-free pigs 3.0, pigs 2.0 (3KO+9TG) with xenocompatibility modifications were first generated. Pigs 2.0 (3KO+9TG) include the transgenic hCD46, hCD55, hCD59, hB2M, hHLA-E, hCD47, hTHBD, hTFPI, and hCD39. To generate donor cells for somatic cell nuclear transfer (SCNT) to produce pigs 2.0, wild-type porcine ear fibroblasts were first electroporated with two reagents: a) CRISPR-Cas9 reagents targeting the GGTA, CMAH, and B4GALNT2 genes; and b) a payload plasmid carrying (i) a PiggyBac transposase cassette (ii) a transgenic construct consisting of nine human transgenes (hCD46, hCD55, hCD59, hB2M, hHLA-E, hCD47, hTHBD, hTFPI, and hCD39) organized into 3 expressible cis-genes (see Figure 51). Single-cell clones of fibroblasts were generated and screened by: a) fragment analysis / whole-genome sequencing to identify clones with the desired genomic modifications (see Figure 51C ) and b) conventional PCR (see Figure 51D ). Then the clones with the desired modifications were used as donors to produce pigs 2.0 by SCNT.

[0387] Using cells isolated from the hooves of pigs 2.0 (3KO+9TG), PERV was engineered using the CRISPR-Cas9 system to produce cells with xenocompatibility modifications and also free of PERV. Pigs 2.0 fibroblasts were electroporated with CRISPR-Cas9 reagents targeting the reverse transcriptase (Pol) gene common to all genomic copies of the PERV element. Single-cell clones of the electroporated cells were generated and screened by deep sequencing to identify clones in which the catalytic core of the Pol gene was disrupted (see Figure 51C ). Then the clones with the desired Pol disruption were karyotyped (see Figure 51E ); then those clones with a normal karyotype were used in SCNT to produce pigs 3.0 (3KO+9TG) embryos and pigs.

[0388] Characterization of the genomic, biochemical, and phenotypic features of pigs 3.0

[0389] A) Assessment of transgene and knockout integrity

[0390] After generating the pigs 3.0 (3KO + 9TG), we next sought to carefully examine the on-target and off-target effects of the genetic modifications therein. To this end, we performed 10-fold whole-genome sequencing (WGS) on WT fibroblasts as well as the pigs 2.0 and pigs 3.0 fibroblasts generated above. Consistent with the deep sequencing performed for screening, WGS confirmed that the mutations in the genomic copies of the introduced PERV pol and GGTA / B4GALNT2 / CMAH genes were all frameshift insertions or deletions, which were expected to translate into functional knockouts of the modified gene copies (see Figure 51A and Figure 51C ). In addition, we confirmed the presence of all nine transgenes in the pig genome and, surprisingly, found that the transgene construct had integrated into one of the GGTA1 alleles at the CRISPR-Cas9 targeting site.

[0391] Regarding the potential confounding off-target effects of CRISPR editing, we did not find artifacts that were expected to interfere with the functions of our desired edits or have an expected detrimental effect on pig health. We did not observe any differences in structural variants between WT and pigs 2.0 (3KO + 9TG) or between pigs 2.0 (3KO + 9TG) and pigs 3.0 (3KO + 9TG), indicating the overall genomic stability of these pigs. Regarding smaller genomic changes, such as small indels, we examined all 1,211 predicted off-target sites of the guide RNAs used and found that there were two small insertions in the B4GALNT2 gRNA off-target sites in pigs 2.0 compared to WT; however, neither of the insertions affected the protein-coding sequence. In addition, when we compared pigs 3.0 cells with pigs 2.0 cells, we did not observe any additional genomic alterations that were expected to be significant; we only found two deletions and one insertion within two PERV gRNA off-target sites, both of which occurred outside the protein-coding region and may actually represent somatic mutations (see Kim 2014). Considering the lack of functional significance and the substantial normal pathophysiological data of our pigs, we concluded that the selected pigs 3.0 maintained genomic stability.

[0392] After confirming the genomic modifications at the DNA level, we further examined whether pigs 3.0 (3KO + 9TG) had appropriate triple knockouts and 9TG expression using RNA expression and immunoassay methods. We first performed RNA-seq and found that both pigs 2.0 and pigs 3.0 expressed all transgenes at levels comparable to those of human umbilical vein endothelial cells (HUVECs) ( Figure 52A)。In addition, we observed comparable transgene expression profiles and levels in both porcine umbilical vein endothelial cells (PUVEC) and fibroblasts, indicating widespread transgene expression in these cell types. Next, we characterized protein expression in the engineered pigs. We observed a reduction in the glycan markers of α-Gal, Neu5GC, and SDa on the cell surface, indicating functional elimination of three genes responsible for synthesizing these glycan epitopes (GGTA, CMAH, and B4GALNT2, respectively) in both porcine 2.0 (3KO+9TG) cells and porcine 3.0 cells ( Figure 52B )。By FACS analysis of PUVEC, we observed that both porcine 2.0 and porcine 3.0 expressed all transgenes at the protein level. In fact, eight out of the nine transgenes were robustly expressed at levels comparable to those of HUVEC. Interestingly, THBD expression was detectable but at much lower levels. Consistent with the FACS analysis, IHC studies showed that porcine 3.0 kidneys lacked three glycan antigens ( Figure 52C )。Also consistent with the FACS staining, we detected the expression of eight transgenes in porcine 3.0 kidneys, except for THBD ( Figure 52C )。Taken together, we conclude from the RNA expression and immunoassay data that our triple knockout and 9TG gene modifications were successfully translated into RNA and protein expression at the cellular and tissue levels in the engineered pigs.

[0393] B) Evaluation of the xenocompatibility characteristics of porcine 3.0 cells

[0394] Next, we examined whether the genome-modified pigs acquired xenocompatible functions. We first tested whether the gene modification allowed the modified porcine cells to escape preformed human antibody binding. Compared with WT PUVEC, porcine 2.0 and porcine 3.0 PUVEC showed more than 90% reduction in antibody binding to human IgG and IgM, confirming that the antibody barrier against xenotransplantation can be greatly alleviated by 3KO ( Figure 53A )。In addition, when incubated with human complement from pooled human serum, porcine 3.0 PUVEC with triple knockout expressing human complement regulators CD46, CD55, and CD59 exhibited minimal in vitro human complement toxicity, similar to their human HUVEC counterparts ( Figure 53B )。Taken together, these results indicate that when transplanted, porcine 3.0-derived xenografts are expected to be less sensitive to humoral injury and hyperacute rejection due to significantly reduced antibody binding and complement activation.

[0395] In addition, we examined whether Pig 3.0 is more resistant to damage mediated by human innate cellular immunity. When performing ex vivo assays, Pig 3.0 expressing HLA-E / B2M exhibited significantly stronger resistance to NK-mediated cell killing compared to WT PUVEC( Figure 53C ). Collectively, these results suggest that Pig 3.0 cells are expected to be more resistant to human innate immune attack when transplanted.

[0396] Finally, we examined whether Pig 3.0 (3KO+9TG) could attenuate the dysregulated platelet activation and coagulation cascade frequently observed in xenotransplantation. When vascularized WT pig organs are transplanted into humans, preformed antibodies, complement, and innate immune cells can induce endothelial cell activation and trigger coagulation and inflammation. The incompatibility between coagulation regulators from pig endothelial cells and human blood leads to abnormal platelet activation and thrombin formation, exacerbating the damage. In addition, the molecular incompatibility of coagulation regulators between pigs and humans (e.g., tissue factor pathway inhibitor, TFPI) renders external coagulation regulation ineffective.

[0397] To address these xenocoagulation issues, we overexpressed the following two in Pig 3.0 as part of our multi-transgene construct for Pig 3.0: a) human CD39 (an ADP hydrolase that counteracts the thrombogenic effects of ADP in the coagulation cascade) and b) human TFPI (a factor that translocates to the cell surface after endothelial cell activation). Then, we performed various in vitro and ex vivo assays to verify the ability of these transgenes to function properly and regulate the coagulation pathway when transplanted into pig cells. In vitro ADPase biochemical assays showed significantly higher CD39 activity in Pig 3.0 PUVEC compared to WT PUVEC and HUVEC, consistent with its higher mRNA and protein expression from the transgene( Figure 53F ). Similarly, activated Pig 3.0 PUVEC showed the ability to effectively bind and neutralize human factor Xa, which can mitigate coagulation and reduce the formation of thrombin-antithrombin (TAT) complexes( Figure 53G ). Finally, in an ex vivo coagulation assay using human whole blood co-cultured with Pig 3.0 PUVEC, minimal TAT (thrombin-antithrombin) was formed, and the level of TAT formation was similar to that of HUVEC( Figure 53E ), indicating that Pig 3.0 acquired enhanced coagulation compatibility with human factors.

[0398] Collectively, the results of these xenocompatibility experiments suggest that Pig 3.0 (3KO+9TG) acquired enhanced compatibility with the human immune system, as demonstrated by attenuated human antibody binding, complement toxicity, NK cell toxicity, phagocytosis, and restored coagulation regulation.

[0399] C) Physiological phenotypes of the 3.0 progenitor / Proof-of-concept pigs

[0400] To evaluate the overall health of the engineered pigs, we examined the physiology, fertility, and transmission of the genetic modifications to the offspring of the engineered pigs. We observed that despite extensive engineering of the PERV elements, immunology, and coagulation pathways, both pigs 1.0 and 2.0 (3KO+9TG) showed normal blood cell counts, including total white blood cells and platelets, monocytes, neutrophils, and eosinophil counts ( Figure 54A ). We also observed normal vital organ function (liver, kidney, and heart) in the engineered pigs ( Figure 54B , Figure 54C and Figure 54D ). Additionally, compared to WT pigs, the engineered pigs had similar prothrombin and thrombin times ( Figure 54E ).

[0401] Furthermore, we found that pigs 1.0 and 2.0 were fertile and produced a normal average litter size of seven. Offspring of breeding pig 1.0 with WT pigs carried approximately 50% inactivated PERV alleles in their liver, kidney, and heart tissues, indicating that the PERV-KO alleles were stably inherited following Mendelian genetics ( Figure 55 ). Similarly, all offspring of pigs 2.0 and WT pigs were heterozygous for 3KO ( Figure 56A ), and approximately half carried 9TG, the expression of which was verified at both the mRNA ( Figure 56B ) and protein levels ( Figure 56C ). This indicates that the genetic modifications were not swept away by normal breeding. Therefore, we conclude that the engineered pigs exhibited normal physiology, fertility, and germline transmission of the edited alleles.

