Improved human PAH production for treatment of severe PKU by liver-directed gene replacement therapy

Abstract

The present invention relates to improved production of human PAH for the treatment of severe PKU by liver-directed gene replacement therapy, and provides variant phenylalanine hydroxylase (PAH) polypeptides that are more stable and have greater activity than wild-type human PAH. Also provided are methods of treating phenylketonuria (PKU) and / or reducing phenylalanine levels in an individual in need thereof. The invention also provides expression cassettes, vectors (e.g., rAAV vectors), virions, pharmaceutical compositions, and kits for expressing the variant PAH polypeptides in an individual in need thereof.

Description

[0001] This divisional application of the present invention claims priority based on the patent application for "Production of Modified Human PAH for the Treatment of Severe PKU by Liver-Directed Gene Replacement Therapy" with an application date of October 11, 2019, application number 201980082127.3 (International Application Number PCT / US2019 / 055917).

[0002] Cross - reference to related applications

[0003] This application claims the benefit of priority of the following applications: U.S. Provisional Application Serial No. 62 / 744,944, filed on October 12, 2018, which is incorporated herein by reference in its entirety.

[0004] Submission of an ASCII text file sequence listing

[0005] The content of the following submitted ASCII text file is incorporated herein by reference in its entirety: Sequence Listing in computer - readable form (CRF) (filename: 159792016640SEQLIST.TXT, date of record: October 16, 2019, size: 33KB). Technical field

[0006] This disclosure relates to variant phenylalanine hydroxylase polypeptides. In some aspects, this disclosure relates to compositions and methods for treating phenylketonuria using gene therapy. Background art

[0007] Phenylketonuria (PKU) is a genetic defect of phenylalanine hydroxylase (PAH), a liver enzyme that catalyzes the hydroxylation of phenylalanine (Phe) to tyrosine (Tyr). This disease is the most common inborn error of amino acid metabolism, with an overall incidence of 1:10,000 - 1:15,000 in North America and is detected in most developed countries through newborn screening programs. In the absence of any treatment, severe forms of PKU result in highly elevated blood Phe levels, which are neurotoxic and associated with severe mental retardation (Kochhar 2012, Ho 2014, Blau 2015). The affected protein PAH is a multi-domain protein consisting of an N-terminal regulatory domain (1 - 117), a central catalytic domain (118 - 410), and a C-terminal tetramerization domain (411 - 452) (Flydal 2013). To date, more than 560 disease-causing mutations have been mapped to each domain, with the catalytic region being the most frequently affected site (Erlandsen 2003). The homotetrameric enzyme is subject to complex regulation by phosphorylation and allosteric activation upon binding of the substrate Phe to the N-terminal domain, and this binding fine-tunes PAH enzyme activity by altering various conformations and multimeric states of the enzyme (Knappskog 1996, Jaffe 2013, Arturo 2016).

[0008] Current treatment for PKU is life-long dietary restriction of Phe using a low-protein diet and a liquid medical food formula (Kochhar 2012, Ho 2014, Blau 2015). Although effective, the poor taste of the medical food and the severe restrictions on food choices make it difficult for children to adhere to the diet, and non-compliance with the diet has been steadily increasing, and by late adolescence, nearly 80% of patients have blood Phe levels above the recommended levels (Waisbren 2007, Thomas 2017). There is also new evidence that despite good adherence to the Phe-restricted diet, many patients have deficits in various neurocognitive and neuropsychiatric functions, and the incidence of attention deficit hyperactivity disorder (ADHD) is high. Although the reasons are unclear, potential explanations include brain amino acid imbalance, nutritional deficiencies of certain vitamins and trace elements, and fluctuations in blood Phe levels normally maintained by hepatic PAH activity (Cleary 2013, Gonzales 2016, Vogel 2017). Interestingly, treatment of patients with mild PKU with the synthetic form of the cofactor tetrahydrobiopterin (BH4) (sapropterin dihydrochloride) not only showed effective reduction of blood Phe levels, but also indicated improvement in neurological function, such as reduction of ADHD symptoms (Burton 2015). This therapy increases the activity of the residual PAH enzyme by acting as a pharmacological chaperone, and thus can partially correct the genetic defect by providing normal Phe-regulated PAH activity (Blau 2015). Another recently approved therapy consists of enzyme replacement therapy using a polyethylene glycolylated form of the bacterial phenylalanine ammonia-lyase (PAL) that metabolizes Phe to trans-cinnamic acid. This therapy significantly reduces blood Phe levels, but seems less effective on neurological endpoints (Longo 2014). It is unclear whether this therapy or any other therapy primarily based on reducing blood Phe levels can address the cognitive and neuropsychiatric problems observed even in compliant PKU patients without correcting the function of PAH, which is the regulator of systemic Phe levels and the producer of Tyr.

[0009] All references (including patent applications and publications) cited herein are incorporated by reference in their entirety. SUMMARY OF THE INVENTION

[0010] The present invention is at least in part based on the discovery by the inventors of improved hPAH variants, and in particular variant-1 (V1), which contains four amino acid changes that result in improved protein stability and enzyme activity compared to endogenous hPAH. Delivery of the cDNA encoding this hPAH-V1 variant to the liver using a clinically relevant dose of rAAV improved PAH in a human PKU model enu2a variety of disease endpoints in mice and is more effective than unmodified hPAH. Thus, the rAAV vector encoding this new variant can provide a route for PKU gene therapy by allowing efficacy to be achieved with a reduced vector dose.

[0011] In some aspects, the present invention provides variant phenylalanine hydroxylase (PAH) polypeptides comprising two amino acid substitutions, wherein the amino acid substitutions are at positions selected from M180, K199, S250, and G256 of the wild-type human PAH polypeptide. In some aspects, the present invention provides variant phenylalanine hydroxylase (PAH) polypeptides comprising three amino acid substitutions, wherein the amino acid substitutions are at positions selected from M180, K199, S250, and G256 of the wild-type human PAH polypeptide. In some aspects, the present invention provides variant phenylalanine hydroxylase (PAH) polypeptides comprising four amino acid substitutions, said amino acid substitutions being at positions M180, K199, S250, and G256 of the wild-type human PAH polypeptide. In some embodiments, the amino acid substitutions include one or more of M180T, K199P, S250P, and G256A. In some embodiments, the amino acid substitutions include K199P, S250P, and G256A; M180T, S250P, and G256A; M180T, K199P, and G256A; or M180T, K199P, and S250P. In some embodiments, the amino acid substitutions include M180T, K199P, S250P, and G256A. In some embodiments, the variant PAH polypeptide further comprises H264P, G272A, G272P, P275L, P279Q, G272P, and P275L, or T323R and F327T amino acid substitutions. In some embodiments, the wild-type human PAH polypeptide comprises the amino acid sequence of SEQ ID NO:1. In some embodiments, the variant PAH polypeptide is a human PAH polypeptide. In some embodiments, the variant PAH polypeptide comprises an amino acid sequence that is at least about 80% identical to the amino acid sequence of SEQ ID NO:3. In some embodiments, the variant PAH polypeptide comprises the amino acid sequence of SEQ ID NO:3. In some embodiments, the variant PAH polypeptide further comprises one or more amino acid substitutions selected from G33A, G46A, G46P, G103A, G139A, G139P, G148A, G188A, G218A, G239A, G247A, G257A, G272A, G289A, G307A, G312A, G332A, G337A, G344A, G352A, and G442A of the wild-type human PAH polypeptide. In some embodiments, the variant PAH polypeptide further comprises one or more amino acid substitutions selected from P9G, G10V, G12S, K184R, K192R, S196A, Y206H, H220R, Q336E, E360D, I374C, N376E, N401T, I421V, I441V, S446H of the wild-type human PAH polypeptide, and addition of S at position 453 of the wild-type human PAH polypeptide.In some embodiments, the variant PAH polypeptide further comprises one or more amino acid substitutions selected from F240W, A246P, G247A, Y268W, C284F, T323R, F327Y, E319P, I306(Y,F), K113P, G188A, F191Y, T193R, Y206H, G337P, and N376P of the wild-type human PAH polypeptide. In some embodiments, the variant PAH polypeptide comprises one or more amino acid substitutions selected from G33A, G46A, G46P, G103A, G139A, G139P, G148A, G188A, G218A, G239A, G247A, G257A, G272A, G289A, G307A, G312A, G332A, G337A, G344A, G352A, and G442A of the wild-type human PAH polypeptide.

[0012] In some aspects, the present invention provides a variant PAH polypeptide, wherein the variant PAH polypeptide comprises one or more amino acid substitutions selected from P9G, G10V, G12S, K184R, K192R, S196A, Y206H, H220R, Q336E, E360D, I374C, N376E, N401T, I421V, I441V, S446H of the wild-type human PAH polypeptide, and an addition of S at position 453 of the wild-type human PAH polypeptide. In some aspects, the present invention provides a variant PAH polypeptide that comprises one or more amino acid substitutions selected from F240W, A246P, G247A, Y268W, C284F, T323R, F327Y, E319P, I306(Y,F), K113P, G188A, F191Y, T193R, Y206H, G337P, and N376P of the wild-type human PAH polypeptide.

[0013] In some embodiments, the variant PAH polypeptide comprises an N-terminal truncation. In some embodiments, the N-terminal truncation comprises truncation of the N-terminal regulatory domain. In some embodiments, the N-terminal truncation comprises truncation of amino acid residues 1-102 of the wild-type PAH polypeptide. In some embodiments, the variant PAH polypeptide comprises a C-terminal truncation. In some embodiments, the C-terminal truncation comprises truncation of the tetramerization domain. In some embodiments, the C-terminal truncation comprises truncation of amino acid residues 429-452 of the wild-type PAH polypeptide. In some embodiments, the variant PAH polypeptide comprises an amino acid sequence corresponding to amino acid residues 103-428 of the wild-type PAH polypeptide.

[0014] In some embodiments, the variant PAH polypeptide comprises one or more amino acid substitutions to eliminate potential protease cleavage sites. In some embodiments, the one or more amino acid substitutions that eliminate potential protease cleavage sites are located at positions 270-295 and / or 380-405 of the wild-type PAH polypeptide.

[0015] In some embodiments, the variant PAH polypeptide is fused to a liver-targeting polypeptide. In some embodiments, the liver-targeting polypeptide is HGF or a fragment thereof or a glycoprotein that binds to the asialoglycoprotein receptor on hepatocytes. In some embodiments, the variant PAH polypeptide is pegylated and / or nitrosylated. In some embodiments, the variant PAH polypeptide comprises an I374C amino acid substitution, wherein the cys residue at position 374 is nitrosylated.

[0016] In some embodiments, the present invention provides a composition comprising a variant PAH polypeptide as described herein. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier.

[0017] In some aspects, the present invention provides isolated nucleic acids encoding variant PAH polypeptides as described herein. In some embodiments, the nucleic acid encoding the variant PAH polypeptide is operably linked to a promoter. In some embodiments, the promoter is selected from the cytomegalovirus (CMV) immediate early promoter, RSV LTR, MoMLV LTR, phosphoglycerate kinase-1 (PGK) promoter, simian virus 40 (SV40) promoter, CK6 promoter, transthyretin promoter (TTR), mTTR482 promoter, mA1MB2-mTTR482 promoter, TK promoter, tetracycline-responsive promoter (TRE), HBV promoter, hAAT promoter, LSP promoter, LP1 promoter, chimeric liver-specific promoter (LSP), E2F promoter, telomerase (hTERT) promoter; cytomegalovirus enhancer / chicken β-actin / rabbit β-globin promoter (CAG) promoter, elongation factor 1-α promoter (EF1-α) promoter, human β-glucuronidase promoter, chicken β-actin (CBA) promoter, modified chicken β-actin (CBA) promoter or SEQ ID NO:17, Rous sarcoma virus (RSV) LTR promoter, dihydrofolate reductase promoter, and β-actin promoter. In some embodiments, the promoter is the LP1 promoter or the mA1MB2-mTTR482 promoter. In some embodiments, the nucleic acid further comprises a polyadenylation signal. In some embodiments, the polyadenylation signal is the bovine growth hormone polyadenylation signal, the SV40 polyadenylation signal, or the HSV TK polyadenylation signal. In some embodiments, the nucleic acid further comprises an intron. In some embodiments, the intron is the chicken β-actin (CBA) / rabbit β-globin hybrid intron. In some embodiments, the intron is the modified chicken β-actin (CBA) / rabbit β-globin hybrid intron of SEQ ID NO:15. In some embodiments, the nucleic acid further comprises one or more ITRs. In some embodiments, the nucleic acid further comprises filler nucleic acid. In some embodiments, the filler nucleic acid is optimized to remove ATG sequences. In some embodiments, the filler nucleic acid is the A1AT intron filler sequence of SEQ ID NO:16.

[0018] In some aspects, the present invention provides an isolated nucleic acid encoding a human PAH polypeptide, wherein the nucleic acid is codon-optimized. In some embodiments, the nucleic acid sequence is at least 80% identical to the nucleic acid sequence of SEQ ID NO:14. In some embodiments, the nucleic acid comprises the nucleic acid sequence of SEQ ID NO:14. In some embodiments, the nucleic acid is mRNA. In some aspects, the present invention provides a composition comprising the nucleic acid as described herein. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier.

[0019] In some aspects, the present invention provides a vector comprising a separated nucleic acid as described herein. In some embodiments, the vector is a recombinant adeno-associated virus (rAAV) vector. In some embodiments, the rAAV vector comprises a nucleic acid as described herein, flanked by one or more AAV inverted terminal repeat (ITR) sequences. In some embodiments, the nucleic acid is flanked by two AAV ITRs. In some embodiments, the AAV ITR is an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV DJ, caprine AAV, bovine AAV or murine AAV serotype ITR. In some embodiments, the AAV ITR is an AAV2 ITR. In some embodiments, the rAAV vector comprises, from 5' to 3', an AAV2 ITR, a promoter, an intron, a nucleic acid encoding a PAH polypeptide, filler nucleic acid, a polyadenylation signal, and an AAV2 ITR. In some embodiments, the promoter is the m1A1MB2-mTTR482 promoter or the LP1 promoter. In some embodiments, the intron is the chicken β-actin (CBA) / rabbit β-globin hybrid intron. In some embodiments, the PAH polypeptide is a variant PAH polypeptide as described herein. In some embodiments, the nucleic acid encoding the PAH polypeptide is a codon-optimized nucleic acid. In some embodiments, the filler nucleic acid comprises nucleic acid from the intron of the human α1-antitrypsin gene. In some embodiments, the intron of the human α1-antitrypsin gene has been mutated to remove the ATG sequence. In some embodiments, the polyadenylation signal is the bovine growth hormone polyadenylation signal. In some embodiments, the vector is a self-complementary vector. In some embodiments, the vector comprises a first nucleic acid sequence encoding a PAH polypeptide and a second nucleic acid sequence encoding the complement of the PAH polypeptide, wherein the first nucleic acid sequence can form intra-strand base pairs with the second nucleic acid sequence along most or all of its length. In some embodiments, the first nucleic acid sequence and the second nucleic acid sequence are joined by a mutated AAV ITR, wherein the mutated AAV ITR comprises a deletion in the D region and a mutation in the terminal unwinding sequence.

[0020] In some aspects, the present invention provides rAAV particles comprising an rAAV vector as described herein. In some embodiments, the AAV viral particle comprises an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV2 / 2-7m8, AAV DJ, AAV2 N587A, AAV2E548A, AAV2 N708A, AAV2 V708K, caprine AAV, AAV1 / AAV2 chimeric, bovine AAV, murine AAV, or rAAV2 / HBoV1 serotype capsid. In some embodiments, the AAV viral particle comprises an engineered AAV capsid. In some embodiments, the engineered AAV capsid is a DJ capsid or an LK03 capsid. In some embodiments, the ITR and capsid of the rAAV viral particle are derived from the same AAV serotype. In some embodiments, the ITR and capsid of the rAAV viral particle are derived from different AAV serotypes. In some embodiments, the rAAV viral particle comprises an AAV8 capsid. In some embodiments, the rAAV viral particle comprises an AAV8 capsid and wherein the vector comprises AAV2 ITRs.

[0021] In some embodiments, the AAV viral particle comprises a capsid having at least 85% sequence identity, such as at least 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity, with the capsid of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV2 / 2-7m8, AAVDJ, AAV2 N587A, AAV2E548A, AAV2 N708A, AAV2 V708K, caprine AAV, AAV1 / AAV2 chimeric, bovine AAV, murine AAV or rAAV2 / HBoV1 serotype. In some embodiments, the AAV viral particle comprises a capsid having at least 85% sequence identity, such as at least 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity, with the capsid of AAV1 serotype. In some embodiments, the AAV viral particle comprises a capsid having at least 85% sequence identity, such as at least 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity, with the capsid of AAV2 serotype. In some embodiments, the AAV viral particle comprises a capsid having at least 85% sequence identity, such as at least 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity, with the capsid of AAV3 serotype. In some embodiments, the AAV viral particle comprises a capsid having at least 85% sequence identity, such as at least 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity, with the capsid of AAV4 serotype. In some embodiments, the AAV viral particle comprises a capsid having at least 85% sequence identity, such as at least 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity, with the capsid of AAV5 serotype. In some embodiments, the AAV viral particle comprises a capsid having at least 85% sequence identity, such as at least 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity, with the capsid of AAV6 serotype. In some embodiments, the AAV viral particle comprises a capsid having at least 85% sequence identity, such as at least 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity, with the capsid of AAV7 serotype.In some embodiments, the AAV viral particle comprises a capsid having at least 85% sequence identity, such as at least 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity, to the AAV8 serotype capsid. In some embodiments, the AAV viral particle comprises a capsid having at least 85% sequence identity, such as at least 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity, to the AAV9 serotype capsid. In some embodiments, the AAV viral particle comprises a capsid having at least 85% sequence identity, such as at least 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity, to the AAV11 serotype capsid. In some embodiments, the AAV viral particle comprises a capsid having at least 85% sequence identity, such as at least 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity, to the AAV12 serotype capsid.

[0022] In some embodiments, the AAV viral particle comprises a chimeric capsid. In some embodiments, the chimeric capsid is an AAV1 / AAV6, AAV2 / AAV6, AAV3 / AAV6, AAV4 / AAV6, AAV5 / AAV6, AAV7 / AAV6, AAV8 / AAV6, AAV9 / AAV6, AAV10 / AAV6, AAV11 / AAV6, AAV12 / AAV6, AAV1 / AAV8, AAV2 / AAV8, AAV3 / AAV8, AAV4 / AAV8, AAV5 / AAV8, AAV7 / AAV8, AAV9 / AAV8, AAV10 / AAV8, AAV11 / AAV8, AAV12 / AAV8, or AAV1 / AAV6 / AAV8 chimeric capsid. In some embodiments, the chimeric capsid is an AAV8 / AAV6 chimeric capsid. In some embodiments, the chimeric capsid is an AAV1 / AAV6 / AAV8 chimeric capsid.

[0023] In some embodiments, the AAV viral particles comprise a hybrid capsid. In some embodiments, the hybrid capsid is an AAV1 / AAV6, AAV2 / AAV6, AAV3 / AAV6, AAV4 / AAV6, AAV5 / AAV6, AAV7 / AAV6, AAV8 / AAV6, AAV9 / AAV6, AAV10 / AAV6, AAV11 / AAV6, AAV12 / AAV6, AAV1 / AAV8, AAV2 / AAV8, AAV3 / AAV8, AAV4 / AAV8, AAV5 / AAV8, AAV7 / AAV8, AAV9 / AAV8, AAV10 / AAV8, AAV11 / AAV8, AAV12 / AAV8 or AAV1 / AAV6 / AAV8 hybrid capsid. In some embodiments, the hybrid capsid is an AAV8 / AAV6 hybrid capsid. In some embodiments, the hybrid capsid is an AAV1 / AAV6 / AAV8 hybrid capsid.

[0024] In some embodiments, the hybrid capsid comprises an amino acid sequence having at least 95% sequence identity, such as at least 96%, 97%, 98% or 99% sequence identity, to a portion of the AAV1 capsid sequence. In some embodiments, the hybrid capsid comprises an amino acid sequence having at least 95% sequence identity, such as at least 96%, 97%, 98% or 99% sequence identity, to a portion of the AAV2 capsid sequence. In some embodiments, the hybrid capsid comprises an amino acid sequence having at least 95% sequence identity, such as at least 96%, 97%, 98% or 99% sequence identity, to a portion of the AAV3 capsid sequence. In some embodiments, the hybrid capsid comprises an amino acid sequence having at least 95% sequence identity, such as at least 96%, 97%, 98% or 99% sequence identity, to a portion of the AAV4 capsid sequence. In some embodiments, the hybrid capsid comprises an amino acid sequence having at least 95% sequence identity, such as at least 96%, 97%, 98% or 99% sequence identity, to a portion of the AAV5 capsid sequence. In some embodiments, the hybrid capsid comprises an amino acid sequence having at least 95% sequence identity, such as at least 96%, 97%, 98% or 99% sequence identity, to a portion of the AAV6 capsid sequence. In some embodiments, the hybrid capsid comprises an amino acid sequence having at least 95% sequence identity, such as at least 96%, 97%, 98% or 99% sequence identity, to a portion of the AAV7 capsid sequence. In some embodiments, the hybrid capsid comprises an amino acid sequence having at least 95% sequence identity, such as at least 96%, 97%, 98% or 99% sequence identity, to a portion of the AAV8 capsid sequence. In some embodiments, the hybrid capsid comprises an amino acid sequence having at least 95% sequence identity, such as at least 96%, 97%, 98% or 99% sequence identity, to a portion of the AAV9 capsid sequence. In some embodiments, the hybrid capsid comprises an amino acid sequence having at least 95% sequence identity, such as at least 96%, 97%, 98% or 99% sequence identity, to a portion of the AAV10 capsid sequence. In some embodiments, the hybrid capsid comprises an amino acid sequence having at least 95% sequence identity, such as at least 96%, 97%, 98% or 99% sequence identity, to a portion of the AAV12 capsid sequence. In some embodiments, the hybrid capsid comprises an amino acid sequence having at least 95% sequence identity, such as at least 96%, 97%, 98% or 99% sequence identity, to a portion of the AAV8 capsid sequence. In some embodiments, the portion comprises at least 100 amino acids, such as at least 150, 200, 250, 300, 350 or 400 amino acids.

[0025] In some aspects, the invention provides a composition comprising an rAAV particle as described herein. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier.

[0026] In some aspects, the present invention provides cells comprising a separated nucleic acid as described herein. In some aspects, the present invention provides a method for generating a variant PAH polypeptide, the method comprising culturing the above cells under conditions for generating a variant PAH polypeptide. In some embodiments, the method further comprises the step of purifying the variant PAH polypeptide.

[0027] In some aspects, the present invention provides a method for treating phenylketonuria in an individual in need thereof, which comprises administering to the individual a variant PAH polypeptide as described herein or a composition as described herein. In some aspects, the present invention provides a method for treating phenylketonuria in an individual in need thereof, which comprises administering to the individual a nucleic acid encoding a variant PAH polypeptide as described herein or a nucleic acid as described herein. In some aspects, the present invention provides a method for treating phenylketonuria in an individual in need thereof, which comprises administering to the individual an rAAV vector as described herein. In some aspects, the present invention provides a method for treating phenylketonuria in an individual in need thereof, which comprises administering to the individual an rAAV particle as described herein. In some embodiments, the present invention provides a method for treating phenylketonuria in an individual in need thereof, which comprises administering to the individual a composition as described herein. In some embodiments, the present invention provides a method for treating phenylketonuria in an individual in need thereof, which comprises administering to the individual a cell as described herein. In some embodiments, the individual lacks PAH activity.

[0028] In some aspects, the present invention provides a method for reducing the level of phenylalanine in the blood of an individual in need thereof, which comprises administering to the individual a variant PAH polypeptide as described herein. In some aspects, the present invention provides a method for reducing the level of phenylalanine in the blood of an individual in need thereof, which comprises administering to the individual a nucleic acid encoding a variant PAH polypeptide as described herein or a nucleic acid as described herein. In some aspects, the present invention provides a method for reducing the level of phenylalanine in the blood of an individual in need thereof, which comprises administering to the individual an rAAV vector as described herein. In some aspects, the present invention provides a method for reducing the level of phenylalanine in the blood of an individual in need thereof, which comprises administering to the individual an rAAV particle as described herein. In some aspects, the present invention provides a method for reducing the level of phenylalanine in the blood of an individual in need thereof, which comprises administering to the individual a composition as described herein. In some embodiments, the level of phenylalanine in the blood of the individual before treatment is elevated compared to the level of phenylalanine in the blood of a peer-matched control individual. In some aspects, the present invention provides a method for reducing the level of phenylalanine in the blood of an individual in need thereof, which comprises administering to the individual a cell as described herein.

[0029] In some embodiments, the nucleic acid, rAAV vector, rAAV particle, composition, or cell is administered intravenously, intraarterially, intrahepatically, intraportally, intraperitoneally, or subcutaneously. In some embodiments, the administration is combined with another therapy. In some embodiments, the other therapy is treatment with tetrahydrobiopterin, treatment with phenylalanine ammonia-lyase (PAL) or polyethylene glycolated PAL, or a phenylalanine-restricted diet.

[0030] In some aspects, the invention provides methods for preparing PAH polypeptides, which include culturing the cells as described herein under conditions that produce PAH polypeptides. In some embodiments, the method further includes purifying the PAH polypeptide.

[0031] In some aspects, the invention provides kits that contain variant PAH polypeptides as described herein. In some embodiments, the invention provides kits that contain the nucleic acids as described herein, the rAAV vectors as described herein, the rAAV particles as described herein, or the compositions as described herein. In some embodiments, the kit further includes instructions for use; buffers and / or pharmaceutically acceptable excipients; and / or vials, bottles, and / or syringes.