[0402] D) Conclusion

[0403] Genetically engineered pigs have great promise in addressing the unmet medical need of organ shortage. In this report, we engineered pig 3.0 (3KO+9TG), in which 42 genomic loci were modified to eradicate PERV activity and enhance human immunocompatibility. Extensive analysis of pig 3.0 showed that the engineered pig cells exhibited reduced human antibody binding, complement toxicity, NK cell toxicity, and coagulation dysregulation. We also examined and verified the normal pathophysiology, fertility, and genetic heredity of our engineered pigs. The successful generation of pig 3.0 enhanced the ability to provide safe and effective organs for clinical transplantation.

[0404] The successful generation of Pig 3.0 (3KO + 9TG) demonstrated the ability of synthetic biology to extensively engineer the genome in large animals and endow novel functions. In Pig 3.0, we deleted 25 copies of the PERV element, 8 alleles of the xenogene, and simultaneously expressed 9 human transgenes to physiologically relevant levels. This extended the record of genome modification in large animal models to 42. With the ability to perform complex genetic engineering on this scale, we were able to engineer additional edits and ultimately select pigs with the most suitable combination for xenotransplantation. Additionally, with these tools, we envision that Pig 3.0 can be further engineered to achieve additional novel functions such as immune tolerance, organ lifespan, and viral immunity.

[0405] E) Method

[0406] CRISPR-Cas9 gRNA Design

[0407] We used the R library DECIPHER to design specific gRNAs (PERV-3N: 5′-TCTGGCGGGAGCCACCAAAC-3′, PERV-5N: 5'-GGCTTCGTCAAAGATGGTCG-3′, PERV-9N: 5 ′ -TTCTAAGCAGTCCTGTTTGG-3′) to specifically target all pol catalytic sequences in the Pig 2.0 genome. Additionally, we used specific gRNAs (GGTA1: 5′-GCTGCTTGTCTCAACTGTAA-3′, CMAH: 5′-GAAGCTGCCAATCTCAAGGA-3′, B4GALTN2: 5′-GATGCCCGAAGGCGTCACAT-3′) to target GGTA1, CMAH, and B4GALNT2, respectively.

[0408] Cell Culture

[0409] Porcine fetal fibroblasts and fibroblast FFF3 were maintained in Dulbecco's Modified Eagle Medium (DMEM, Invitrogen) high glucose and sodium pyruvate, which was supplemented with 15% fetal bovine serum (Invitrogen), 1% penicillin / streptomycin (Pen / Strep, Invitrogen), and 1% HEPES (Thermo Fisher Scientific). All cells were kept in a humidified tri-gas incubator at 38 °C and 5% CO2, 90% N2, and 5% O2.

[0410] Fresh porcine umbilical vein endothelial cells (PUVEC) were isolated from the umbilical vein and cultured in PriGrow II medium (abm) supplemented with 10% fetal bovine serum (Gibco), 1% penicillin / streptomycin (Pen / Strep, Invitrogen), and 1% HEPES (Thermo Fisher Scientific). Human umbilical vein endothelial cells (HUVEC, ATCC, PCS-100-010) were cultured in vascular cell basal medium (ATCC) supplemented with endothelial cell growth kit-BBE (ECG kit, ATCC). The human NK-92 cell line was cultured in minimum essential medium α (α-MEM, Gibco) supplemented with 12.5% fetal bovine serum (Gibco), 12.5% fetal equine serum (FES, Solarbio), and 1% penicillin / streptomycin (Pen / Strep, Invitrogen). The human macrophage cell line THP-1 was cultured in RPMI 1640 (BI) supplemented with 10% fetal bovine serum (Gibco) and 1% penicillin / streptomycin (Pen / Strep, Invitrogen). Differentiation of THP-1 cells was achieved in 62.5 nM phorbol 12-myristate 13-acetate (PMA, Sigma) over 3 days and confirmed by attaching these cells to tissue culture plastic.

[0411] PiggyBac-Cas9 / 2gRNA construction and cell line establishment

[0412] Similar to the previously described procedure (Yang 2015), we synthesized a DNA fragment encoding U6-gRNA1-U6-gRNA2 (Genewiz) and incorporated it into the previously constructed PiggyBac-cas9 plasmid. To establish the FFF3 cell line with PiggyBac-Cas9 / 2gRNA integration, we used the Neon transfection system and transfected 5×105 FFF3 cells with 14.3 μg of PiggyBac-Cas9 / 2gRNA plasmid and 5.7 μg of Super PiggyBac transposase plasmid (System Biosciences) according to the instructions provided by the vendor (Thermo Fisher Scientific). To select cells carrying the integrated construct, 2 μg / mL puromycin was applied to the transfected cells. Based on the negative control of applying puromycin to wild-type FFF3 cells, we determined that puromycin selection was completed within 4 days. Thereafter, the FFF3-PiggyBac cell line was maintained with 2 μg / mL puromycin, and 2 μg / ml doxycycline was applied to induce Cas9 expression in the doxycycline-inducible FFF3-PiggyBac cell line for one week.

[0413] To avoid constitutive Cas9 expression in the FFF3 cell line, we performed PiggyBac-Cas9 / 2gRNA excision from the FFF3 genome by transfecting 5×105 cells with 3 μg of the PiggyBac-only transposase vector using Lipofectamine 2000 reagent only to excise the transposase. Then, the FFF3 cells with PiggyBac-Cas9 / 2gRNA excision were sorted into 96-well plates by single cell and subjected to clonal growth and genotyping.

[0414] Genotyping of single cells and single cell clones

[0415] First, the FFF3-PiggyBac-Cas9 / 2gRNA cell line was subjected to puromycin selection, followed by PiggyBac excision. The cells were then sorted into single cells, placed into 96-well PCR plates for direct genotyping, and into 96-well cell culture plates for colony growth. To genotype single FF cells without clonal expansion, we directly amplified the PERV locus from sorted single cells. We also genotyped clones grown from sorted single cells. The genotyping procedure was based on the method of Yang et al. (6). Briefly, we sorted single cells into 96-well PCR plates, where each well contained 5 μl of lysis mixture, which consisted of 0.5 μl of 10×KAPA Express Extract Buffer (KAPA Biosystems), 0.1 μl of 1 U / μl KAPA Express Extract Enzyme, and 4.4 μl of water. We incubated the lysis reaction at 75 °C for 15 min and inactivated the reaction at 95 °C for 5 min. Then all reactions were added to a 20 μl PCR reaction containing 1×KAPA 2Gfast (KAPA Biosystems) and 0.2 μM PERV Illumina primers (Method Table 2). The reaction was incubated at 95 °C for 3 min, followed by 30 cycles (for single cells) or 25 cycles (for single cell clones) as follows: 95 °C, 20 s; 59 °C, 20 s and 72 °C, 10 s. To add Illumina sequence adapters, 3 μl of the reaction product was then added to a 20 μl PCR mixture containing 1×KAPA 2G fast (KAPA Biosystems) and 0.3 μM primers carrying Illumina sequence adapters. The reaction was incubated at 95 °C for 3 min, followed by 20 cycles (for single cells) or 10 cycles (for single cell clones) as follows: 95 °C, 20 s; 59 °C, 20 s and 72 °C, 10 s. The PCR products were examined on a 2% EX gel (Invitrogen), and the ~360 bp target products were then recovered from the gel. These products were then mixed in roughly equal amounts, purified (QIAquick Gel Extraction Kit), and sequenced using a MiSeq Personal Sequencer (Illumina). Then, we analyzed the deep sequencing data and used CRISPR-GA to determine the PERV editing efficiency (5).

[0416] Primers used in PERV pol genotyping

[0417] Illumina_PERV_pol forward: 5′-ACACTCTTTCCCTACACGACGCTCTTCCGATCTCGACTGCCCCAAGGGTTCAA-3′

[0418] Illumina_PERV_pol reverse: 5'-GTGACTGGAGTTCAGACGTGTGCTCTT℃CGAICTTCTCTCCTGCAAATCTGGGCC-3′

[0419] Somatic cell microinjection to generate SCNT embryos and embryo transfer for pig cloning

[0420] The somatic cell microinjection procedure was based on Wei et al. All animal experiments were conducted with the approval of the Animal Care Committee of Yunnan Agricultural University, China. Unless otherwise stated, all chemicals were purchased from Sigma Chemical Co. (St. Louis, MO, USA). Pig ovaries were collected from Hongteng Slaughterhouse (Chenggong Ruide Food Co., Ltd, Kunming, Yunnan Province, China). The ovaries were transported to the laboratory at 25 °C to 30 °C in 0.9% (w / v) NaCl solution supplemented with 75 mg / mL potassium penicillin G and 50 mg / mL streptomycin sulfate. Cumulus cell-oocyte complexes (COCs) were isolated from follicles with diameters of 3 - 6 mm and then cultured at 38.5 °C in a humidified atmosphere with 5% CO2 (APC-30D, ASTEC, Japan) in 200 μL of TCM-199 medium supplemented with 0.1 mg / mL pyruvate, 0.1 mg / mL L-cysteine hydrochloride monohydrate, 10 ng / mL epidermal growth factor, 10% (v / v) porcine follicular fluid, 75 mg / mL potassium penicillin G, 50 mg / mL streptomycin sulfate, and 10 IU / mL eCG and hCG (Teikoku Zouki Co., Tokyo, Japan). After 38 to 42 hours of in vitro maturation, the expanded cumulus cells in the COCs were removed by repeatedly aspirating the COCs in 0.1% (w / v) hyaluronidase.

[0421] SCNT was performed as previously described. Briefly, oocytes extruding the first polar body with an intact membrane were cultured in NCSU23 medium supplemented with 0.1 mg / mL colchicine, 0.05 M sucrose, and 4 mg / mL bovine serum albumin (BSA) for 0.5 to 1 hour for nuclear protrusion. Then, in the presence of 0.1 mg / mL colchicine and 5 mg / mL cytochalasin B, in Tyrode's lactate medium supplemented with 10 μM N-(2-hydroxyethyl)piperazine-N'-ethanesulfonic acid (HEPES), 0.3% (w / v) polyvinylpyrrolidone, and 10% FBS, the protruding nucleus together with the polar body was removed by using an beveled pipette (with a diameter of approximately 20 μm). WT or PERV-free fibroblasts were used as nuclear donors. A single donor cell was injected into the perivitelline space of the enucleated oocyte.