[0032] In some aspects, the invention provides an expression cassette for expressing a transgene in hepatocytes, wherein the expression cassette contains a transgene operably linked to a promoter and an enhancer, wherein the promoter includes the murine transthyretin (mTTR) promoter, and the enhancer includes one or two modified prothrombin enhancers (pPrT2), one or two modified α1-microbikunin enhancers (mA1MB2), a modified murine albumin enhancer (mEalb), hepatitis B virus enhancer II (HEII), or CRM8 enhancer. In some embodiments, the mTTR promoter is the mTTR482 promoter. In some embodiments, the enhancer is on the 5' side of the mTTR promoter.

[0033] In some aspects, the invention provides an expression cassette for expressing a transgene in hepatocytes, wherein the expression cassette contains a transgene operably linked to a promoter and a 3' element, wherein the promoter includes the murine transthyretin (mTTR) promoter, and the 3' element is the albumin 3' element (3'Alb) or the albumin 3' element linked to the human α1-antitrypsin scaffold / matrix attachment region (SMAR) (3'AlbSMAR). In some embodiments, the mTTR promoter is the mTTR482 promoter. In some embodiments, the 3' element is on the 3' side of the transgene.

[0034] In some aspects, the present invention provides an expression cassette for expressing a transgene in hepatocytes, wherein the expression cassette comprises a transgene operably linked to a promoter and an enhancer and a 3'-element, wherein the promoter comprises a murine transthyretin (mTTR) promoter, and the enhancer comprises one or two modified prothrombin enhancers (pPrT2), one or two modified α1-micro bikunin enhancers (mA1MB2), a modified murine albumin enhancer (mEalb), hepatitis B virus enhancer II (HEII) or CRM8 enhancer, and wherein the 3'-element is an albumin 3'-element (3'Alb) or an albumin 3'-element (3'AlbSMAR) linked to a human α1-antitrypsin scaffold / matrix attachment region (SMAR). In some embodiments, the mTTR promoter is the mTTR482 promoter. In some embodiments, the enhancer is on the 5'-side of the mTTR promoter. In some embodiments, the 3'-element is located on the 3'-side of the transgene.

[0035] In some embodiments, the expression cassette further comprises an intron. In some embodiments, the intron is a chicken β-actin / rabbit β-globin hybrid intron. In some embodiments, the expression cassette further comprises a polyadenylation signal. In some embodiments, the polyadenylation signal is a bovine growth hormone polyadenylation signal.

[0036] In some embodiments, the transgene encodes a PAH polypeptide or a variant PAH polypeptide. In some embodiments, the present invention provides a vector comprising the expression cassette as described herein. In some embodiments, the vector is a recombinant adeno-associated virus (rAAV) vector.

[0037] In some embodiments, the present invention provides an rAAV vector comprising the expression cassette as described herein, the expression cassette being flanked by one or more AAV inverted terminal repeat (ITR) sequences. In some embodiments, the expression cassette is flanked by two AAV ITRs. In some embodiments, the AAV ITR is an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAVDJ, caprine AAV, bovine AAV or murine AAV serotype ITR. In some embodiments, the AAV ITR is an AAV2 ITR.

[0038] In some embodiments, the vector is a self-complementary vector. In some embodiments, the vector comprises a first nucleic acid sequence encoding a PAH polypeptide and a second nucleic acid sequence encoding the complement of the PAH polypeptide, wherein the first nucleic acid sequence can form intrastrand base pairs with the second nucleic acid sequence along most or all of its length. In some embodiments, the first nucleic acid sequence and the second nucleic acid sequence are joined by a mutated AAV ITR, wherein the mutated AAV ITR comprises a deletion in the D region and a mutation in the terminal unwinding sequence.

[0039] In some embodiments, the present invention provides rAAV particles comprising an rAAV vector as described herein. In some embodiments, the AAV viral particles comprise AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV2 / 2-7m8, AAV DJ, AAV2N587A, AAV2E548A, AAV2 N708A, AAV2 V708K, caprine AAV, AAV1 / AAV2 chimeric, bovine AAV, murine AAV, or rAAV2 / HBoV1 serotype capsids. In some embodiments, the AAV viral particles comprise an engineered AAV capsid. In some embodiments, the engineered AAV capsid is a DJ capsid or an LK03 capsid. In some embodiments, the ITRs and capsids of the rAAV viral particles are derived from the same AAV serotype. In some embodiments, the ITRs and capsids of the rAAV viral particles are derived from different AAV serotypes. In some embodiments, the present invention provides a composition comprising an rAAV particle as described herein. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier.

[0040] Specifically, the present invention includes but is not limited to the following:

[0041] 1. A variant phenylalanine hydroxylase (PAH) polypeptide comprising two amino acid substitutions, wherein the amino acid substitutions are at positions selected from M180, K199, S250, and G256 of the wild-type human PAH polypeptide.

[0042] 2. A variant phenylalanine hydroxylase (PAH) polypeptide comprising three amino acid substitutions, wherein the amino acid substitutions are at positions selected from M180, K199, S250, and G256 of the wild-type human PAH polypeptide.

[0043] 3. A variant phenylalanine hydroxylase (PAH) polypeptide comprising four amino acid substitutions at positions M180, K199, S250, and G256 of the wild-type human PAH polypeptide.

[0044] 4. The variant PAH polypeptide according to any one of items 1-3, wherein the amino acid substitutions include one or more of M180T, K199P, S250P, and G256A.

[0045] 5. The variant PAH polypeptide according to any one of items 1-4, wherein the amino acid substitutions include K199P, S250P, and G256A; M180T, S250P, and G256A; M180T, K199P, and G256A; or M180T, K199P, and S250P.

[0046] 6. The variant PAH polypeptide according to any one of items 1-5, wherein the amino acid substitutions include M180T, K199P, S250P, and G256A.

[0047] 7. The variant PAH polypeptide according to any one of items 1-6, wherein the variant PAH polypeptide further comprises H264P, G272A, G272P, P275L, P279Q, G272P, and P275L, or T323R and F327T amino acid substitutions.

[0048] 8. The variant PAH polypeptide according to any one of items 1-7, wherein the wild-type human PAH polypeptide comprises the amino acid sequence of SEQ ID NO:1.

[0049] 9. The variant PAH polypeptide according to any one of items 1-8, wherein the variant PAH polypeptide is a human PAH polypeptide.

[0050] 10. The variant PAH polypeptide according to any one of items 1-9, wherein the variant PAH polypeptide comprises an amino acid sequence that is at least about 80% identical to the amino acid sequence of SEQ ID NO:3.

[0051] 11. The variant PAH polypeptide according to any one of items 1-6, wherein the variant PAH polypeptide comprises the amino acid sequence of SEQ ID NO:3.

[0052] 12. A variant PAH according to any one of items 1 - 11, wherein the variant PAH polypeptide further comprises one or more amino acid substitutions selected from G33A, G46A, G46P, G103A, G139A, G139P, G148A, G188A, G218A, G239A, G247A, G257A, G272A, G289A, G307A, G312A, G332A, G337A, G344A, G352A, and G442A of the wild - type human PAH polypeptide.

[0053] 13. A variant PAH according to any one of items 1 - 12, wherein the variant PAH polypeptide further comprises one or more amino acid substitutions selected from P9G, G10V, G12S, K184R, K192R, S196A, Y206H, H220R, Q336E, E360D, I374C, N376E, N401T, I421V, I441V, S446H of the wild - type human PAH polypeptide, and addition of S at position 453 of the wild - type human PAH polypeptide.

[0054] 14. A variant PAH according to any one of items 1 - 13, wherein the variant PAH polypeptide further comprises one or more amino acid substitutions selected from F240W, A246P, G247A, Y268W, C284F, T323R, F327Y, E319P, I306(Y,F), K113P, G188A, F191Y, T193R, Y206H, G337P, and N376P of the wild - type human PAH polypeptide.

[0055] 15. A variant PAH polypeptide, wherein the variant PAH polypeptide comprises one or more amino acid substitutions selected from G33A, G46A, G46P, G103A, G139A, G139P, G148A, G188A, G218A, G239A, G247A, G257A, G272A, G289A, G307A, G312A, G332A, G337A, G344A, G352A, and G442A of the wild - type human PAH polypeptide.

[0056] 16. A variant PAH polypeptide, wherein the variant PAH polypeptide comprises one or more amino acid substitutions selected from P9G, G10V, G12S, K184R, K192R, S196A, Y206H, H220R, Q336E, E360D, I374C, N376E, N401T, I421V, I441V, S446H of the wild - type human PAH polypeptide, and addition of S at position 453 of the wild - type human PAH polypeptide.

[0057] 17. A variant PAH polypeptide, wherein the variant PAH polypeptide comprises one or more amino acid substitutions selected from F240W, A246P, G247A, Y268W, C284F, T323R, F327Y, E319P, I306(Y,F), K113P, G188A, F191Y, T193R, Y206H, G337P, and N376P of the wild-type human PAH polypeptide.

[0058] 18. The variant PAH polypeptide according to any one of items 1 - 17, wherein the variant PAH polypeptide comprises an N-terminal truncation.

[0059] 19. The variant PAH polypeptide according to item 18, wherein the N-terminal truncation comprises truncation of the N-terminal regulatory domain.

[0060] 20. The variant PAH polypeptide according to item 18 or 19, wherein the N-terminal truncation comprises truncation of amino acid residues 1 - 102 of the wild-type PAH polypeptide.

[0061] 21. The variant PAH polypeptide according to any one of items 1 - 20, wherein the variant PAH polypeptide comprises a C-terminal truncation.

[0062] 22. The variant PAH polypeptide according to item 21, wherein the C-terminal truncation comprises truncation of the tetramerization domain.

[0063] 23. The variant PAH polypeptide according to item 21 or 22, wherein the C-terminal truncation comprises truncation of amino acid residues 429 - 452 of the wild-type PAH polypeptide.

[0064] 24. The variant PAH polypeptide according to any one of items 1 - 23, wherein the variant PAH polypeptide comprises an amino acid sequence corresponding to amino acid residues 103 - 428 of the wild-type PAH polypeptide.

[0065] 25. The variant PAH polypeptide according to any one of items 1 - 24, wherein the variant PAH polypeptide comprises one or more amino acid substitutions to eliminate potential protease cleavage sites.

[0066] 26. The variant PAH polypeptide according to item 25, wherein the one or more amino acid substitutions that eliminate potential protease cleavage sites are located at positions 270 - 295 and / or 380 - 405 of the wild-type PAH polypeptide.

[0067] 27. The variant PAH polypeptide according to any one of items 1 - 26, wherein the variant PAH polypeptide is fused to a liver-targeting polypeptide.

[0068] 28. The variant PAH polypeptide according to item 27, wherein the liver-targeting polypeptide is HGF or a fragment thereof or a glycoprotein that binds to the asialoglycoprotein receptor of hepatocytes.

[0069] 29. The variant PAH polypeptide according to any one of items 1-25, wherein the variant PAH polypeptide is pegylated and / or nitrosylated.

[0070] 30. The variant PAH polypeptide according to item 26, wherein the variant PAH polypeptide contains an I374C amino acid substitution, and the cys residue at position 374 is nitrosylated.

[0071] 31. A composition comprising the variant PAH polypeptide according to any one of items 1-30.

[0072] 32. The composition according to item 31, wherein the composition further comprises a pharmaceutically acceptable carrier.

[0073] 33. An isolated nucleic acid encoding the variant PAH polypeptide according to any one of items 1-30.

[0074] 34. The isolated nucleic acid according to item 33, wherein the nucleic acid encoding the variant PAH polypeptide is operably linked to a promoter.

[0075] 35. The isolated nucleic acid according to item 34, wherein the promoter is selected from the cytomegalovirus (CMV) immediate-early promoter, RSV LTR, MoMLV LTR, phosphoglycerate kinase-1 (PGK) promoter, simian virus 40 (SV40) promoter, CK6 promoter, transthyretin promoter (TTR), mTTR482 promoter, mA1MB2-mTTR482 promoter, TK promoter, tetracycline-responsive promoter (TRE), HBV promoter, hAAT promoter, LSP promoter, LP1 promoter, chimeric liver-specific promoter (LSP), E2F promoter, telomerase (hTERT) promoter; cytomegalovirus enhancer / chicken β-actin / rabbit β-globin promoter (CAG) promoter, elongation factor 1-α promoter (EF1-α) promoter, human β-glucuronidase promoter, chicken β-actin (CBA) promoter, modified chicken β-actin (CBA) promoter or SEQ ID NO:17, Rous sarcoma virus (RSV) LTR promoter, dihydrofolate reductase promoter and β-actin promoter.

[0076] 36. The isolated nucleic acid according to item 34 or 35, wherein the promoter is the LP1 promoter or the mA1MB2-mTTR482 promoter.

[0077] 37. The isolated nucleic acid according to any one of items 33-36, wherein the nucleic acid further comprises a polyadenylation signal.

[0078] 38. The isolated nucleic acid according to item 37, wherein the polyadenylation signal is a bovine growth hormone polyadenylation signal, an SV40 polyadenylation signal, or an HSV TK pA.