[0422] In a fusion medium containing 0.25 M D-sorbitol, 0.05 mM Mg(C2H3O2)2, 20 mg / mL BSA, and 0.5 mM HEPES (free acid), donor cells were fused with recipient cytoplasm using an embryo cell fusion system (ET3, Fujihira Industry Co., Ltd., Tokyo, Japan) with a single DC pulse of 200 V / mm for 20 μs. The reconstructed embryos were cultured in PZM-3 solution (van't Veer 1997) for 2 hours to allow nuclear reprogramming, and then activated with a single pulse of 150 V / mm for 100 μs in an activation medium containing 0.25 M D-sorbitol, 0.01 mM Ca(C2H3O2)2, 0.05 mM Mg(C2H3O2)2, and 0.1 mg / mL BSA. Then, the activated embryos were cultured in a humidified atmosphere with 5% CO2, 5% O2, and 90% N2 (APM-30D for further activation, ASTEC, Japan) in PZM-3 supplemented with 5 mg / mL cytochalasin B at 38.5 °C for 2 hours. Then the reconstructed embryos were transferred to fresh PZM-3 medium and cultured at 38.5 °C in humidified air with 5% CO2, 5% O2, and 90% N2 for 2 days and 7 days, respectively, to examine the cleavage and blastocyst development rates.

[0423] Crossbred (Large White / Landrace Duroc) sows with one parturition history were used as surrogate mothers for the constructed embryos. They were checked for estrus at 9:00 am and 6:00 pm every day. SCNT embryos cultured for 6 hours after activation were surgically transferred into the oviducts of the surrogates. Pregnancy was checked using an ultrasonic scanner (HS-101V, Honda Electronics Co., Ltd., Yamazuka, Japan) 23 days after embryo transfer.

[0424] Characterize protein expression by immunofluorescence

[0425] Immunofluorescence was performed on cryosections of neonatal (3 - 6 days old) porcine kidneys from WT, Pig 2.0, and Pig 3.0 to characterize gene modifications (3KO and 9TG) at the tissue level. The cryosections were fixed with ice-cold acetone, blocked, and then stained using one-step direct immunofluorescence technique or two-step indirect immunofluorescence technique. The primary and secondary antibodies used are summarized in Supplementary Table 2. Nuclear staining was performed using ProLong Gold DAPI (Thermo Fisher, P36931). The sections were imaged using a Leica fluorescence microscope and analyzed using ImageJ software. All the photos were taken under the same conditions to allow proper comparison of the fluorescence intensities among the WT, Pig 2.0, and Pig 3.0 cryosections.

[0426] Binding of human antibodies to porcine endothelial cells

[0427] As previously described (Xenotransplantation, Methods and Protocols, edited by Costa, Cristina, Rafael, ISBN 978-1-61779-845-0), antibody binding of human IgG and IgM antibodies to porcine and human endothelial cells was evaluated by flow cytometry. Briefly, porcine 2.0, porcine 3.0, WT PUVEC, and HUVEC were collected, washed twice, and resuspended in staining buffer (PBS containing 1% BSA). Normal human male AB serum (Innovative Research, IPLA-SERAB-H26227) was heat-inactivated at 56 °C for 30 min and diluted 1:4 in staining buffer. Porcine 2.0, porcine 3.0, WT PUVEC, and HUVEC (1 × 105 cells per test) were incubated with the diluted human serum at 37 °C for 30 min. n . The cells were then washed with cold staining buffer and incubated with goat anti-human IgG Alexa Fluor488 (Invitrogen, A11013, diluted 1:200) and goat anti-human IgM Alexa Fluor 647 (Invitrogen, A21249, diluted 1:200) at 4 °C for 30 min. After washing with cold staining buffer, the cells were resuspended in staining buffer containing 7-AAD (BD, 559925, diluted 1:100) to include dead / live gating. Fluorescence was acquired on a Cy t oFLEX S flow cytometer, and the data were analyzed using FlowJo analysis software. For each sample, 5,000 events were collected in the live cell gate and plotted as the specific median fluorescence intensity (MFI) generated by "test MFI (IgG or IgM) - control (secondary antibody only) MFI".

[0428] Human complement cytotoxicity assay

[0429] Porcine 2.0, porcine 3.0, WT PUVEC, and HUVEC were harvested, washed twice with PBS, and resuspended in serum-free medium. The cells (1x10 per test) 5Cells) were incubated with an aliquot of human serum complement (Quidel, A113) at different concentrations (0%, 25%, 50% and 75%) for 45 min at 37 °C and 5% CO2. After that, the cells were stained with propidium iodide (Invitrogen, P3566, 1:500 dilution) for 5 min and analyzed using a CytoFLEX S flow cytometer. 5,000 events were collected for each sample and the percentage of PI-positive cells was used as the percentage of cell death mediated by human complement.

[0430] NK cytotoxicity assay

[0431] PUVEC and HUVEC were used as target cells and labeled with anti-pig CD31-FITC antibody (Bio-Rad) and anti-human CD31-FITC antibody (BD), respectively. Meanwhile, human NK 92 cells were used as effector cells and labeled with anti-human CD56-APC antibody (eBioscience). Effector (E) and target cells (T) were co-cultured at an E / T ratio of 3 at 37 °C and 5% CO2 for 4 h. The cells were stained with propidium iodide for 5 min and then subjected to FACS analysis. The percentage of PI-positive cells in the CD31+ gate was used to calculate the percentage of target cells killed.

[0432] Phagocytosis assay

[0433] Differentiation of the human macrophage cell line THP-1 was achieved by 62.5 μM phorbol 12-myristate 13-acetate (PMA) for 3 days and confirmed by attaching these cells to tissue culture plastic. Porcine splenocytes (target cells) were stained with the fluorescent dye 5 / 6-CFSE (Molecular Probes) according to the manufacturer's protocol. CFSE-labeled target cells were incubated with human-differentiated THP-1 cells (effector cells) at E / T ratios of 1:1 and 1:5 at 37 °C for 4 h. Macrophages were counterstained with anti-human CD11b antibody and phagocytosis of CFSE-labeled targets was measured by FACS. Phagocytic activity was calculated as described previously (Ide 2007).

[0434] CD39 biochemical ADPase assay

[0435] One day before the assay, pigs 2.0, pigs 3.0, and WT PUVEC and HUVEC were seeded at 2 × 104 per well in 96-well plates. The cells were incubated with 500 μM ADP (Chrono-Log Corp, #384) at 37 °C and 5% CO2 for 30 min. Malachite green (Sigma, MAK307) was added to terminate the reaction and absorbance was measured at 630 nm to determine the level of phosphate production relative to a standard curve of KH2PO4.

[0436] TFPI Activity and Human Factor Xa Binding Assay

[0437] Before the assay, cells were treated with 1 μM PMA for 6 h to induce hTFPI expression on the cell surface of porcine 2.0 and porcine 3.0 PUVEC. Then TFPI activity and human factor Xa binding assay were performed as previously described (Xenotransplantation, Methods and Protocols, edited by Costa, Cristina, Rafael, ISBN 978 - 1 - 61779 - 845 - 0). All assays were performed in quadruplicate.

[0438] TAT Formation Assay

[0439] Porcine 2.0, porcine 3.0, as well as WT PUVEC and HUVEC were seeded at 3×105 per well in 6 - well plates. After 1 day, the cells were incubated with 1 mL of fresh human whole blood (containing 0.5 U / mL heparin) at 37 °C under gentle shaking. At different indicated time points, blood was drawn and plasma was isolated from it. The TAT content in plasma was measured by using a thrombin - antithrombin complex human ELISA kit (Abcam, ab108907).

[0440] Variant Calling from Whole - Genome Sequencing Data

[0441] Paired reads were mapped to the Sus scrofa 11.1 genome (ftp: / / ftp.ensembl.org / pub / release - 91 / fasta / sus_scrofa / dna / ) by BWA (v0.7.17 - r1188). Variants (SNPs and INDELs) were called using GATK (v4.0.7.0) following the GATK best practices recommendations with standard filters plus a requirement for a minimum depth of 10.

[0442] In - silico Prediction of On - target / Off - target Sites

[0443] CRISPRSeek (v1.22.1) in R (v3.5.0) allowing up to 6 mismatches was used to predict on - target and off - target sites across the genome. The input genome was Sus scrofa 11.1 (ftp: / / ftp.ensembl.org / pub / release - 91 / fasta / sus_scrofa / dna / ).

[0444] Off - target Calling from Whole - Genome Sequencing Data

[0445] GATK filtered variants that fall within 20 bp flanking the predicted off-target PAM sites by CRISPRSeek (v1.22.1) are called potential off-target modifications. When parental line WGS data is available, variants with allele frequencies significantly deviating from the parental line by more than or less than 0.5 are filtered out using an in-house developed statistical test. This test assumes that the chance of both alleles being modified simultaneously is extremely low since off-target mutations are rare events.

[0446] Functional impact analysis of mutations

[0447] Regardless of whether the variant is an off-target mutation or a germline mutation, sequence changes at the transcriptional level and amino acid changes at the protein level should be annotated to assess their potential functional impact using VEP (Variant Effect Predictor, v93.3). High-impact mutations should be specifically selected if they cause frameshifts, start gain / loss, stop gain / loss, splice donor / acceptor shifts, or splice region changes. Whenever possible, mutations will be annotated to indicate whether they affect the principal or alternative transcripts using the APPRIS database.

[0448] Transcriptional analysis from RNA-Seq

[0449] In splicing-aware mode, RNA-Seq reads are aligned to the Sus scrofa 11.1 genome using STAR (v2.6.1a). Both the porcine transcriptome and the transgene are used as input transcripts, and expression levels are quantified as TPM (transcripts per million) using Salmon (v0.11.3).

[0450] PERV knockout efficiency analysis by Amplicon-Seq

[0451] After trimming low-quality bases at the 3′ end below Q20, paired reads are merged into fragments if their overlap exceeds 100 bases. The merged fragments are further scanned for hard-masked low-quality bases below Q20 and aligned to the PERV amplicon target sequence in splicing-aware mode using STAR (v2.6.1a). Then, the output BAM file is analyzed by an in-house R script (v3.5.0) to parse the alignment patterns, evaluate the distribution of INDELs in the PERV amplicon target sequence (relative to the catalytic center), and derive the knockout efficiency.