[0079] 39. The isolated nucleic acid according to any one of items 33-38, wherein the nucleic acid further comprises an intron.

[0080] 40. The isolated nucleic acid according to item 39, wherein the intron is a chicken β-actin (CBA) / rabbit β-globin hybrid intron.

[0081] 41. The isolated nucleic acid according to item 39, wherein the intron is a modified chicken β-actin (CBA) / rabbit β-globin hybrid intron of SEQ ID NO:15.

[0082] 42. The isolated nucleic acid according to any one of items 33-41, wherein the nucleic acid further comprises one or more ITRs.

[0083] 43. The isolated nucleic acid according to any one of items 33-42, wherein the nucleic acid further comprises filler nucleic acid.

[0084] 44. The isolated nucleic acid according to item 43, wherein the filler nucleic acid is optimized to remove ATG sequences.

[0085] 45. The isolated nucleic acid according to item 44, wherein the filler nucleic acid is the A1AT intron filler sequence of SEQ ID NO:16.

[0086] 46. An isolated nucleic acid encoding a human PAH polypeptide, wherein the nucleic acid is codon-optimized.

[0087] 47. The isolated nucleic acid according to item 46, wherein the nucleic acid sequence is at least 80% identical to the nucleic acid sequence of SEQ ID NO:14.

[0088] 48. The isolated nucleic acid according to item 46, wherein the nucleic acid comprises the nucleic acid sequence of SEQ ID NO:14.

[0089] 49. The isolated nucleic acid according to item 33, wherein the nucleic acid is mRNA.

[0090] 50. A composition comprising the nucleic acid according to any one of items 33-49.

[0091] 51. The composition according to item 50, wherein the composition further comprises a pharmaceutically acceptable carrier.

[0092] 52. A vector comprising the nucleic acid according to any one of items 33 - 49.

[0093] 53. The vector according to item 52, wherein the vector is a recombinant adeno - associated virus (rAAV) vector.

[0094] 54. An rAAV vector comprising the nucleic acid according to any one of items 33 - 41 or 43 - 49, the nucleic acid being flanked by one or more AAV inverted terminal repeat (ITR) sequences.

[0095] 55. The rAAV vector according to item 54, wherein the nucleic acid according to any one of items 33 - 48 is flanked by two AAV ITRs.

[0096] 56. The rAAV vector according to item 54 or 55, wherein the AAV ITR is an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV DJ, caprine AAV, bovine AAV or murine AAV serotype ITR.

[0097] 57. The rAAV vector according to any one of items 54 - 56, wherein the AAV ITR is an AAV2 ITR.

[0098] 58. The rAAV vector according to item 57, wherein the rAAV vector comprises, from 5' to 3', an AAV2 ITR, a promoter, an intron, a nucleic acid encoding a PAH polypeptide, filler nucleic acid, a polyadenylation signal and an AAV2 ITR.

[0099] 59. The rAAV vector according to item 58, wherein the promoter is an m1A1MB2 - mTTR482 promoter or an LP1 promoter.

[0100] 60. The rAAV vector according to item 58 or 59, wherein the intron is a chicken β - actin (CBA) / rabbit β - globin hybrid intron.

[0101] 61. The rAAV vector according to any one of items 58 - 59, wherein the PAH polypeptide is a variant PAH polypeptide according to any one of items 1 - 30.

[0102] 62. The rAAV vector according to any one of items 58 - 60, wherein the nucleic acid encoding the PAH polypeptide is a codon - optimized nucleic acid according to any one of items 46 - 48.

[0103] 63. The rAAV vector according to any one of items 58 - 62, wherein the filler nucleic acid comprises a nucleic acid from an intron of the human alpha-1 antitrypsin gene.

[0104] 64. The rAAV vector according to item 63, wherein the intron of the human alpha-1 antitrypsin gene has been mutated to remove the ATG sequence.

[0105] 65. The rAAV vector according to any one of items 58 - 64, wherein the polyadenylation signal is the bovine growth hormone polyadenylation signal.

[0106] 66. The rAAV vector according to any one of items 53 - 65, wherein the vector is a self-complementary vector.

[0107] 67. The rAAV vector according to item 66, wherein the vector comprises a first nucleic acid sequence encoding the PAH polypeptide and a second nucleic acid sequence encoding the complement of the PAH polypeptide, wherein the first nucleic acid sequence can form in-chain base pairs with the second nucleic acid sequence along most or all of its length.

[0108] 68. The rAAV vector according to item 67, wherein the first nucleic acid sequence and the second nucleic acid sequence are linked by a mutated AAV ITR, wherein the mutated AAV ITR comprises a deletion in the D region and a mutation in the terminal unwinding sequence.

[0109] 69. An rAAV particle comprising the rAAV vector according to any one of items 53 - 68.

[0110] 70. The rAAV particle according to item 69, wherein the AAV viral particle comprises an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV2 / 2-7m8, AAV DJ, AAV2 N587A, AAV2 E548A, AAV2 N708A, AAV2 V708K, caprine AAV, AAV1 / AAV2 chimeric, bovine AAV, murine AAV or rAAV2 / HBoV1 serotype capsid.

[0111] 71. The rAAV particle according to item 69, wherein the AAV viral particle comprises an engineered AAV capsid.

[0112] 72. The rAAV particle according to item 71, wherein the engineered AAV capsid is a DJ capsid or an LK03 capsid.

[0113] 73. The rAAV particle according to item 69 or 70, wherein the ITR and capsid of the rAAV viral particle are derived from the same AAV serotype.

[0114] 74. The rAAV particle according to item 69 or 70, wherein the ITR and capsid of the rAAV viral particle are derived from different AAV serotypes.

[0115] 75. The rAAV particle according to any one of items 69-70 or 73-74, wherein the rAAV viral particle comprises an AAV8 capsid.

[0116] 76. The rAAV particle according to item 74, wherein the rAAV viral particle comprises an AAV8 capsid, and wherein the vector comprises AAV2 ITR.

[0117] 77. A composition comprising the rAAV particle according to any one of items 69-76.

[0118] 78. The composition according to item 77, wherein the composition further comprises a pharmaceutically acceptable carrier.

[0119] 79. A cell comprising the nucleic acid according to any one of items 33-49 or the vector according to item 52 or 53 or the rAAV vector according to any one of items 54-68.

[0120] 80. A method for producing a variant PAH polypeptide, the method comprising culturing the cell according to item 79 under conditions for producing the variant PAH polypeptide.

[0121] 81. The method according to item 80, which further comprises the step of purifying the variant PAH polypeptide.

[0122] 82. A method for treating phenylketonuria in an individual in need thereof, the method comprising administering to the individual the variant PAH polypeptide according to any one of items 1-30 or the composition according to item 31 or 32.

[0123] 83. A method for treating phenylketonuria in an individual in need thereof, the method comprising administering to the individual the nucleic acid encoding the variant PAH polypeptide according to any one of items 1-30 or the nucleic acid according to item 33, 34 or 49.

[0124] 84. A method for treating phenylketonuria in an individual in need thereof, the method comprising administering to the individual the rAAV vector according to any one of items 53-68.

[0125] 85. A method for treating phenylketonuria in an individual in need thereof, comprising administering to the individual an rAAV particle according to any one of items 69-76.

[0126] 86. A method for treating phenylketonuria in an individual in need thereof, comprising administering to the individual a composition according to item 31, 32, 50, 51, 77 or 78.

[0127] 87. A method for treating phenylketonuria in an individual in need thereof, comprising administering to the individual a cell according to item 79.

[0128] 88. The method according to any one of items 82-87, wherein the individual lacks PAH activity.

[0129] 89. A method for reducing the level of phenylalanine in the blood of an individual in need thereof, comprising administering to the individual a variant PAH polypeptide according to any one of items 1-30 or a composition according to item 31 or 32.

[0130] 90. A method for reducing the level of phenylalanine in the blood of an individual in need thereof, comprising administering to the individual a nucleic acid encoding a variant PAH polypeptide according to any one of items 1-30 or a nucleic acid according to item 33, 34 or 49.

[0131] 91. A method for reducing the level of phenylalanine in the blood of an individual in need thereof, comprising administering to the individual an rAAV vector according to any one of items 53-68.

[0132] 92. A method for reducing the level of phenylalanine in the blood of an individual in need thereof, comprising administering to the individual an rAAV particle according to any one of items 69-76.

[0133] 93. A method for reducing the level of phenylalanine in the blood of an individual in need thereof, comprising administering to the individual a composition according to item 31, 32, 50, 51, 77 or 78.

[0134] 94. A method for reducing the level of phenylalanine in the blood of an individual in need thereof, comprising administering to the individual a cell according to item 79.

[0135] 95. The method according to any one of items 89-94, wherein the level of phenylalanine in the blood of the individual before treatment is elevated compared to the level of phenylalanine in the blood of an equivalently matched control individual.

[0136] 96. The method according to any one of items 82 - 95, wherein the variant PAH polypeptide, the nucleic acid, the rAAV vector, the rAAV particle, the composition or the cell is administered intravenously, intraarterially, intrahepatically, intraportally, intraperitoneally or subcutaneously.

[0137] 97. The method according to any one of items 82 - 96, wherein the administration is combined with another therapy.

[0138] 98. The method according to item 97, wherein the another therapy is treatment with tetrahydrobiopterin, treatment with phenylalanine ammonia-lyase (PAL) or polyethylene glycolated PAL, or a phenylalanine-restricted diet.

[0139] 99. A method for preparing a PAH polypeptide, which comprises culturing the cells according to item 79 under conditions for producing the PAH polypeptide.

[0140] 100. The method according to item 99, which further comprises purifying the PAH polypeptide.

[0141] 101. A kit, which comprises a variant PAH polypeptide according to any one of items 1 - 24.

[0142] 102. A kit, which comprises a nucleic acid according to any one of items 33 - 46, an rAAV vector according to any one of items 53 - 68, an rAAV particle according to any one of items 69 - 76, or a composition according to item 77 or 78.

[0143] 103. The kit according to item 101 or 102, wherein the kit further comprises instructions for use; a buffer and / or a pharmaceutically acceptable excipient; and / or a bottle, a vial and / or a syringe.

[0144] 104. An expression cassette for expressing a transgene in hepatocytes, wherein the expression cassette comprises a transgene operably linked to a promoter and an enhancer, wherein the promoter comprises a mouse transthyretin (mTTR) promoter, and the enhancer comprises one or two modified prothrombin enhancers (pPrT2), one or two modified α1-microbikunin enhancers (mA1MB2), a modified mouse albumin enhancer (mEalb), a hepatitis B virus enhancer II (HEII) or a CRM8 enhancer.

[0145] 105. The expression cassette according to item 104, wherein the mTTR promoter is the mTTR482 promoter.

[0146] 106. The expression cassette according to item 104 or 105, wherein the enhancer is on the 5' side of the mTTR promoter.

[0147] 107. An expression cassette for expressing a transgene in hepatocytes, wherein the expression cassette comprises a transgene operably linked to a promoter and a 3'-element, wherein the promoter comprises a murine thyroxine-binding globulin (mTTR) promoter, and the 3'-element is an albumin 3'-element (3'Alb) or an albumin 3'-element linked to a human α1-antitrypsin scaffold / matrix attachment region (SMAR) (3'AlbSMAR).

[0148] 108. The expression cassette according to item 107, wherein the mTTR promoter is the mTTR482 promoter.

[0149] 109. The expression cassette according to item 107 or 108, wherein the 3'-element is located on the 3'-side of the transgene.

[0150] 110. An expression cassette for expressing a transgene in hepatocytes, wherein the expression cassette comprises a transgene operably linked to a promoter, an enhancer and a 3'-element, wherein the promoter comprises a murine thyroxine-binding globulin (mTTR) promoter, and the enhancer comprises one or two modified prothrombin enhancers (pPrT2), one or two modified α1-microbikunin enhancers (mA1MB2), a modified murine albumin enhancer (mEalb), a hepatitis B virus enhancer II (HEII) or a CRM8 enhancer, and wherein the 3'-element is an albumin 3'-element (3'Alb) or an albumin 3'-element linked to a human α1-antitrypsin scaffold / matrix attachment region (SMAR) (3'AlbSMAR).

[0151] 111. The expression cassette according to item 110, wherein the mTTR promoter is the mTTR482 promoter.

[0152] 112. The expression cassette according to item 110 or 111, wherein the enhancer is on the 5'-side of the mTTR promoter.

[0153] 113. The expression cassette according to any one of items 110-112, wherein the 3'-element is located on the 3'-side of the transgene.

[0154] 114. The expression cassette according to any one of items 104-113, wherein the expression cassette further comprises an intron.

[0155] 115. The expression cassette according to item 114, wherein the intron is a chicken β-actin / rabbit β-globin hybrid intron.

[0156] 116. The expression cassette according to any one of items 104 - 115, wherein the expression cassette further comprises a polyadenylation signal.

[0157] 117. The expression cassette according to item 116, wherein the polyadenylation signal is a bovine growth hormone polyadenylation signal.

[0158] 118. The expression cassette according to any one of items 104 - 117, wherein the transgene encodes a PAH polypeptide or a variant PAH polypeptide.