[0452] PERV knockout efficiency analysis by Capture-Seq

[0453] First, paired reads were aligned to the PERV target sequences using STAR (v2.6.1a) in splice-aware mode, and then duplicate removal based on alignment positions was performed by Picard (v2.18.14). Then, the deduplicated paired reads were merged into fragments by an in-house script. Then, in splice-aware mode, the merged fragments were realigned to the PERV capture target sequences using STAR (v2.6.1a). Then, the output BAM file was analyzed by an in-house R script (v3.5.0) to digest the alignment patterns, evaluate the distribution of INDELs in the capture target sequences, and derive the knockout efficiency.

[0454] PERV Haplotype Analysis by Capture-Seq

[0455] First, paired reads were aligned to the PERV target sequences using STAR (v2.6.1a) in splice-aware mode. Somatic variants were called using Mutect2 (v4.1.2.0), and variants with a minor allele frequency greater than a given threshold (MAF > 0.01) were filtered out. The filtered variants from multiple samples were merged to obtain a set of variant sites for haplotyping. Next, the correctly aligned paired reads were merged into fragments by an in-house script. Then, in splice-aware mode, the merged fragments were realigned to the PERV target sequences using STAR (v2.6.1a). For each fragment covering the target region, we extracted alleles to collect variant sites to define the haplotype of the fragment. Finally, the distribution of haplotypes was derived by counting all fragments covering the target region.

[0456] Identifying Payload Integration Sites Using Whole-Genome Sequencing Data

[0457] In splice-aware mode, paired reads were aligned to a reference library consisting of the Sus scrofa 11.1 genome, PERV haplotypes, and payload plasmid sequences using STAR (v2.6.1a). Structural variants (SVs) were called from the BAM file using Lumpy (v0.2.13) to detect DNA fusion points. Next, we screened for SVs that bridged the porcine genome and payload sequences with mismatched reads at the integration sites.

[0458] Statistical Analysis

[0459] All statistical analyses were performed using R (v3.5.0) and Excel (v2016). Unless otherwise specified, a p-value < 0.05 was considered significant. When multiple tests were involved simultaneously, p-value correction was performed following the Benjamini-Hochberg procedure to control the overall false discovery rate (FDR). Unless otherwise specified, FDR < 0.05 was generally used.

[0460] Example 10: Immunocompatible Porcine Liver Perfused with Human Blood

[0461] Liver perfusion experiments were performed using immunocompatible porcine livers isolated from pigs 2.0 (4 - 7; 3KO + 12TG) as an alternative experiment for xenotransplantation to analyze organ function. Wild - type livers and 4 - 7 livers (approximately 80 kg) were isolated from 12 - month - old pigs. The livers were perfused with human whole blood and human fresh frozen plasma (FFP). Table 1 outlines the brief liver perfusion protocol.

[0462] Table 1

[0463]

[0464]

[0465] Bile was collected from the livers at different time points and analyzed. As Figure 28 shown, compared with WT livers, the total bile production in 4 - 7 livers increased by approximately 2 - fold. In addition, 4 - 7 livers showed stable serum levels of metabolic enzymes, which are markers of liver damage, including alanine aminotransferase (ALT), aspartate aminotransferase (AST), and albumin (ALB) ( Figure 29 A - Figure 29 C). In addition, 4 - 7 livers showed stable serum electrolyte levels, including potassium (K) and sodium (Na) ( Figure 29 D - Figure 29 E). The complement (C3) expression of 4 - 7 and WT livers was also tested, and the complement (C3) expression in 4 - 7 livers persisted at higher and more stable levels compared with WT livers ( Figure 29 F). When analyzing coagulation, 4 - 7 livers showed stable prothrombin time (PT) and international normalized ratio (PT - NIR), fibrinogen level (FIB), and lower activated partial thromboplastin time (APTT) ( Figure 30 A - Figure 30 D). Taken together, these data indicate that 4 - 7 livers have improved liver function.

[0466] Example 11: Porcine to Non-Human Primate (NHP) Kidney Transplantation

[0467] Prior to 2014, the longest porcine-to-nonhuman primate (NHP) kidney xenograft was 90 days, and graft survival >30 days was highly unusual. The recent advances in induction and maintenance immunosuppressive regimens, combined with the increased availability of genetically modified donor pigs with targeted host innate and adaptive immune responses, have led to graft survival extended to >125 days (Higginbotham 2015, Iwase 2015b). Further genetic engineering to compensate for molecular incompatibilities in immune, coagulation, complement, and inflammatory response pathways is beginning to advance the field of xenotransplantation. Despite genetic modification to produce GTKO and overexpress one hCRP, coagulation dysfunction (including thrombotic microangiopathy and systemic consumptive coagulopathy) persists, primarily due to molecular incompatibilities between pigs and NHPs.

[0468] Preclinical kidney transplantation studies. For preclinical kidney transplantation studies, safety and efficacy studies will be conducted in NHPs. For safety and efficacy examinations, kidneys from 2.0 donors of 8- to 10-week-old pigs will be transplanted into NHP (cynomolgus monkey) recipients, who will undergo bilateral nephrectomy at the time of transplantation. Xenograft function will be monitored by serum creatinine values, complete blood counts, and urine protein analysis, as well as a series of biopsies and examinations of body weight and overall health status. Immunosuppression will consist of clinically relevant reagents, the combination and intensity of which are acceptable in allotransplantation. These will include the use of steroids, anti-NHP thymocyte globulin, anti-CD20 induction therapy, and the use of steroids, anti-CD40, MMF, and rapamycin for maintenance immunosuppression. Prophylactic antiviral, antibacterial, and anticoagulant therapies will be administered, and supplemental Epogen will be given as needed based on hematocrit levels.

[0469] Six months of well-functioning xenograft survival is expected to provide sufficient evidence of efficacy, as indicated by normal creatinine and the absence or low levels of proteinuria, as well as biopsies without antibody- or cell-mediated acute injury.

[0470] By analogy with allotransplantation, the period of greatest risk for preformed antibody-mediated injury is expected to be in the first few weeks after transplantation, and acute cell-mediated rejection is most likely to occur within the first three months after transplantation, after which the risk gradually decreases (Cowan 2014).

[0471] Allograft rejection. According to the draft guidance “Source Animal, Product, Preclinical, and Clinical Issues Concerning the Use of Xenotransplantation Products in Humans” revised in December 2016 (FDA 2016), there is a possibility that rejection of a xenotransplantation product may render the recipient susceptible to rejection of a subsequent xenotransplantation product or allograft (section IX.C.1.g).

[0472] In preclinical models, in vitro antibody reactivity and mixed lymphocyte reaction (MLR) assays will be used to demonstrate the lack of reactivity after xenotransplantation. To test for possible cross-reactivity between the response to a xenograft and the response to a subsequent allograft, flow cytometry cross-matching will be performed using serum from male NHPs that received kidney grafts from normal pigs and pig donor 2.0 as described above. The reactivity of the serum to lymphocytes from a panel of NHP donors as well as to lymphocytes from pig donors will be tested. Reactivity to pig cells will confirm that a xenosensitization event has occurred by an increase in anti-pig antibody levels. Samples from pre-transplant NHPs (first experiment) will be compared to samples after rejection to assess changes in antibody binding to the panel of NHP lymphocytes. At the same time, the direct and indirect T cell responses of pre- and post-transplant (after rejection) NHP recipients to a panel of allogeneic stimulators will be evaluated to determine if cell-mediated alloreactivity is enhanced after xenograft rejection (Baertschiger 2004, Cooper 2004, Ye 1995).

[0473] At least low levels of cross-reactivity are expected to be observed between xenogeneic and allogeneic responses. However, these results should be considered in the proposed trials. For the kidney trial, transplantation is planned for highly sensitized patients who are unable to receive transplantation due to the inability to identify a suitable match. Moderate additional sensitization is unlikely to alter the likelihood of the opportunity to receive a subsequent allograft. In addition, T cell sensitization has not been identified as a significant barrier to re-transplantation and may therefore not be clinically monitored (Baertschiger 2004, Cooper 2015). Therefore, xenogeneic cell-mediated sensitization does not appear likely to impede allograft survival.

[0474] Biodistribution. The migration of donor cells to distal tissues / organs in the recipient remains a possible outcome of xenotransplantation. Chimera studies have shown that this may actually increase the success rate of transplantation and reduce the likelihood of rejection (Starzl 1993, Vagefi 2015). However, the migration of porcine donor cells may have unknown consequences, and thus strategies have been developed to determine whether cell migration occurs. Biodistribution is studied as part of porcine-NHP xenotransplantation research according to the principles outlined in FDA guidance documents, including Source Animal, Product, Preclinical, and Clinical Issues Concerning the Use of Xenotransplantation Products in Humans, December 2016 (Section IX.C.5; FDA December 2016), Gene Therapy Clinical Trials - Observing Subjects for Delayed Adverse Events, November 2016 (Section IV.B.2; FDA November 2016), and Preclinical Assessment of Investigational Cellular and Gene Therapy Products, November 2013 (Section V.C.5; FDA 2013).

[0475] Oncogenicity. All animals included in SCNT and assisted reproductive facilities will be routinely monitored for evidence of tumorigenesis. All animals found moribund or dead will undergo a complete necropsy and gross and microscopic pathological examination by a veterinary pathologist. Records of the health and pathology of all genetically engineered animals will be maintained and compiled to determine the risk of oncogenic potential due to specific or unanticipated genetic modifications.

[0476] Example 12: Porcine to Human Kidney Transplantation

[0477] Renal xenotransplantation has been studied for decades, and porcine xenografts have been evaluated in early clinical trials (Starzl 1964). The challenge is to make the xenotransplantation procedure provide clinical benefits equivalent to allograft survival.

[0478] Clinical study design. The proposed clinical study population will include transplant patients aged 18 - 65 years with end-stage renal disease who are unlikely to find a suitable kidney donor in a timely manner due to the presence of high levels of panel reactive anti-HLA antibodies (PRA). High PRA poses a significant challenge in matching suitable deceased or living donors, resulting in extended waiting times for transplantation and increased morbidity due to additional years of hemodialysis. Despite the allocation of priority on the waiting list, >90% of PRA patients still experience significantly longer waiting times compared to less sensitive patients. Subjects with >90% PRA sensitization against HLA antigens and a negative flow crossmatch with porcine donor lymphocytes (or endothelial cells) will be targeted.

[0479] Patients will receive a porcine donor kidney weighing 120 ± 10 grams, which provides an estimated glomerular filtration rate (GFR) of 40 - 50 mL / min / 1.73m 2 ². A single porcine kidney from a 9 - to 12-month-old donor will be transplanted into the right or left iliac fossa in the same manner as used for allogeneic kidney transplantation. The primary endpoint will be freedom from hemodialysis for one year after transplantation. Patients will be evaluated by serial blood tests for creatinine levels, urinary protein, and calculation of GFR using the MDRD equation: GFR (mL / min / 1.73m 2 ) = 175 × (Scr) -1.154 ⁻¹.¹⁵⁴ × (age) -0.203 ⁻⁰.²⁰³ × (if female, 0.742) × (if African American, 1.212). Protocol-specified graft biopsies will be performed every three months and for reasons based on a >20% rise in creatinine from baseline, defined as the mean of the best three consecutive creatinine measurements in the first month after transplantation, or urinary protein greater than 300 mg / day. Safety measurements will include monitoring of coagulation parameters, clinical chemistry, hematology, and exogenous infections.

[0480] Organs for porcine - to - human kidney transplantation. Data indicate that porcine kidneys exhibit a similar functional potency to human kidneys by kidney weight, thus allowing kidney transplantation based on graft and recipient weights comparable to those used clinically for allografts. In humans, allogeneic kidney graft transplantation is performed within a wide range of kidney weight to recipient weight. On average, adult male kidney weight is 125 - 170 grams, and adult female kidney weight is 115 - 155 grams (Boron 2003). When considering the upper limit of drug administration in terms of the ratio of kidney weight to recipient weight, there is no evidence that an excess of renal function is harmful in any way. Instead, the upper limit of transplantable kidney mass is limited by technical issues. For example, a single adult kidney that can be successfully transplanted into a 10 kg infant is equivalent to 12 - 17 grams of kidney / kg, which is approximately 3 - 4 times the renal mass ratio of the average adult (3 - 4 grams of kidney / kg; Donati - Bourne 2014). This upper limit of the graft weight to recipient weight ratio is relevant to the pre - clinical studies proposed below. In experimental pre - clinical studies, 50 - 75 gram kidneys from 8 - to 10 - week - old porcine donors will be transplanted into 5 - 12 kg NHP recipients (approximately 10 grams of kidney / kg).

[0481] Glomerular filtration rate (GFR; mL / min / 1.73m2) is a standard measure of renal function or kidney potency and is used to stage the progression of chronic kidney disease (CKD) and renal failure in patients eligible for dialysis and / or transplantation. When determining the lower limit of drug administration in terms of kidney weight to recipient weight, the goal is to achieve a GFR of 45 - 60 mL / min / 1.73m 2 2 (stage CKD 3A; Levey 2011). This target range of GFR is based on data indicating that renal function in CKD 3A is comparable and stable to that achieved by single - kidney allograft transplantation in humans, while the lower GFR in CKD 3B (GFR 30 - 45 mL / min / 1.73m 2 ) is associated with end - stage renal disease and increased all - cause and cardiovascular disease mortality (Sharma 2010). The target GFR range of 45 - 60 mL / min / 1.73m 2 is comparable to the GFR range achieved by single - kidney allograft transplantation in humans (50 - 65 mL / min / 1.73m 2 ; Gourishankar 2003, Marcén 2010).

[0482] Given the comparability of human and porcine kidneys in terms of GFR per kidney mass, this would require that the xenotransplanted kidney mass be comparable to the kidney mass (115 - 170 grams) routinely used in allotransplantation. It should be considered that partial renal function may be lost during donation and after transplantation due to nephrotoxic immunosuppressive treatment in the form of calcineurin inhibitors in the recipient.

[0483] Pharmacology and toxicology information. Pharmacological studies will be used to evaluate efficacy and safety in both rodent and NHP models. A variety of comprehensive safety endpoints will be used, as well as the assessment of clinical pathology and pathophysiology in genetically engineered donor pig tissues. A tiered approach will be taken, which involves in vitro cell and tissue function, as well as the assessment of clinical pathology and histopathology in donor pigs and NHP xenografts. Endpoints will include graft function and rejection, as well as recipient safety related to innate and adaptive immunity, inflammation, and the complement and coagulation cascades.

[0484] Somatic cell nuclear transfer and assisted reproduction in genetically engineered donor pigs. For safety considerations, genetically engineered donor pigs will be regularly monitored by full clinical pathology (including clinical chemistry and hematology as well as gross and microscopic histopathology). The reproductive capacity, embryo - fetal development, organ and tissue development, and potential tumorigenesis of all donor pigs within the breeding colony will be monitored and recorded.

[0485] Animals are identified by unique ear tags printed with permanent ink (placed at the place of origin). The flow of pigs includes quarantine areas, which are open - air communal pens with shavings bedding. The feed troughs are wooden and kept clean, free of debris and waste. Fresh water for free choice is available at all times via nipple drinkers. The pens rely on outdoor wind movement to circulate air, and the temperature is maintained above 10°C. Biosafety requires at least 24 - hour isolation from other pigs, specific pen clothing, and soaking boots in disinfectant before and after entering the pen. The quarantine period includes 35 - 40 days of isolation, vaccination with Parvo Shield L5E, FluSure XP / ER Bac Plus, Ingelvac FLEX combination (porcine circovirus and mycoplasma hyopneumoniae), and Dectomax, and includes 2 blood draws showing no increase in disease antibodies (PRRSV, PRRSX3). After clearance from the quarantine area, the pigs are transferred to the buffer zone of the facility. This area is an enclosed communal pen with sawdust bedding, with a maximum of 12 pigs per group. The bedding is changed weekly. The temperature is controlled within the range of 15 - 24°C by fans and propane heaters controlled by a thermostat. The pigs are fed from stainless - steel troughs, and fresh water for free choice is available at all times via nipple drinkers. The pigs are observed at least once a day and as indicated by their health status.

[0486] Pig pens where health problems are observed are housed in individual barns for personalized care and attention and are handled under the guidance of the attending veterinarian and the director of embryology. Biosecurity requires at least 24 hours of non-contact with other pig groups. Before and after entering the pens, the coveralls and boots used only in the pen area are disinfected with Virkon-S or Synergize. The production of source donor pigs for clinical research will follow all relevant guidelines and regulations.

[0487] Verification of genetic engineering. Endogenous gene KO and human transgene expression will be verified at the genomic, mRNA, and protein levels. For gene KO, Sanger sequencing or deep sequencing will be performed to confirm gene mutations at the expected target sites. Secondly, RNA-seq and / or RT-PCR will be performed to ensure that the mRNA contains the expected mutations and is subject to nonsense-mediated decay. RT assays will be performed to show the elimination of RT activity in PERV KO cells. In addition, immunohistochemistry (IHC) staining and / or flow cytometry will be performed to ensure the absence of gene products in or on the cell surface.

[0488] Despite the progress in the field of precise gene editing, off-target mutations may still exist, and it is necessary to understand such off-target mutations in order to produce safe and effective donor organs for clinical xenotransplantation. To identify potential off-target effects of CRISPR-Cas9 gene editing, the following multi-layered assessment method has been adopted:

[0489] 1. Karyotype of modified cell clones to determine chromosomal structural integrity;

[0490] 2. CIRCLE-Seq: A sensitive in vitro screening strategy that comprehensively detects genome-wide CRISPR-Cas9 off-target mutations for any given gRNA. Potential off-target sites will be reviewed in any derived cell line from a specific gRNA using subsequent targeted amplicon sequencing;

[0491] 3. Whole-genome sequencing (WGS): Used to examine single-point mutations and small structural variations in genetically engineered cell lines or pigs. Table 2 lists the resolution and sensitivity of the detection methods employed.

[0492] Table 2

[0493]

[0494] For transgene expression, the integrity and expression of human transgenes will be verified at the genomic, mRNA, and protein levels using sequencing, RT-PCR / RNA-seq, and IHC / flow cytometry techniques. In addition, the location of random transgene integration will be determined by inverse PCR-based junction capture, and the results will be verified by junction PCR.

[0495] The following clones will be selected: where the single-copy transgene is integrated into the intergenic region at least 10,000 bp away from any known gene and ncRNA, and at least 50,000 bp away from any oncogene and tumor suppressor. For site-specific integration and endogenous gene humanization, bi-allelic site-specific integration / replacement will be verified by ligase chain reaction and droplet digital PCR (ddPCR).

[0496] Example 13: Non-human primate (NHP) kidney transplantation

[0497] Preclinical transplantation studies. For preclinical transplantation studies, safety and efficacy studies were conducted in NHPs. Hearts, kidneys, and livers from 8-10-week-old pig 2.0 donors were used for solid organ transplantation studies, and livers and lungs were used for perfused organ studies. Over a 5-month span, 15 organ transplants and 11 organ perfusions were performed. Specifically, 7 kidney transplants, 4 heart transplants, 4 liver transplants were performed, along with 4 liver perfusions and 7 lung perfusions, as summarized in Table 3.

[0498] Table 3

[0499]

[0500] The immunosuppression regimen for kidney transplantation consisted of clinically relevant reagents, the combination and strength of which were acceptable in allografts. Clinical monitoring included: abdominal ultrasound on days 2, 5, 7, 9, 12, and 14, and clinical laboratory tests (CBC, Chem 17, coagulation screening, serum) on days 2, 5, 7, 9, 12, and 14 and weekly.

[0501] The survival of transplanted kidneys from pig 2.0 donors and control pigs (GTKO.hCD55) was analyzed. Table 4 provides a summary of the results.