[0159] 119. The expression cassette according to item 118, wherein the variant PAH polypeptide is the variant PAH polypeptide according to any one of items 1 - 30.

[0160] 120. A vector comprising the expression cassette according to any one of items 104 - 119.

[0161] 121. The vector according to item 120, wherein the vector is a recombinant adeno - associated virus (rAAV) vector.

[0162] 122. An rAAV vector comprising the expression cassette according to any one of items 104 - 119, the expression cassette being flanked by one or more AAV inverted terminal repeat (ITR) sequences.

[0163] 123. The rAAV vector according to item 122, wherein the expression cassette according to any one of items 104 - 119 is flanked by two AAV ITRs.

[0164] 124. The rAAV vector according to item 122 or 123, wherein the AAV ITR is an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV DJ, caprine AAV, bovine AAV or murine AAV serotype ITR.

[0165] 125. The rAAV vector according to any one of items 122 - 124, wherein the AAV ITR is an AAV2 ITR.

[0166] 126. The rAAV vector according to any one of items 122 - 125, wherein the vector is a self - complementary vector.

[0167] 127. The rAAV vector according to item 126, wherein the vector comprises a first nucleic acid sequence encoding the PAH polypeptide and a second nucleic acid sequence encoding the complement of the PAH polypeptide, and wherein the first nucleic acid sequence can form intrastrand base pairs with the second nucleic acid sequence along most or all of its length.

[0168] 128. The rAAV vector according to item 127, wherein the first nucleic acid sequence and the second nucleic acid sequence are linked by a mutated AAV ITR, and wherein the mutated AAV ITR comprises a deletion in the D region and a mutation in the terminal unwinding sequence.

[0169] 129. An rAAV particle comprising the rAAV vector according to any one of items 122 - 127.

[0170] 130. The rAAV particle according to item 128, wherein the AAV viral particle comprises an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV2 / 2 - 7m8, AAV DJ, AAV2 N587A, AAV2 E548A, AAV2 N708A, AAV2 V708K, caprine AAV, AAV1 / AAV2 chimeric, bovine AAV, murine AAV, or rAAV2 / HBoV1 serotype capsid.

[0171] 131. The rAAV particle according to item 130, wherein the AAV viral particle comprises an engineered AAV capsid.

[0172] 132. The rAAV particle according to item 131, wherein the engineered AAV capsid is a DJ capsid or an LK03 capsid.

[0173] 133. The rAAV particle according to item 131 or 132, wherein the ITR and capsid of the rAAV viral particle are derived from the same AAV serotype.

[0174] 134. The rAAV particle according to item 131 or 132, wherein the ITR and capsid of the rAAV viral particle are derived from different AAV serotypes.

[0175] 135. A composition comprising the rAAV particle according to any one of items 129 - 134.

[0176] 136. The composition according to item 135, wherein the composition further comprises a pharmaceutically acceptable carrier. Description of the Drawings

[0177] Figures 1A - 1C Shows the optimization of the liver promoter. Figure 1A Shows a schematic diagram of the proviral plasmid construct. Construct mTTR482 (number 1) was modified by adding various liver enhancer elements (construct numbers 2 - 6) or 3' stability elements (construct numbers 7 - 8). A construct containing the CBA promoter was used for comparison. All constructs contain flanking ITRs, a hybrid intron, and a SEAP reporter. The constructs were then transfected into Huh7 cells ( Figure 1B ) or HepG2 cells ( Figure 1C ). The secreted SEAP activity levels were measured 72 hours after transfection and normalized by the β-galactosidase levels from the co-transfected LacZ plasmid. Each evaluation included n = 3 - 4 / plasmid.

[0178] Figure 2A and Figure 2B Shows the evaluation of the liver promoter by in vivo SEAP production. Figure 2A Shows the SEAP levels in normal C57BL / 6 mice. Figure 2B Shows the SEAP levels in PAH enu2 mice. In both experiments, the plasmid vectors were delivered by hydrodynamic injection, and the plasma SEAP activity was measured at different time points. Each treatment group contained n = 3 - 6 animals.

[0179] Figures 3A - 3D Shows the comparison of liver promoter performance in PAH enu2 mice. rAAV8 vectors expressing mPAH from the sc-LP1 or ss-A1MB2-mTTR promoter (leader) were administered to male PAH enu2 mice at 4e10 (L) or 1e11 (M) VG / mouse. Figure 3A Shows the blood Phe levels over a 56-day time course. Levels are the mean of n = 8 / group, except for the initial animals with n = 2. Figure 3B Shows the blood Phe levels on day 56. Plasma Phe levels are shown for animals treated with two constructs administered at 4e10 or 1e11 VG / mouse or untreated animals. Figure 3C Shows the blood Tyr levels. Levels were measured before vector administration (pre-bleed) and 7 and 56 days after vector administration. Each value is the mean of n = 8 / group. Figure 3D Shows the vector genomes in the liver on day 56. Vector copies were determined by qPCR and shown as the mean of n = 5 / group.

[0180] Figures 4A - 4D Shows for PAH enu2Analysis of the brains of mice. Five animals from untreated, ss-mA1MB2-mTTR (leader) construct (4e10 and 1e11 vg / mouse) -treated, and sc-LP1 (1e11 vg / mouse) -treated PAH mice were sacrificed 56 days after treatment. The brains were perfused with PBS and collected for analysis. Balb / C mice were used as wild-type controls (WT). enu2 Phenylalanine (Phe) levels in the brain are shown. Figure 4A The correlation between blood and brain Phe levels is shown. Figure 4B Dopamine levels in the brain are shown. Figure 4C Serotonin levels in the brain are shown. All values represent the mean of n = 5 / group (except for untreated PAH mice, n = 2). The studies were conducted as described. Figure 4D The codon optimization of human PAH cDNA is shown. The cDNA encoding FLAG-tagged hPAH was cloned into the mTTR482-hPAH-BGHpA expression plasmid. hPAH production was tested in vitro and in vivo. enu2 FLAG-hPAH levels in Huh7 cells are shown. The plasmid was transfected, and cell lysates were prepared 48 hours later. PAH protein levels in the cell lysates were analyzed by Western blotting. Figures 3A - 3C FLAG-hPAH levels in the livers of C57BL / 6 mice are shown. The plasmid was administered by hydrodynamic injection, and the livers were collected 24 hours later. FLAG-tagged hPAH levels in the liver lysates were quantified using FLAG-ELISA and normalized by total protein. Values represent the mean of n = 4 - 5 animals / group. Abbreviations: C, negative control plasmid; GS, Genscript, GA, GeneArt, GS CpG, Genscript sequence with CpGs removed; non, original hPAH DNA sequence; initial ([[]]) )

[0182] Figure 6A

[0183] Figure 6B is a Western blot showing the expression of human phenylalanine hydroxylase (hPAH) and mouse phenylalanine hydroxylase (mPAH) under the control of different promoters (mTTR482, CBA, and LP1). The expression plasmid was transfected into Huh7 cells, and FLAG-PAH levels in the cell lysates were analyzed using an antibody against FLAG two days later. Figure 5A Figure 5B and Figure 5B Figure 5A

[0181] Figures 3A - 3C Figure 4D Figure 4Cis a Western blot that shows a comparison of in vitro expression of full-length (FL) and double-truncated (DT) human and mouse PAH. Analysis was performed as Figure 6A .

[0184] Figure 6C is a comparison of hPAH and mPAH protein levels in both full-length (FL) and double-truncated (DT) forms. After transfection with the expression plasmid, FLAG-tagged proteins in Huh7 cell lysates were quantified by ELISA.

[0185] Figure 6D is a comparison of hPAH and mPAH mRNA levels. RNA analysis was performed on the Figure 6C materials used in

[0186] Figure 6E is a Western blot that shows an analysis of purified hPAH and mPAH (both produced in full-length and double-truncated forms). Proteins were purified by FLAG affinity column and run on SDS-PAGE gels, followed by detection with anti-FLAG antibody.

[0187] Figure 6F shows the efficacy of rAAV8 vectors encoding hPAH or mPAH in a PKU mouse model. Both hPAH and mPAH were expressed by a self-complementary vector (sc-LP1) with an LP1 promoter. Efficacy was measured as the reduction in blood Phe levels after a single IV injection into PAH enu2 mice.

[0188] Figures 7A - 7C shows the generation of mouse / human hybrid PAH constructs. Figure 7A shows a schematic of the mouse / human hybrid PAH construct. Regions derived from human (green) and mouse (gray) PAH are shown. Figure 7B shows the effect of replacing the N-terminal region of hPAH on protein expression levels. Figure 7C shows the effect of changes in the C-terminal region of hPAH on protein expression levels. Experiments were performed by transfecting plasmids with a CBA-PAH expression cassette into 293T cells. After 48 hours, cells were harvested for quantification of FLAG-PAH by FLAG ELISA.

[0189] Figure 8A and Figure 8B show in vitro screening of double-truncated hPAH (hPAH-DT) variants. Figure 8A shows the protein expression levels of plasmid-expressed hPAH protein variants (number 1 to number 8). Figure 8BShows the PAH activity levels of plasmid-expressed hPAH protein variants. All variants were transfected into 293 cells and expressed from plasmids with a CBA promoter. The results of the variant plasmids were compared to similar plasmids expressing human or mouse PAH.

[0190] Figures 9A - 9C Shows the characterization of hPAH-V1-DT derivatives for in vitro PAH production. Figure 9A Shows the PAH activity levels of hPAH-V1-DT derivatives. Figure 9B Shows the PAH protein levels of hPAH-V1-DT derivatives. Figure 9C Shows the specific PAH activity of hPAH-V1-DT derivatives. Results are based on analysis of cell lysates from transfected 293 cells.

[0191] Figures 10A - 10D Shows the repeated analysis of hPAH-V1-DT derivatives for in vitro PAH production. Figure 10A Shows the PAH activity levels of selected hPAH-V1-DT derivatives. Figure 10B Shows the PAH protein levels of hPAH-V1-DT derivatives. Figure 10C Shows the specific PAH activity of hPAH-V1-DT derivatives. Data were generated as Figure 8A and 8B described. Figure 10D Shows the PAH activity of three double mutant forms of variant-1. Data were generated as Figure 8A and 8B described.

[0192] Figures 11A - 11C Shows an in vitro comparison of full-length hPAH-V1 with mouse PAH (mPAH) and human PAH (hPAH). Figure 11A Is a western blot analysis of protein expression. Figure 11B Shows the PAH protein levels by FLAG-ELISA. Figure 11C Shows the PAH activity levels. Data were generated by transfecting an expression plasmid with a liver promoter A1MB2-mTTR482 encoding the full-length PAH protein into Huh7 and subsequently analyzing cell lysates. m indicates the marker lane.

[0193] Figures 12A - 12C Shows in PAH enu2 Comparison of the efficacy of an rAAV vector expressing full-length hPAH-V1 in PAH mice with the efficacy of mouse and human PAH. Figure 12A Shows the blood phenylalanine levels. Figure 12B Shows the blood tyrosine levels. Figure 12CShows blood phenylalanine metabolite levels. P values are represented as: * for P < 0.05, ** for P < 0.01, and *** for P < 0.001. All treatment groups consisted of AAV8 vectors expressing FLAG-tagged PAH from the liver promoter. Vectors were injected via the IV route at 3e11 (hPAH, hPAH-V1, and mPAH) or 1e12 vg / mouse (hPAH and hPAH-V1) on day 0. Initial PAH enu2 Mice and heterozygotes (HET) were used as negative and positive controls, respectively.

[0194] Figures 13A - 13C Shows the quantification of rAAV vector genomes and 3x-FLAG-PAH levels in the liver. Figure 13A Shows PAH protein levels. Figure 13B Shows PAH activity levels. Figure 13C Shows the vector genome copies in the liver. As Figures 12A - 12C described, experiments were performed and livers were collected 69 days after vector administration. In each figure, data for the 3e11 VG / mouse treatment groups (hPAH, hPAH-V1, and mPAH) and the 1e12 vg / mouse treatment groups (hPAH, hPAH-V1) are shown. P values, *** for < 0.001.

[0195] Figures 14A - 14D Shows the quantification of various amino acid levels in the brain. Figure 14A Shows brain phenylalanine levels. Figure 14B Shows brain tyrosine levels. Figure 14C Shows the correlation between brain and blood phenylalanine levels. Figure 14D Shows brain tryptophan levels. As Figures 12A - 12C described, experiments were performed. The data shown are from the treatment groups administered at 3e11 VG / mouse (n = 5 / group) (day 69). P values, *** for < 0.001.

[0196] Figures 15A - 15D Shows neurotransmitter levels in the brain. Figure 15A Shows brain dopamine levels. Figure 15B Shows the brain level of the dopamine metabolite DOPAC. Figure 15C Shows brain serotonin levels. Figure 15D Shows the brain level of the serotonin metabolite HIAA. Experiments were performed as Figures 12A - 12C described, and the values are from the 3e11 VG / mouse group (day 69). P values, ** for P < 0.01, and *** for P < 0.001.