[0502] Table 4

[0503] Porcine ID Donor Strain Kidney Graft Survival (days) 33-7 GTKO.hCD55 15 (aCD40) 32-2 GTKO.hCD55 11 (aCD40) 53-5 GTKO.hCD55 76 (aCD40L) 53-1 GTKO.hCD55 93 (aCD40L) 1839 9 Survival > 190 (aCD40L) 1841 9 20 (aCD40L) 1844 9 72 (aCD40L) 1848 9 15 (aCD40L) 1850 9 6 (aCD40L) A10169 10M 2 (aCD40L) 9956 10M Survival > 30 (aCD40L)

[0504] The two longest surviving recipients of GTKO.hCD55 pig kidneys survived until day 76 and day 93, at which time they were euthanized due to renal failure and weight loss, respectively. Among the two, one was found to have thrombotic microangiopathy (TMA), chronic antibody-mediated rejection (AMR), and borderline T cell-mediated rejection (TCMR); while the other had C4d deposition but no histological evidence of obvious rejection. The remaining seven recipients received kidneys from Pig 2.0. In these pigs, the transduced human proteins that regulate immune responses or complement activation were expressed at high levels. The NHP recipients of these genetically modified pig kidneys survived >190, 72, 20, 15, and 6 days under an immunosuppressive regimen for kidney transplantation.

[0505] One recipient is currently doing well on day 190 of an immunosuppressive regimen for kidney transplantation, with normal kidney function (creatinine 0.6 mg / dl). Multiple biopsies have shown no evidence of rejection or TMA.

[0506] These data together indicate that long-term survival of kidney xenografts with triple xenoantigen KO is achieved under minimal maintenance immunosuppression, the xenografts having multiple transduction of human genes encoding regulatory proteins in the innate response and complement pathways, and without rejection or TMA.

[0507] Impaired health of the monkeys led to early termination of several xenotransplanted monkeys. Complications included transfusion, injection site abscesses and infections, and wound healing. Bladder and / or ureteral bleeding occurred in some cases, possibly due to excessive anticoagulation. Table 5 provides a summary of Pig 2.0 grafts.

[0508] Table 5

[0509]

[0510] Analysis of host monkeys that received kidneys isolated from payload 9 (A) and payload 10 (B) donor pigs for transplantation showed that the hosts exhibited stable serum creatinine levels ( Figure 32A and Figure 32B ). Several host monkeys also exhibited stable or restored hematocrit levels ( Figure 33A and Figure 33B ). Platelet counts were low in some host monkeys but had recovered in others ( Figure 34A and Figure 34B ). Fluctuations in WBC reflected the immunosuppressive regimen and infection events ( Figure 35A and Figure 35B ).

[0511] Heterotopic liver transplantation. Until recently, survival of pig-to-baboon orthotopic liver transplantation (OLTx) has been limited to 9 days. Administration of human coagulation factors extended survival to 25 days and 29 days in two GTKO liver recipients, but sustained survival remained uncertain.

[0512] Here, four pig-to-baboon OLTx were performed. The livers were from transgenic pigs with two gene constructs that lacked targets for xenoantibodies and contained human transgenes to address complement activation and innate immune cell function (Group 1: B1, B2; Group 2: B3, B4). Immunosuppression consisted of ATG, rituximab, corticosteroids, MMF, and aCD154. All recipients received KCentra infusions. Different from previous studies, splenectomy was not performed, and cobra venom factor and tacrolimus were omitted. B2 and B4 received continuous infusions of GpIIb / IIIa inhibitors. Graft function was evaluated with daily chemistries, lactate, CBC, INR, and weekly coagulation profiles.

[0513] Baboons B1, B2, and B4 successfully underwent OLTx with life-sustaining graft function. LFTs peaked in all baboons on POD1 and normalized between POD4 - 7 ( Figure 38 A- Figure 38 B). Each baboon developed thrombocytopenia, which spontaneously resolved starting on POD8 in B2 and on POD4 in B4 ( Figure 38 C). Transfusion requirements ( Figure 38 D) were less than historical experience. Coagulation factors were consumed immediately after OLTx and then produced at normal pig levels ( Figure 38 E- Figure 38 I). B1 was euthanized on POD8 due to respiratory failure secondary to volume overload and abdominal compartment syndrome. Liver biopsy showed focal ischemia, no rejection, and negative C4d ( Figure 38 A- Figure 38 B). B2 recovered uneventfully, and the biopsy on POD8 was normal. Development of hemoptysis and increased transfusion requirements necessitated euthanasia on POD14. Autopsy identified pulmonary hemorrhage. H&E staining of the liver showed diffuse sinusoidal neutrophilic infiltration, indicating infectious complications with rejection, B2 was C4 negative, and LFTs remained normal throughout ( Figure 38 C- Figure 38D). B3 developed intraoperative hypotension and hypoxemia after reperfusion and required euthanasia. Autopsy revealed diffuse pulmonary hemorrhage, while the liver was normal and the vasculature was patent. B4 recovered uneventfully. Only one postoperative blood transfusion was required. On POD7, the rise in Tbili and LFT prompted exploration, in which bile leak and hepatic artery thrombosis (HAT) were identified, requiring euthanasia. Biopsy showed focal subcapsular necrosis and negative C4d, and no evidence of rejection, consistent with HAT( Figure 38 E- Figure 38 F).

[0514] Together, these data on OLTx using the novel genetically modified porcine organs suggest reduced reperfusion injury, reduced RBC consumption, and survival without antibody-mediated rejection for the first time without splenectomy or CVF. The absence of significant rejection indicates that this porcine strain is suitable for further OLTx studies.

[0515] Hepatic xenoperfusion. Barriers to successful xenogeneic pig liver transplantation include hyperacute rejection by preformed xenogeneic antibodies, molecular incompatibilities leading to complement dysregulation, coagulation, and innate and adaptive immunity. Genetically modified pigs can circumvent these barriers, and rapid and effective models will be needed to evaluate the efficacy of different gene constructs. Here, preliminary results are reported for ex vivo liver xenoperfusion (EVLXP) using wild-type (WT) and genetically modified porcine livers perfused with human blood and plasma (hWB+P).

[0516] In brief, livers from pigs 2.0 (EG group, n = 3), WT (n = 2), and GTKO.hCD55 (n = 4) were studied. EVXLP was performed with fresh heparinized hWB+P at 37°C. Failure during EVXLP was defined as a reduction in blood flow due to increased vascular resistance, severe metabolic derangement, or severe necrosis. CBC, serum clinical chemistry, and blood gas analysis were performed. Tissue biopsies were stained with H+E and for deposition of IgG, IgM, and complement (C4d).

[0517] All groups showed progressive reduction in blood flow, with a corresponding rise in vascular resistance. Hemodynamic deterioration occurred earlier and progressed faster in WT and GTKO.CD55 compared to EG livers( Figure 39 A- Figure 39 B), and was associated with longer EG liver survival. The mean liver survival was 5 hours (range 5 - 7 hours) for WT, 4.5 hours (range 4 - 6 hours) for GTKO.CD55, and 13 hours (range 11 - 14 hours) in EG livers. In all groups, platelets and neutrophils rapidly decreased, with the greatest loss observed in WT, but the differences did not reach statistical significance( Figure 39C- Figure 39 D). The RBC count was maintained throughout perfusion for EG and was significantly higher than that in WT livers and trended higher than in GTKO.CD55( Figure 39 E).

[0518] EG liver biopsies showed preserved hepatic architecture based on H+E, with mild diffuse portal and sinusoidal inflammation( Figure 41 A). WT livers showed focal ischemic necrosis and congestion based on H+E Figure 41 E), with strong staining for IgM and IgG Figure 41 F- Figure 41 G) and C4d positive Figure 41 H). In contrast, EG livers showed diffuse mild sinusoidal IgG and IgM deposition Figure 41 B- Figure 41 C), with negative C4d Figure 41 D), which may indicate that reduced preformed antigen and improved complement regulation through increased expression of human complement regulatory proteins resulted in less injury.

[0519] Xenogeneic livers from transgenic pigs lacking xeno-specific antigens and containing humanized transgenes related to complement activation and immune cell function achieved significantly prolonged survival, as well as less severe platelet sequestration, maintained RBC quality, and reduced antibody and complement deposition compared to WT or GTKO.CD55 xenografts. This model is a useful tool for simulating porcine-to-human xenotransplantation and evaluating the efficacy of specific genetic modifications.

[0520] Lung xenoperfusion. Ex vivo lung perfusion with human blood is a standardized method for evaluating the impact of transgenic combinations. Results related to novel transgenic pig lines evaluated in the context of a reference group are reported here.

[0521] In brief, eight pairs of lungs from pigs with combined Gal1,3αGal, β4Gal, and Neu5Gc knockout (TKO) and containing human transgenes that address molecular incompatibilities in complement activation and innate and adaptive immune cell function were perfused ex vivo with freshly collected heparinized human blood. GalTKO.hCD55 lungs served as the reference group. In paired lungs from each pig, the blood was kept "untreated" (n = 5 for pig 2.0 and n = 3 for reference), or the blood was "treated" with 1-BIA (a thromboxane synthase inhibitor and histamine receptor blocker) (n = 7 for pig 2.0; n = 4 for reference). Tissue and blood samples were collected at predetermined time points, and the experiment was terminated selectively after 8 hours of perfusion if the lungs did not fail prematurely.

[0522] The median survival time of the Porcine 2.0 lungs was 450 min (range 300 - 480 min) in the untreated group compared to 30 min (range 20 - 300 min) for the reference lungs (P = 0.04), and 480 min (range 360 - 480 min) in the treated group compared to 300 min (range 145 - 360 min) (P = 0.009). Relative to the GalTKO.hCD55 lungs, the rise in pulmonary vascular resistance (PVR) in the 'untreated' Porcine 2.0 lungs was significantly attenuated and delayed ( Figure 42 ). In both Porcine 2.0 and the reference groups, additional blood treatment with 1 - BIA and H - blocker attenuated the PVR rise. Neutrophil and platelet sequestration generally occurred within 5 - 15 min of perfusion and was not attenuated in relation to the Porcine 2.0 multi - transgenic lungs.

[0523] These data suggest that the novel Porcine 2.0 donor genetics protect the lungs from PVR rise and lung injury and are associated with significantly improved lung survival in this stringent model. As previously described for other lung genetics, leukocyte and white cell sequestration was not prevented. The combination of transgenes expressed by the Porcine 2.0 lungs may contribute to the successful completion of xenotransplantation of lungs and other organs.