[0197] Figures 16A - 16BShows the efficacy comparison of the 3.8 and 4.6 kb A1MB2-mTTR-hPAV-V1 vector genomes. Figure 16A Shows a schematic diagram of the vector. Figure 16B Shows PAH enu2 Efficacy tests in mice. An AAV8 vector expressing hPAH-V1 from a liver promoter (leader) was administered once at 1e11 vg / mouse, and efficacy was measured by blood Phe levels. These vectors were also compared to a 4.6 kb vector with hPAH-V1 and no N-terminal tag (tested at 1e11 and 3e11 vg / mouse).

[0198] Figures 17A - 17C Shows an in vivo comparison of hPAH-V1 and hPAH production in the livers of non-human primates after delivery with an rAAV vector. Figure 17A Shows the levels of rAAV vector genomes in the livers of each individual animal. Figure 17B Shows the levels of vector-derived mRNA in the livers and spleens of each treated animal. The mRNA levels of each animal were normalized to vector genome copies. Figure 17C Shows the detection of FLAG-tagged PAH protein in liver homogenates. Equal loading of lysates was confirmed by detecting the housekeeping protein GAPDH. The experiment was conducted by IV administration of an rAAV vector expressing FLAG-tagged PAH or PAH-V1 from the A1MB2-mTTR promoter at 5e12 g / kg. Tissues were collected after 2 weeks for analysis of vector genomes, vector-derived mRNA, and PAH protein in the liver. Detailed Description

[0199] In some aspects, the invention described herein provides variants of the human PAH (hPAH-V1) polypeptide that contain at least two four-amino acid changes that confer higher levels of PAH protein and / or activity in vitro and in vivo compared to wild-type hPAH. In other aspects, the invention described herein provides improved variants of human PAH (hPAH-V1) that contain at least two, three, or four amino acid changes that confer higher levels of PAH protein and / or activity in vitro and in vivo compared to wild-type hPAH. In some aspects, the invention provides nucleic acids encoding the human PAH variants. In some aspects, the invention provides expression cassettes, recombinant adeno-associated virus (rAAV) vectors and viral particles, and pharmaceutical compositions comprising variant PAH polypeptides of the present disclosure. In other aspects, the invention provides methods for treating phenylketonuria (PKU); for example, by increasing PAH activity, increasing the transport of tyrosine and tryptophan to the brain, and normalizing levels of brain neurotransmitters including dopamine and serotonin. In still other aspects, the invention provides kits for using variant PAH of the present disclosure to treat PKU in an individual.

[0200] I. General Techniques

[0201] Those skilled in the art are generally familiar with and typically use conventional methods to utilize the technologies and procedures described or cited herein, such as the widely used methods described in the following references: Molecular Cloning: A Laboratory Manual (Sambrook et al., 4th Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 2012); Current Protocols in Molecular Biology (edited by F.M. Ausubel, et al., 2003); the series Methods in Enzymology (Academic Press, Inc.); PCR 2: A Practical Approach (edited by M.J. MacPherson, B.D. Hames and G.R. Taylor, 1995); Antibodies, A Laboratory Manual (edited by Harlow and Lane, 1988); Culture of Animal Cells: A Manual of Basic Technique and Specialized Applications (R.I. Freshney, 6th Edition, J.Wiley and Sons, 2010); Oligonucleotide Synthesis (edited by M.J. Gait, 1984); Methods in Molecular Biology, Humana Press; Cell Biology: A Laboratory Notebook (edited by J.E. Cellis, Academic Press, 1998); Introduction to Cell and Tissue Culture (J.P. Mather and P.E. Roberts, Plenum Press, 1998); Cell and Tissue Culture: Laboratory Procedures (edited by A. Doyle, J.B. Griffiths and D.G. Newell, J.Wiley and Sons, 1993 - 8); Handbook of Experimental Immunology (edited by D.M. Weir and C.C. Blackwell, 1996); Gene Transfer Vectors for Mammalian Cells (J.M. Miller and M.P.Calos, ed., 1987); PCR: The Polymerase Chain Reaction, (Mullis et al., eds., 1994); Current Protocols in Immunology (J. E. Coligan et al., eds., 1991); Short Protocols in Molecular Biology (Ausubel et al., eds., J. Wiley and Sons, 2002); Immunobiology (C. A. Janeway et al., 2004); Antibodies (P. Finch, 1997); Antibodies: A Practical Approach (D. Catty, ed., IRL Press, 1988-1989); Monoclonal Antibodies: A Practical Approach (P. Shepherd and C. Dean, eds., Oxford University Press, 2000); Using Antibodies: A Laboratory Manual (E. Harlow and D. Lane, Cold Spring Harbor Laboratory Press, 1999); The Antibodies (M. Zanetti and J. D. Capra, eds., Harwood Academic Publishers, 1995); and Cancer: Principles and Practice of Oncology (V. T. DeVita et al., eds., J. B. Lippincott Company, 2011).

[0202] II. Definitions

[0203] As used herein, "vector" refers to a recombinant plasmid or virus that contains nucleic acid to be delivered to a host cell, either in vitro or in vivo.

[0204] As used herein, the term "polynucleotide" or "nucleic acid" refers to nucleotides (ribonucleotides or deoxyribonucleotides) in polymeric form of any length. Thus, the term includes, but is not limited to, single-stranded, double-stranded or multi-stranded DNA or RNA; genomic DNA; cDNA; DNA-RNA hybrids; or polymers comprising purine and pyrimidine bases or other natural, chemically modified or biochemically modified nucleobases, unnatural or derivatized nucleobases. The backbone of a polynucleotide can include sugar and phosphate groups (as typically seen in RNA or DNA) or modified or substituted sugars or phosphate groups. Alternatively, the backbone of a polynucleotide can comprise a polymer of synthetic subunits such as phosphoramidates and can thus be an oligodeoxynucleoside phosphoramidate (P-NH2) or a mixed phosphoramidate-phosphodiester oligomer. In addition, double-stranded polynucleotides can be obtained from chemically synthesized single-stranded polynucleotide products by synthesizing the complementary strand and annealing these strands under appropriate conditions or by de novo synthesis of the complementary strand using a DNA polymerase with an appropriate primer.

[0205] The terms "polypeptide" and "protein" are used interchangeably to refer to polymers of amino acid residues and are not limited to a minimum length. Such polymers of amino acid residues can contain natural or unnatural amino acid residues and include, but are not limited to, peptides, oligopeptides, dimers, trimers and polymers of amino acid residues. The definition encompasses both full-length proteins and fragments thereof. The term also includes post-expression modifications of polypeptides such as glycosylation, sialylation, acetylation, phosphorylation and the like. In addition, for the purposes of the present disclosure, "polypeptide" refers to a protein that includes modifications to the native sequence (such as deletions, additions and substitutions, which are generally conservative in nature) as long as the protein retains the desired activity. These modifications may be intentional (such as by site-directed mutagenesis) or may be accidental (such as by mutations in the host producing the protein or due to errors in PCR amplification).

[0206] "Recombinant viral vector" refers to a recombinant polynucleotide vector that contains one or more heterologous sequences (i.e., nucleic acid sequences that are not of viral origin). In the case of a recombinant AAV vector, the recombinant nucleic acid is flanked by at least one, and in embodiments two, inverted terminal repeats (ITRs).

[0207] "Recombinant AAV vector (rAAV vector)" refers to a polynucleotide vector that contains a heterologous sequence (i.e., a nucleic acid sequence not of AAV origin) flanked by one or more, and in embodiments two, AAV inverted terminal repeats (ITRs). When such an rAAV vector is present in a host cell that has been infected with a suitable helper virus (or the helper virus expresses suitable helper functions) and is expressing the AAV rep and cap gene products (i.e., the AAV Rep and Cap proteins), the rAAV vector can be replicated and packaged into infectious virus particles. When an rAAV vector is incorporated into a larger polynucleotide (e.g., in a chromosome or in another vector such as a plasmid used for cloning or transfection), the rAAV vector can be referred to as a "provector", which can be "rescued" by replication and encapsidation in the presence of AAV packaging functions and suitable helper functions. The rAAV vector can be in any of a variety of forms, including but not limited to plasmids, linear artificial chromosomes, complexed with lipids, encapsulated within liposomes, and encapsidated within virus particles (especially AAV particles). The rAAV vector can be packaged in an AAV viral capsid to produce "recombinant adeno-associated virus particles (rAAV particles)".

[0208] "Heterologous" means derived from an entity having a genotype different from the remainder of the entity to which it is compared or into which it is introduced or incorporated. For example, a polynucleotide introduced into a different cell type by genetic engineering techniques is a heterologous polynucleotide (and can encode a heterologous polypeptide when expressed). Similarly, a cellular sequence (e.g., a gene or a portion thereof) incorporated into a viral vector is a heterologous nucleotide sequence relative to the vector.

[0209] The term "transgene" refers to a polynucleotide that is introduced into a cell and is capable of being transcribed into RNA and optionally translated and / or expressed under appropriate conditions. In various aspects, it confers a desired property on the cell into which it is introduced, or otherwise produces a desired therapeutic or diagnostic result.

[0210] "Chicken β-actin (CBA) promoter" refers to a polynucleotide sequence derived from the chicken β-actin gene (e.g., Gallus gallus β-actin, represented by GenBank Entrez Gene ID 396526). As used herein, "chicken β-actin promoter" can refer to a promoter containing a cytomegalovirus (CMV) early enhancer element, the promoter and first exon and intron of the chicken β-actin gene, and the splice acceptor of the rabbit β-globin gene, such as the sequence described by Miyazaki, J. et al. (1989) Gene 79(2):269-77. As used herein, the term "CAG promoter" can be used interchangeably. As used herein, the term "CMV early enhancer / chicken β-actin (CAG) promoter" can be used interchangeably.

[0211] As used in reference to virus titer, the terms "genomic particles (gp)", "genomic equivalents", or "genomic copies" refer to the number of viral particles containing the recombinant AAV DNA genome, regardless of infectivity or functionality. The number of genomic particles in a particular vector preparation can be measured by procedures such as those described in the examples herein or, for example, in the following references: Clark et al. (1999) Hum. Gene Ther., 10:1031-1039; Veldwijk et al. (2002) Mol. Ther., 6:272-278.

[0212] As used herein, the term "vector genome (vg)" can refer to one or more polynucleotides comprising a set of polynucleotide sequences of a vector (e.g., a viral vector). The vector genome can be encapsidated in a viral particle. Depending on the particular viral vector, the vector genome can comprise single-stranded DNA, double-stranded DNA, single-stranded RNA, or double-stranded RNA. The vector genome can include endogenous sequences associated with the particular viral vector and / or any heterologous sequences inserted into the particular viral vector by recombinant techniques. For example, a recombinant AAV vector genome can include at least one ITR sequence flanking a promoter, a filler fragment, a sequence of interest (e.g., RNAi), and a polyadenylation sequence. A complete vector genome can include the entire set of polynucleotide sequences of the vector. In some embodiments, the nucleic acid titer of a viral vector can be measured in vg / mL. Methods suitable for measuring this titer are known in the art (e.g., quantitative PCR).

[0213] As used in reference to virus titer, the terms "infection units (iu)", "infectious particles", or "replication units" refer to the number of infectious and replication-competent recombinant AAV vector particles, as measured by the infection center assay (also known as the replication center assay), such as described by McLaughlin et al. (1988) J. Virol., 62:1963-1973.

[0214] The term "transducing unit (tu)" as used with respect to virus titer refers to the number of infectious recombinant AAV vector particles that result in the production of a functional transgene product, as measured in a functional assay, as described in the examples herein or, for example, in Xiao et al. (1997) Exp. Neurobiol., 144:113-124; or Fisher et al. (1996) J. Virol., 70:520-532 (LFU assay).

[0215] "Inverted terminal repeat" or "ITR" sequences are terms well known in the art and refer to relatively short sequences found at the ends of the viral genome that are in opposite orientations.

[0216] "AAV inverted terminal repeat (ITR)" sequences are terms well known in the art and are sequences of approximately 145 nucleotides that are present at both ends of the native single-stranded AAV genome. The outermost 125 nucleotides of the ITR can be present in either of two alternative orientations, resulting in heterogeneity between different AAV genomes and between the two ends of a single AAV genome. The outermost 125 nucleotides also contain several shorter self-complementary regions (designated regions A, A', B, B', C, C', and D), allowing for intrastrand base pairing within this portion of the ITR.

[0217] "Terminal resolution sequence" or "trs" is a sequence in the D region of the AAV ITR that is cleaved by the AAV rep protein during viral DNA replication. Mutant terminal resolution sequences are resistant to cleavage by the AAV rep protein.

[0218] "AAV helper function" refers to functions that permit AAV to be replicated and packaged by a host cell. AAV helper functions can be provided in any of a variety of forms, including but not limited to helper viruses or helper virus genes that assist in AAV replication and packaging. Other AAV helper functions are known in the art, such as genotoxic agents.