[0524] Transgene expression. RNAseq expression data showed that complement and cytotoxicity genes were expressed in samples collected from Payload 9 and Payload 10 Porcine 2.0 pigs ( Figure 36 ). FACS data showed that complement and cytotoxicity proteins were expressed in samples collected from Payload 5, Payload 9, and Payload 10 pigs ( Figure 37 ). All three payloads expressed complement (CD46, CD55, and CD59) and cytotoxicity - related proteins (e.g., B2M, HLA - E, CD47). In addition, Payload 5 expressed CD39, while Payload 10 expressed PDL1. Although there were large differences in performance in NHPs, the gene expression profiles were similar among the five pigs carrying Payload 5.

[0525] Unless otherwise explicitly indicated, the use of numerical values specified in this application is expressed as an approximation of the minimum and maximum values specified within a stated range and is placed after the word "about". The disclosure of a range is intended to be a continuous range, including every value between the recited minimum and maximum values and any range that can be formed by such values. The numerical values presented in this application represent various embodiments of the present disclosure.

[0526] This disclosure is not intended to be exhaustive or to limit the technology to the precise forms disclosed herein. While specific embodiments of the technology are disclosed herein for illustrative purposes, various equivalent modifications are possible without departing from the technology, as will be recognized by those of ordinary skill in the relevant art. In some instances, well-known structures and functions have not been shown and / or described in detail to avoid unnecessarily obscuring the description of embodiments of the technology. Although the steps of the methods may be presented herein in a specific order, in alternative embodiments, the steps may have a different appropriate order. Similarly, certain embodiments of the technology disclosed in the context of specific embodiments may be combined or eliminated in other embodiments. Additionally, while certain advantages associated with some embodiments may have been disclosed in the context of those embodiments, other embodiments may exhibit such advantages, and not all embodiments need to exhibit such advantages or other advantages disclosed herein to fall within the scope of the technology. Accordingly, the disclosure and the related art may cover other embodiments not expressly shown and / or described herein.

[0527] It should be understood from the foregoing that specific embodiments of this disclosure have been described herein for purposes of illustration, but that various modifications may be made without departing from the scope of the disclosure. Accordingly, the disclosure is not limited except as by the appended claims.

[0528] While numerous specific embodiments of the subject matter of this disclosure have been discussed, the foregoing description is illustrative and not restrictive. Various variations of the disclosure will become apparent to those skilled in the art upon review of this specification and the following claims. The full scope of the disclosure should be determined by reference to the claims, along with the full scope of their equivalents, and the specification, along with such variations.

[0529] Abbreviations

[0530] Acute vascular rejection (AVR); Activated partial thromboplastin time (APTT); Adeno-associated virus integration site 1 (AAVS1); Alanine aminotransferase (ALT); Albumin (ALB); ɑ1,3-galactosyl-galactose (Gal or αGal); Antibody-mediated rejection (AMR); Antithymocyte globulin (ATG); Asialoglycoprotein receptor 1 (ASGR1); Aspartate aminotransferase (AST); β1,4 N-acetylgalactosaminyltransferase 2 (B4GalNT2); β-2 microglobulin (B2M); Cluster of differentiation 39 (CD39); Cluster of differentiation 47 (CD47); Clustered regularly interspaced short palindromic repeats (CRISPR); Class II trans-activator dominant negative (CIITA-DN); CMV early enhancer / chicken β-actin (CAG); Complement factor 3 (C3); Complement factor 3 knockout (C3-KO); Complete blood count (CBC); C-X-C motif chemokine receptor 3 (CXCR3); C-X-C motif chemokine receptor 12 (CXCR12); Cytidine monophosphate-N-acetylneuraminic acid hydroxylase (CMAH); Cytotoxic T lymphocyte-associated immunoglobulin (CTLA-Ig); Deoxyribonucleic acid (DNA); DQα (DQA); DRα (DRA); Droplet digital PCR (ddPCR); Ecto-5′-nucleotidase (CD73); Elongation factor 1α (EF1α); Endothelial cell (EC); Endothelial protein C receptor (EPCR); Ex vivo liver xenoperfusion (EVLXP); Fas ligand (FasL); Fibrinogen level (FIB); Fluorescence-activated cell sorting (FACS); Fresh frozen plasma (FFP); Green fluorescent protein (GFP); Glomerular filtration rate (GFR); Glucagon-like peptide 1 receptor (GLP-1R); Glycoprotein IIb / IIIa (GpIIb / IIIa); Glycoprotein α-galactosyltransferase 1 (GGTA); GGTA knockout (GTKO); Guide ribonucleic acid (gRNA); Hematoxylin and eosin (H+E); Hepatic artery thrombosis (HAT); Human embryonic kidney 293 (HEK293); Heme oxygenase (HO-1); Homology-directed repair (HDR); Human whole blood and plasma (hWB+P); Human membrane cofactor protein (hCD46); Human complement decay-accelerating factor (hCD55); Human complement regulatory protein (hCRP); Human leukocyte antigen (HLA); Human leukocyte antigen-E (HLA-E); Human MAC inhibitor (hCD59); Immunoglobulin G (IgG); Immunoglobulin G-degrading enzyme of Streptococcus pyogenes (IdeS); Immunoglobulin M (IgM); Immunohistochemistry (IHC); Inosine monophosphate dehydrogenase (IMDH); Interleukin 12 (IL12); Interleukin 35 (IL35); International normalized ratio (INR); Intracellular adhesion molecule-2 (ICAM2);Killer inhibitory receptor (KIR); Knock-in (KI); Knock-out (KO); Krüppel-associated box (KRAB); Liver function test (LFT); Long terminal repeat (LTR); Major histocompatibility complex class I (MHC class I); Major histocompatibility complex class II (MHC class II); Major histocompatibility complex class I E single-chain trimer (HLA-ESCT); Mechanistic target of rapamycin (mTOR); Messenger ribonucleic acid (mRNA); Modified diet in renal disease (MDRD); Mixed lymphocyte reaction (MLR); Mycophenolate mofetil (MMF); Natural killer (NK); N-glycolylneuraminic acid (Neu5Gc); Neurogenic differentiation 1 (NeuroD); Non-human primate (NHP); Non-homologous end joining (NHEJ); Orthotopic liver xenotransplantation (OLTx); Panel reactive antibody (PRA); Peripheral blood mononuclear cell (PBMC); Porcine kidney-15 cell (PK15); Porcine endogenous retrovirus (PERV); Porcine endogenous retrovirus knock-out (PERV KO); Programmed death ligand 1 (PD-L1); Polymerase chain reaction (PCR); Porcine aortic endothelial cell line (PEC-A or pAEC); Potassium (K); Prothrombin time (PT) and international normalized ratio (PT-NIR); Quantitative reverse transcription polymerase chain reaction (qRT-PCR); Recombinase-mediated cassette exchange (RMCE); Red blood cell (RBC); Ribonucleic acid sequencing (RNAseq); Reverse transcription polymerase chain reaction (RT-PCT); Single guide RNA (sgRNA); Small interfering ribonucleic acid (siRNA); Sodium (Na); Somatic cell nuclear transfer (SCNT); Superoxide dismutase 3 (SOD3); Swine leukocyte antigen (SLA); T cell-mediated rejection (TCMR); Thrombin-antithrombin III (TAT); Thrombomodulin (THBD, TBM or TM); Thrombotic microangiopathy (TMA); Tissue factor pathway inhibitor (TFPI); Topoisomerase (TOPO); Total bilirubin (Tbili); Transcription activator-like (TAL) effector and nuclease (TALEN); Tumor necrosis factor α-induced protein 3 (A20); Tumor necrosis factor receptor 1 immunoglobulin (TNFR1-Ig); Ubiquitously chromatin opening element (UCOE); Von Willebrand factor (vWF); Whole genome sequencing (WGS); Wild type (WT); Zinc finger nuclease (ZFN).;

[0531] References

[0532] ● Ahlborg et al. N Engl J Med 349(4): 327 - 334 (July 24, 2003) (PMID: 12878739; DOI: 10.1056 / NEJMoa022464)

[0533] ● Armstrong et al. J Gen Virol 10(2): 195 - 198 (Feb. 1971) (PMID: 4324256; DOI: 10.1099 / 0022 - 1317 - 10 - 2 - 195)

[0534] ● Bacrtschiger et al. Xenotransplantation 11(1): 27 - 32 (Jan. 2004) (PMID: 14962290; DOI: 10.1111 / j.1399 - 3089.2004.00075.x)

[0535] ● Boron & Boulpaep, Medical Physiology: A Cellular and Molecular Approach, Elsevier / Saunders (1st ed., 2003)

[0536] ● Byme et al. Xenotransplantation 21(6): 543 - 554)(Nov - Dec. 2014) (PMID: 25176027; DOI: 10.1111 / xen.12124)

[0537] ● Cibelli et al. Science 280(5367): 1256 - 1258 (May 22, 1998) (PMID: 9596577)

[0538] ● Clémenceau et al. Diabetologia 45(6): 914 - 923 (June 2002) (PMID: 12107737; DOI: 10.1007 / s00125 - 002 - 0832 - 7)

[0539] ● Cooper et al. Transplantation 77(1): 1 - 5 (Jan. 15, 2004) (PMID: 14724427; DOI: 10.1097 / 01.TP.0000105116.74032.63)

[0540] ● Cooper et al. Int J Surg 23(Pt B): 211 - 216(Nov. 2015)(PMID: 26159291; DOI: 10.1016 / j.ijsu.2015.06.068)

[0541] ● Cowan et al. Kidney Int 85(2): 265 - 275(Feb. 2014)(PMID: 24088952; DOI: 10.1038 / ki.2013.381)

[0542] ● Davis et al. Transplantation 98(9): 931 - 936(Nov. 15, 2014)(PMID: 25286057; DOI: 10.1097 / TP.0000000000000446)

[0543] ● Donati - Boume et al. J Transplant 204: 317574(2014)(PMID: 24688785; DOI: 10.1155 / 2014 / 317574)

[0544] ● Dunn et al. FASEB J 29(Suppl1): LB761(Apr. 1, 2015)

[0545] ● Eggers Am J Kidney Dis 15(5): 414 - 421(May 1990)(PMID: 2185627)

[0546] ● Ekser et al. Int J Surg 23(Pt B): 197 - 198(Nov. 2015)(PMID: 26318503; DOI: 10.1016 / j.ijsu.2015.08.036)

[0547] ● FDA Guidance for Industry: Source Animal, Product, Preclinical, and Clinical Issues Concerning the Use of Xenotransplantation Products in Humans(Apr. 2003, revised Dec. 2016)