[0219] The "helper virus" of AAV refers to a virus that allows AAV, which is a defective parvovirus, to be replicated and packaged by a host cell. The helper virus provides the "helper functions" that allow AAV to replicate. A variety of such helper viruses have been identified, including adenoviruses, herpesviruses, and poxviruses such as vaccinia and baculoviruses. Adenoviruses encompass a variety of different subgroups, but adenovirus type 5 (Ad5) of subgroup C is the most commonly used. Many adenoviruses from human, non-human mammalian, and avian sources are known and can be obtained from depository institutions such as ATCC. Herpes family viruses that can also be obtained from depository institutions such as ATCC include, for example, herpes simplex virus (HSV), Epstein-Barr virus (EBV), cytomegalovirus (CMV), and pseudorabies virus (PRV). Examples of adenovirus helper functions for replicating AAV include the E1A function, the E1B function, the E2A function, the VA function, and the E4orf6 function. Baculoviruses that can be obtained from depository institutions include Autographa californica multiple nucleopolyhedrovirus.

[0220] If the ratio of infectious AAV particles to infectious helper virus particles is at least about 10 2 :1; at least about 10 4 :1, at least about 10 6 :1; or at least about 10 8 :1 or more, then a preparation of rAAV is said to be "substantially free" of helper virus. In some embodiments, the preparation is also free of equivalent amounts of helper virus proteins (i.e., if the above helper virus particle impurities are present in a disrupted form, proteins would be present due to this level of helper virus). Viral and / or cellular protein contamination can generally be observed on an SDS gel as the presence of Coomassie-stained bands (e.g., bands that appear different from those corresponding to the AAV capsid proteins VP1, VP2, and VP3).

[0221] The "percent sequence identity (%)" with respect to a reference polypeptide or nucleic acid sequence is defined as the percentage of amino acid residues or nucleotides in the candidate sequence that are identical to the amino acid residues or nucleotides in the reference polypeptide or nucleic acid sequence after aligning the sequences and introducing gaps (if necessary) to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. The alignment for the purpose of determining the percent amino acid or nucleic acid sequence identity can be achieved in a variety of ways within the skill in the art, such as using publicly available computer software programs, such as those described in Current Protocols in Molecular Biology (edited by Ausubel et al., 1987), Supplement 30, Chapter 7.7.18, Table 7.7.1, and including BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. A preferred alignment program is ALIGN Plus (Scientific and Educational Software, Pennsylvania). One of ordinary skill in the art can determine the appropriate parameters for measuring the alignment, including any algorithms needed to achieve the maximum alignment over the full length of the sequences being compared. For the purposes herein, the percent amino acid sequence identity of a given amino acid sequence A to (to, with or against) a given amino acid sequence B (which can alternatively be stated as a given amino acid sequence A having or comprising a certain percent amino acid sequence identity to (to, with or against) a given amino acid sequence B) is calculated as follows: 100 times the fraction X / Y, where X is the number of amino acid residues scored as identical matches in the alignment of A and B by the sequence alignment program, and where Y is the total number of amino acid residues in B. It should be appreciated that when the length of amino acid sequence A is not equal to the length of amino acid sequence B, the percent amino acid sequence identity of A to B will not be equal to the percent amino acid sequence identity of B to A. For the purposes herein, the percent nucleic acid sequence identity of a given nucleic acid sequence C to (to, with or against) a given nucleic acid sequence D (which can alternatively be stated as a given nucleic acid sequence C having or comprising a certain percent nucleic acid sequence identity to (to, with or against) a given nucleic acid sequence D) is calculated as follows: 100 times the fraction W / Z, where W is the number of nucleotides scored as identical matches in the alignment of C and D by the sequence alignment program, and where Z is the total number of nucleotides in D. It should be appreciated that when the length of nucleic acid sequence C is not equal to the length of nucleic acid sequence D, the percent nucleic acid sequence identity of C to D will not be equal to the percent nucleic acid sequence identity of D to C.

[0222] A "separated" molecule (e.g., nucleic acid or protein) or cell means that it has been identified, separated, and / or recovered from the components of its natural environment.

[0223] An "effective amount" is an amount sufficient to produce a beneficial or desired result, including clinical results (e.g., improvement of symptoms, achievement of clinical endpoints, etc.). The effective amount can be administered in one or more administrations. In terms of a disease state, an effective amount is an amount sufficient to improve, stabilize, or delay the progression of the disease.

[0224] An "individual" or "subject" is a mammal. Mammals include, but are not limited to, domestic animals (e.g., cows, sheep, cats, dogs, and horses), primates (e.g., humans and non-human primates such as monkeys), rabbits, and rodents (e.g., mice and rats). In certain embodiments, the individual or subject is a human.

[0225] As used herein, "treatment" is a means for obtaining a beneficial or desired clinical result. For the purposes of this disclosure, beneficial or desired clinical results include, but are not limited to, the following: alleviation of symptoms, reduction in the extent of the disease, stabilization of the disease state (e.g., not getting worse), prevention of the spread of the disease (e.g., metastasis), delay or slowing of disease progression, improvement or mitigation of the disease state, and remission (whether partial or complete), whether detectable or not. "Treatment" can also mean an extension of the survival period compared to the expected survival period if treatment had not been received.

[0226] As used herein, the term "preventive treatment" refers to a treatment in which an individual is known or suspected to have a disorder or be at risk of developing a disorder, but has not exhibited symptoms of the disorder or has exhibited minimal symptoms of the disorder. An individual undergoing preventive treatment can be treated before the onset of symptoms.

[0227] As used herein, "phenylalanine hydroxylase (PAH)" is the enzyme (EC 1.14.16.1) that catalyzes the hydroxylation of the aromatic side chain of phenylalanine to tyrosine. PAH is a monooxygenase that uses tetrahydrobiopterin (BH4, a pterin cofactor) and non-heme iron for catalysis. During the reaction, molecular oxygen is heterolytically cleaved, and one oxygen atom is successively incorporated into BH4 and the phenylalanine substrate. The hydroxylation of phenylalanine to tyrosine is the rate-limiting step in phenylalanine catabolism, and the lack of this enzyme activity results in the autosomal recessive disorder phenylketonuria. PAH may also be referred to as PH, PKU, or PKU1. PAH is a multi-domain protein composed of an N-terminal regulatory domain (1-117), a central catalytic domain (118-410), and a C-terminal tetramerization domain (411-452). Human PAH is provided in GenBank; for example, NM_000277, NM_00877, NM_001354304, NP_000268, NP_032803, NP_001341233, AAA60082.1, AAH26251.1, AAC51772.1, and AAL78816.1 (GI: 18765885). An example of human PAH is provided as SEQ ID NO:1.

[0228] As used herein, "phenylketonuria (PKU)" refers to a genetic defect in the hepatic enzyme phenylalanine hydroxylase (PAH). In the absence of any treatment, severe forms of PKU result in highly elevated blood Phe levels, which are neurotoxic and associated with severe mental retardation.

[0229] "mTTR promoter" refers to a polynucleotide sequence derived from the murine transthyretin gene. An example of the mTTR promoter, mTTR482, is provided by Kyostio-Moore, (2016) and Nambiar (2017).

[0230] "Modified prothrombin enhancer (mPrT2)" refers to two copies of a polynucleotide sequence derived from the human prothrombin gene. Examples of the mPrT2 enhancer are provided by (McEachern 2006, Jacobs 2008). An example of the mPrT2 sequence is provided by SEQ ID NO:7.

[0231] "Modified α1-microbikunin (mA1MB2)" refers to two copies of a polynucleotide sequence derived from the human α1-microbikunin / bikunin gene. An example of mA1MB2 is the enhancer of (McEachern 2006, Jacobs 2008). An example of the mA1MB2 sequence is provided by SEQ ID NO:8.

[0232] "Modified murine albumin enhancer (mEalb)" refers to a polynucleotide sequence derived from the murine albumin gene. Examples of mEalb enhancers are provided by (Kramer 2003). An example of an mEalb sequence is provided by SEQ ID NO:9.

[0233] "Hepatitis B virus enhancer II (HEII)" refers to a polynucleotide sequence derived from the hepatitis B virus that is upstream of the pre-C region promoter. Examples of hEII enhancers are provided by (Kramer 2003). An example of a HEII sequence is provided by SEQ ID NO:10.

[0234] "CRM8" refers to a cis-acting regulatory module derived from a polynucleotide sequence from the human Serpina1 gene (Chuah 2014). An example of a CRM8 sequence is provided by SEQ ID NO:11.

[0235] "Alb 3" refers to a polynucleotide sequence on the 3'-side of the coding region of the human albumin gene. Examples of Alb 3' elements are provided by Wooddell (2008). An example of an Alb 3' sequence is provided by SEQ ID NO:12. "Alb3' / SMAR" refers to Alb3' linked to the scaffold / matrix attachment region of the human α1-antitrypsin gene (AF156542). An example of an Alb3' / SMAR sequence is provided by SEQ ID NO:13.

[0236] References herein to "about" a value or parameter include (and describe) embodiments that refer to the value or parameter itself. For example, a description that refers to "about X" includes a description of "X".

[0237] Unless otherwise indicated, as used herein, the singular forms of the articles "a", "an", and "the" include plural referents.

[0238] It should be understood that aspects and embodiments of the disclosure described herein include "comprising" aspects and embodiments, "consisting of" aspects and embodiments, and / or "consisting essentially of" aspects and embodiments.

[0239] III. PAH Variants

[0240] In some aspects, the present invention provides variant PAH polypeptides which, when expressed in an individual, confer higher levels of PAH expression and / or activity. In some embodiments, the variant PAH polypeptide comprises at least two amino acid substitutions, wherein the amino acid substitutions are located at positions selected from M180, K199, S250, S251, H264, G256, G272, G275, P279, T323 and F327 of the wild-type human PAH polypeptide. In some embodiments, the variant PAH polypeptide comprises at least two amino acid substitutions at H264 and G275. In some embodiments, the variant PAH polypeptide comprises at least three amino acid substitutions, wherein the amino acid substitutions are located at positions selected from M180, K199, S250 and G256 of the wild-type human PAH polypeptide. In some embodiments, the variant PAH polypeptide comprises four amino acid substitutions at positions M180, K199, S250 and G256 of the wild-type human PAH polypeptide. In some embodiments, the variant PAH polypeptide comprises five amino acid substitutions at M180, K199, S250, S251, G256, G272 and P279. In some embodiments, the variant PAH polypeptide comprises six amino acid substitutions at M180, K199, S250, G256, T323 and F327. In some embodiments, the variant PAH polypeptide comprises at least two amino acid substitutions of H264P and G275H. In some embodiments, the variant PAH polypeptide comprises at least three amino acid substitutions selected from M180T, K199P, S250P and G256A. In some embodiments, the variant PAH polypeptide comprises amino acid substitutions including: K199P, S250P and G256A; M180T, S250P and G256A; M180T, K199P and G256A; or M180T, K199P and S250P. In some embodiments, the variant PAH polypeptide further comprises amino acid substitutions of H264P, G272A, G272P, P275L, P279Q, G272P and P275L, or T323R and F327T amino acid substitutions. In some embodiments, the variant PAH polypeptide is any one of the variant PAH polypeptides listed in Tables 1-3. In some embodiments, the variant PAH polypeptide comprises the amino acid substitutions M180T, K199P, S250P and G256A, and comprises additional amino acid substitutions while at least substantially maintaining the phenylalanine hydroxylase activity of wild-type PAH. In some embodiments, the positions of the amino acid substitutions are based on the wild-type human PAH polypeptide; for example, the human PAH polypeptide comprising the amino acid sequence of SEQ ID NO:1.

[0241] In some embodiments, the variant PAH polypeptide is a human PAH polypeptide. In some embodiments, the variant PAH polypeptide comprises the amino acid sequence of SEQ ID NO:3. In some embodiments, the variant PAH polypeptide comprises an amino acid sequence having at least about 80%, 85%, 90%, 95%, or 99% identity to the amino acid sequence of SEQ ID NO:3. In some embodiments, the variant PAH polypeptide comprising an amino acid sequence having at least about 80%, 85%, 90%, 95%, or 99% identity to the amino acid sequence of SEQ ID NO:3 has at least about 25%, 50%, 75%, 100%, or greater than 100% of the phenylalanine hydroxylase activity of wild-type PAH. In some embodiments, the variant PAH polypeptide comprising an amino acid sequence having at least about 80%, 85%, 90%, 95%, or 99% identity to the amino acid sequence of SEQ ID NO:3 has at least about 25%, 50%, 75%, 100%, or greater than 100% of the phenylalanine hydroxylase activity of the wild-type PAH of SEQ ID NO:1.