[0548] ● FDA Guidance for Industry:Gene Therapy Clinical Trials - Observing Subjects for Delayed Adverse Events (Nov. 2006)

[0549] ● FDA Guidance:Preclinical Assessment of Investigational Cellular and Gene Therapy Products (Nov. 2013)

[0550] ● Fiebig et al. Virology 307(2):406 - 413 (Mar. 15, 2003) (PMID:12667808)

[0551] ● Fischer et al. Sci Rep 6:29081 (Jun 29, 2016) (PMID:27353424;DOI:10.1038 / srep29081)

[0552] ● Gourishankar et al. J Am Soc Nephrol 14(9):2387 - 2394 (Sept. 2003) (PMID:12937318)

[0553] ● Grams et al. Transplantation 94(7):750 - 756 (Oct. 15, 2012) (PMID:22932116;DOI:10.1097 / TP.0b013e31826205b9)

[0554] ● Higginbotham et al. Xenotransplantation 22(3):221 - 230 (May - June 2015) (PMID:25847130;DOI:10.1111 / xen.12166)

[0555] ● Ide et al. Proc Natl Acad Sci USA 104:5062 - 5066 (2007)

[0556] ● Iwase et al. Xenotransplantation 22(4): 302 - 309 (Jul - Aug. 2015) (PMID: 26130164; DOI: 10.1111 / xen.12174)

[0557] ● Iwase & Kobayashi Int J Surg 23(Pt B): 229 - 233 (Nov. 2015) (PMID: 26305729; DOI: 10.1016 / j.ijsu.2015.07.721)

[0558] ● Kasiske et al. Am J Kidney Dis 56(5): 947 - 960 (Nov. 2010) (PMID: 20801565; DOI: 10.1053 / j.ajkd.2010.06.020)

[0559] ● Kim et al. Genome Res 24(6): 1012 - 1019 (June 2014) (PMID: 24696461; DOI: 10.1101 / gr.171322.113)

[0560] ● Kim et al. Am J Transplant 17 Suppl 1: 174 - 251 (Jan. 2017) (PMID: 28052604; DOI: 10.1111 / ajt.14126)

[0561] ● Lai et al. Science 295(5557): 1089 - 1092 (Feb. 8, 2002) (PMID: 11778012; DOI: 10.1126 / science.1068228)

[0562] ● Lee et al. Anim Biotechnol 22(4): 175 - 180 (Oct. 2011) (PMID: 22132811; DOI: 10.1080 / 10495398.2011.595294)

[0563] ● Levey et al. Kidney Int 80(1): 17 - 28 (July 2011) (PMID: 21150873; DOI: 10.1038 / ki.2010.483)

[0564] ● Lilienfeld Xenotransplantation 14(2):126 - 134(Mar.2007)(PMID:17381687;DOI:10.1111 / j.1399 - 3089.2007.00378.x)

[0565] ● Loveland et al. Xenotransplantation 11(2):171 - 183(Mar.2004)(PMID:14962279;DOI:10.1046 / j.1399 - 3089.2003.00103.x)

[0566] ● Lutz et al. Xenotransplantation 20(1):27 - 35(Jan - Feb.2013)(PMID:23384142;DOI:10.1111 / xen.12019)

[0567] ● Marcén et al. NDT Plus 3(Supp1_2):ii2 - ii8(June 2010)(PMID:20508857;DOI:10.1093 / ndtplus / sfq063)

[0568] ● Martens et al. Transplantation 101(4):e86 - e92(Apr.2017)(PMID:28114170;DOI:10.1097 / TP.0000000000001646)

[0569] ● McGregor et al. Transplantation 93(7):686 - 692(Apr.15,2012)(PMID:22391577;DOI:10.1097 / TP.0b013e3182472850)

[0570] ● Moalic et al. J Virol 80(22):10980 - 10988(Nov.2006)(PMID:16928752;DOI:10.1128 / JVI.00904 - 06)

[0571] ● Mohiuddin et al. Nat Commun 7:11138(Apr.5,2016)(PMID:27045379;DOI:10.1038 / ncomms11138)

[0572] ● Niu et al., Science 357(6357): 1303 - 1307 (Sept. 22, 2017) (PMID: 28798043; DOI: 10.1126 / science.aan4187)

[0573] ● Ojo et al., Transplantation 71(1): 82 - 90 (Jan. 15, 2001) (PMID: 11211201)

[0574] ● Patience et al., Nat Med 3(3): 282 - 286 (Mar. 1997) (PMID: 9055854)

[0575] ● Patience et al., J Virol 75(6): 2771 - 2775 (Mar. 2001) (PMID: 11222700; DOI: 10.1128 / JVI.75.6.2771 - 2775.2001)

[0576] ● Pinheiro et al., Anal Chem 84(2): 1003 - 1011 (Jan. 17, 2012) (PMID: 22122760; DOI: 10.1021 / ac202578x)

[0577] ● Ramsoondar et al., Xenotransplantation 16(3): 164 - 180 (May - June 2009) (PMID: 19566656; DOI: 10.1111 / j.1399 - 3089.2009.00525.x)

[0578] ● Reyes et al., J Immunol 193(11): 5751 - 5757 (Dec. 1, 2014) (PMID: 25339675; DOI: 10.4049 / jimmunol.1402059)

[0579] ● Robson et al., Xenotransplantation 7(3): 166 - 176 (Aug. 2000) (PMID: 11021661)

[0580] ● Schuurman Xenotransplantation 16(4): 215 - 222 (July - Aug. 2009) (PMID: 19799761; DOI: 10.1111 / j.1399 - 3089.2009.00541.x)

[0581] ● Semaan et al. Xenotransplantation 19(2): 112 - 121 (Mar - Apr 2012) (PMID: 22497513; DOI: 10.1111 / j.1399 - 3089.2012.00683.x)

[0582] ● Semaan et al. PLoS One 10(4): e0122059 (Apr. 24, 2015) (PMID: 25909512; DOI: 10.1371 / journal.pone.0122059)

[0583] ● Sharma et al. Br J Gen Pract 60(575): e266 - e276 (June 2010) (DOI: 10.3399 / bjgp10X502173)

[0584] ● Shen et al. Transplant Proc 43(5): 1994 - 1997 (June 2011) (PMID: 21693314; DOI: 10.1016 / j.transproceed.2011.03.037)

[0585] ● Starzl et al. Transplantation 2: 752 - 756 (Nov. 1964) (PMID: 14224657)

[0586] ● Starzl et al. Hepatology 17(6): 1127 - 1152 (June 1993) (PMID: 8514264)

[0587] ● Tanabe et al. Am J Transplant 17(7): 1778 - 1790 (July 2017) (PMID: 28117931; DOI: 10.1111 / ajt.14210)

[0588] ● Tseng et al. Transplantation 81(7): 1058 - 1062 (Apr. 15, 2006) (PMID: 16612284; DOI: 10.1097 / 01.tp.0000197555.16093.98)

[0589] ● Vagefi et al. Int J Surg 23(Pt B): 291 - 295 (Nov. 2015) (PMID: 26296932; DOI: 10.1016 / j.ijsu.2015.07.720)

[0590] ● van't Veer et al. J Biol Chem 272(12): 7983 - 7994 (Mar. 21, 1997) (PMID: 9065469; DOI: 10.1074 / jbc.272.12.7983)

[0591] ● Wang et al. Sci Rep 6: 38854 (Dec. 16, 2016) (PMID: 27982048; DOI: 10.1038 / srep38854)

[0592] ● Yang et al. Nucleic Acids Res 41(19): 9049 - 9061 (Oct. 2013) (PMID: 23907390; DOI: 10.1093 / nar / gkt555)

[0593] ● Yang et al. Science 350(6264): 1101 - 1104 (Nov. 27, 2015) (PMID: 26456528; DOI: 10.1126 / science.aad1191)

[0594] ● Ye et al. Transplantation 60(1): 19 - 22 (July 15, 1995) (PMID: 7624938)

[0595]

[0596]

[0597]

[0598]

[0599]

[0600]

[0601]

[0602]

Claims

1. An isolated cell, tissue, organ or animal comprising a plurality of transgenes of at least two types selected from inflammatory response transgenes, immune response transgenes, immune regulatory transgenes and combinations thereof.

2. An isolated cell, tissue, organ or animal comprising a plurality of transgenes, wherein the plurality of transgenes includes at least one inflammatory response transgene, at least one immune response transgene and at least one immune regulatory transgene.

3. The isolated cell, tissue, organ or animal according to claim 1 or 2, wherein the inflammatory response transgene is selected from TNFα-induced protein 3 (A20), heme oxygenase (HO-1), cluster of differentiation 47 (CD47) and combinations thereof.

4. The isolated cell, tissue, organ or animal according to claim 1 or 2, wherein the immune response transgene is selected from human leukocyte antigen-E (HLA-E), β-2 microglobulin (B2M) and combinations thereof.

5. The isolated cell, tissue, organ or animal according to any one of claims 1 or 2, wherein the immune regulatory transgene is selected from programmed death ligand 1 (PD-L1), Fas ligand (FasL) and combinations thereof.

6. The isolated cell, tissue, organ or animal according to claim 1 or 2, wherein the plurality of transgenes further includes at least one coagulation response transgene.

7. The isolated cell, tissue, organ or animal according to claim 6, wherein the coagulation response transgene is selected from cluster of differentiation 39 (CD39), thrombomodulin (THBD), tissue factor pathway inhibitor (TFPI) and combinations thereof.

8. The isolated cell, tissue, organ or animal according to claim 1 or 2, wherein the plurality of transgenes further includes at least one complement response transgene.

9. The isolated cell, tissue, organ or animal according to claim 8, wherein the complement response transgene is selected from human membrane cofactor protein (hCD46), human complement decay-accelerating factor (hCD55), human MAC inhibitor factor (hCD59) and combinations thereof.

10. An isolated cell, tissue, organ or animal comprising six or more transgenes, the transgenes being independently selected from complement response transgenes, coagulation response transgenes, inflammatory response transgenes, immune response transgenes and immune regulatory transgenes.

Citation Information

Patent Citations

  • Multi-Transgenic Pig for Xenotransplantation

    US20180249688A1

  • Developmental competence for assisted reproduction and nuclear transfer in pigs

    US6548741B2

  • Multiplexed genome editing

    WO2017062723A1

  • Methods for generating genetically modified animals

    WO2018195402A1