[0242] In some embodiments, the variant PAH polypeptide is a truncated PAH polypeptide that retains phenylalanine hydroxylase activity. In some embodiments, the truncated PAH polypeptide comprises an N-terminal truncation. In some embodiments, the N-terminal truncation is a partial or complete truncation of the N-terminal regulatory domain. In some embodiments, the N-terminal truncation is a deletion of amino acid residues 1 to about amino acid residue 102 of the wild-type human PAH polypeptide (e.g., the PAH polypeptide of SEQ ID NO:1). In some embodiments, the truncated PAH polypeptide comprises a C-terminal truncation. In some embodiments, the C-terminal truncation is a partial or complete truncation of the tetramerization domain. In some embodiments, the C-terminal truncation is a deletion of about amino acid residues 429 to 452 of the wild-type human PAH polypeptide (e.g., the PAH polypeptide of SEQ ID NO:1). In some embodiments, the variant PAH polypeptide comprises an N-terminal truncation and a C-terminal truncation. In some embodiments, the truncated PAH polypeptide comprises a partial or complete truncation of the N-terminal regulatory sequence and a partial or complete truncation of the tetramerization domain. In some embodiments, the truncated PAH polypeptide comprises a deletion of amino acid residues 1 to about amino acid residue 102 and about amino acid residues 429 to about 452 of the wild-type human PAH polypeptide (e.g., the PAH polypeptide of SEQ ID NO:1). In some embodiments, the variant PAH polypeptide comprises an amino acid sequence corresponding to about amino acid residues 102 to about 428 of the wild-type human PAH polypeptide (e.g., the PAH polypeptide of SEQ ID NO:1). In some embodiments, the variant PAH polypeptide comprises an amino acid sequence corresponding to amino acid residues 102 to 428 of the wild-type human PAH polypeptide (e.g., the PAH polypeptide of SEQ ID NO:1). In some embodiments, the truncated PAH polypeptide further comprises four amino acid substitutions at positions M180, K199, S250, and G256 of the wild-type human PAH polypeptide (e.g., the PAH polypeptide of SEQ ID NO:1). In some embodiments, the truncated PAH polypeptide comprises four amino acid substitutions selected from M180T, K199P, S250P, and G256A. In some embodiments, the truncated variant PAH polypeptide further comprises any combination of the amino acid substitutions listed in Tables 1-3. In some embodiments, the truncated PAH polypeptide has at least about 25%, 50%, 75%, 100%, or greater than 100% of the phenylalanine hydroxylase activity of wild-type PAH (e.g., the PAH polypeptide of SEQ ID NO:1).

[0243] In some embodiments, the variant PAH polypeptide comprises one or more amino acid substitutions at one or more of the following positions: G33, G46, G103, G139, G148, G188, G218, G239, G247, G257, G272, G289, G307, G312, G332, G337, G344, G352, or G442. In some embodiments, the variant PAH polypeptide comprises one of the following amino acid substitutions: G33A, G46(A, P), G103A, G139(A, P), G148A, G188A, G218A, G239A, G247A, G257A, G272A, G289A, G307A, G312A, G332A, G337A, G344A, G352A, or G442A. In some embodiments, the variant No. 1 PAH polypeptide further comprises one or more amino acid substitutions at one or more of the following positions: G33, G46, G103, G139, G148, G188, G218, G239, G247, G257, G272, G289, G307, G312, G332, G337, G344, G352, or G442. In some embodiments, the variant No. 1 PAH polypeptide comprises one or more of the following amino acid substitutions: G33A, G46(A, P), G103A, G139(A, P), G148A, G188A, G218A, G239A, G247A, G257A, G272A, G289A, G307A, G312A, G332A, G337A, G344A, G352A, or G442A.

[0244] In some embodiments, the variant PAH polypeptide (e.g., variant No. 1 PAH polypeptide) comprises one or more of the following amino acid substitutions: P9G, G10V, G12S, K184R, K192R, S196A, Y206H, H220R, Q336E, E360D, I374C, N376E, N401T, I421V, I441V, S446H. In some embodiments, the variant PAH polypeptide (e.g., variant No. 1) further comprises a serine residue (Ser453) at the C-terminus of human PAH.

[0245] In some embodiments, the variant PAH polypeptide (e.g., variant No. 1 PAH polypeptide) comprises one or more of the following amino acid substitutions: F240W, A246P, G247A, Y268W, C284F, T323R, F327Y, E319P, I306(Y, F), K113P, G188A, F191Y, T193R, Y206H, G337P, N376P.

[0246] In some embodiments, the variant PAH polypeptide (e.g., variant number 1 PAH polypeptide) comprises any amino acid substitutions to eliminate potential protease cleavage sites. In some embodiments, the amino acid substitutions for eliminating potential protease cleavage sites are located within PAH fragments 270 - 295 and 380 - 405.

[0247] In some embodiments, the variant PAH polypeptide (e.g., variant number 1 PAH polypeptide) comprises post - translational modifications to enhance the stability of human PAH. In some embodiments, the variant PAH polypeptide comprises post - translational modifications such as PEGylation and nitrosylation of Cys residues, particularly I374C, by an external nitrosating agent.

[0248] III. Nucleic Acids

[0249] In some aspects, the present invention provides nucleic acids encoding variant PAH polypeptides which, when expressed in an individual, confer a higher level of PAH activity. In some embodiments, the nucleic acid encodes a variant PAH polypeptide comprising at least three amino acid substitutions, wherein the amino acid substitutions are located at positions selected from M180, K199, S250, and G256 of the wild-type human PAH polypeptide. In some embodiments, the nucleic acid encodes a variant PAH polypeptide comprising four amino acid substitutions at positions M180, K199, S250, and G256 of the wild-type human PAH polypeptide. In some embodiments, the nucleic acid encodes a variant PAH polypeptide comprising at least three amino acid substitutions selected from M180T, K199P, S250P, and G256A. In some embodiments, the nucleic acid encodes a variant PAH polypeptide comprising the amino acid substitutions M180T, K199P, S250P, and G256A. In some embodiments, the nucleic acid encodes a variant PAH polypeptide comprising amino acid substitutions including: K199P, S250P, and G256A; M180T, S250P, and G256A; M180T, K199P, and G256A; or M180T, K199P, and S250P. In some embodiments, the nucleic acid encodes a variant PAH polypeptide comprising the amino acid substitutions M180T, K199P, S250P, and G256A. In some embodiments, the nucleic acid encodes a variant PAH polypeptide further comprising amino acid substitutions H264P, G272A, G272P, P275L, P279Q, G272P, and P275L, or T323R and F327T amino acid substitutions. In some embodiments, the nucleic acid encoding is a variant PAH polypeptide of any of the variant PAH polypeptides listed in Tables 1-3. In some embodiments, the nucleic acid encodes a variant PAH polypeptide comprising the amino acid substitutions M180T, K199P, S250P, and G256A and comprising additional amino acid substitutions while at least substantially maintaining the phenylalanine hydroxylase activity of wild-type PAH. In some embodiments, the positions of the amino acid substitutions encoded by the nucleic acid are based on the wild-type human PAH polypeptide; for example, a human PAH polypeptide comprising the amino acid sequence of SEQ ID NO:1.

[0250] In some embodiments, the nucleic acid encodes a variant human PAH polypeptide. In some embodiments, the nucleic acid encodes a variant PAH polypeptide comprising the amino acid sequence of SEQ ID NO:3. In some embodiments, the nucleic acid encodes a variant PAH polypeptide comprising an amino acid sequence having at least about 80%, 85%, 90%, 95% or 99% identity to the amino acid sequence of SEQ ID NO:3. In some embodiments, the nucleic acid encodes a variant PAH polypeptide comprising an amino acid sequence having at least about 80%, 85%, 90%, 95% or 99% identity to the amino acid sequence of SEQ ID NO:3 and having at least about 25%, 50%, 75%, 100% or greater than 100% of the phenylalanine hydroxylase activity of wild-type PAH. In some embodiments, the nucleic acid encodes a variant PAH polypeptide comprising an amino acid sequence having at least about 80%, 85%, 90%, 95% or 99% identity to the amino acid sequence of SEQ ID NO:3 and having at least about 25%, 50%, 75%, 100% or greater than 100% of the phenylalanine hydroxylase activity of wild-type PAH of SEQ ID NO:1.

[0251] In some embodiments, the nucleic acid encodes a variant PAH polypeptide that is a truncated PAH polypeptide maintaining phenylalanine hydroxylase activity. In some embodiments, the nucleic acid encodes a truncated PAH polypeptide with an N-terminal truncation. In some embodiments, the nucleic acid encoding is a partial or complete truncation of the N-terminal regulatory domain, an N-terminal truncation. In some embodiments, the nucleic acid encoding comprises an N-terminal truncation with a deletion of amino acid residues 1 to about amino acid residue 102 of the wild-type human PAH polypeptide (e.g., the PAH polypeptide of SEQ ID NO:1). In some embodiments, the nucleic acid encodes a truncated PAH polypeptide with a C-terminal truncation. In some embodiments, the nucleic acid encoding is a partial or complete truncation of the tetramerization domain, a C-terminal truncation. In some embodiments, the nucleic acid encoding comprises a C-terminal truncation with a deletion of about amino acid residues 429 to 452 of the wild-type human PAH polypeptide (e.g., the PAH polypeptide of SEQ ID NO:1). In some embodiments, the nucleic acid encodes a variant PAH polypeptide with an N-terminal truncation and a C-terminal truncation. In some embodiments, the truncated PAH polypeptide comprises a partial or complete truncation of the N-terminal regulatory sequence and a partial or complete truncation of the tetramerization domain. In some embodiments, the truncated PAH polypeptide comprises a deletion of amino acid residues 1 to about amino acid residue 102 and about 429 to about 452 of the wild-type human PAH polypeptide (e.g., the PAH polypeptide of SEQ ID NO:1). In some embodiments, the nucleic acid encodes a variant PAH polypeptide with an amino acid sequence corresponding to amino acid residues about 102 to about 428 of the wild-type human PAH polypeptide (e.g., the PAH polypeptide of SEQ ID NO:1). In some embodiments, the nucleic acid encodes a variant PAH polypeptide with an amino acid sequence corresponding to amino acid residues 102 to 428 of the wild-type human PAH polypeptide (e.g., the PAH polypeptide of SEQ ID NO:1). In some embodiments, the nucleic acid encoding further comprises a truncated PAH polypeptide with four amino acid substitutions at positions M180, K199, S250, and G256 of the wild-type human PAH polypeptide (e.g., the PAH polypeptide of SEQ ID NO:1). In some embodiments, the nucleic acid encoding comprises a truncated PAH polypeptide with four amino acid substitutions selected from M180T, K199P, S250P, and G256A. In some embodiments, the nucleic acid encoding further comprises a truncated variant PAH polypeptide with any combination of the amino acid substitutions listed in Tables 1-3. In some embodiments, the nucleic acid encoding has a truncated PAH polypeptide with at least about 25%, 50%, 75%, 100%, or greater than 100% of the phenylalanine hydroxylase activity of wild-type PAH (e.g., the PAH polypeptide of SEQ ID NO:1).

[0252] In some embodiments, a nucleic acid encoding a variant PAH polypeptide is operably linked to a promoter. In some embodiments, the promoter is selected from the cytomegalovirus (CMV) immediate early promoter, RSV LTR, MoMLV LTR, phosphoglycerate kinase-1 (PGK) promoter, simian virus 40 (SV40) promoter, CK6 promoter, mouse transthyretin promoter (mTTR), mTTR482 promoter, mA1MB2-mTTR482 promoter, TK promoter, tetracycline-responsive promoter (TRE), HBV promoter, hAAT promoter, LSP promoter, LP1 promoter, chimeric liver-specific promoter (LSP), E2F promoter, telomerase (hTERT) promoter; cytomegalovirus enhancer / chicken β-actin / rabbit β-globin promoter (CAG) promoter, elongation factor 1-α promoter (EF1-α) promoter, human β-glucuronidase promoter, chicken β-actin (CBA) promoter, Rous sarcoma virus (RSV) LTR promoter, dihydrofolate reductase promoter, and β-actin promoter. In some embodiments, the promoter is the LP1 promoter or the mA1MB2-mTTR482 promoter.

[0253] In some embodiments, the nucleic acid further comprises a polyadenylation signal. In some embodiments, the polyadenylation signal is the bovine growth hormone polyadenylation signal, the SV40 polyadenylation signal, or the HSV TK pA. In some embodiments, the polyadenylation signal is a synthetic polyadenylation signal, as described in Levitt, N et al. (1989), Genes Develop. 3:1019-1025.

[0254] In some embodiments, the nucleic acid further comprises an intron. A variety of introns useful for the present invention are known to those skilled in the art and include the MVM intron, the FIX truncated intron 1, the β-globin SD / immunoglobulin heavy chain SA, the adenovirus SD / immunoglobulin SA, the SV40 late SD / SA (19S / 16S), and the chimeric adenovirus SD / IgGSA. (Wu et al. 2008, Kurachi et al., 1995, Choi et al. 2014, Wong et al., 1985, Yew et al. 1997, Huang and Gorman (1990). In some embodiments, the intron is the chicken β-actin (CBA) / rabbit β-globin hybrid intron. In some embodiments, the intron is the chicken β-actin (CBA) / rabbit β-globin hybrid promoter and intron, with all ATG sites removed to minimize incorrect translation initiation sites (SEQ ID NO:15).

[0255] In some embodiments, the nucleic acid can include (one or more) filler nucleic acids. In some embodiments, the filler nucleic acid can comprise a sequence encoding a reporter polypeptide. As will be understood by those skilled in the art, the filler nucleic acid can be located in multiple regions within the nucleic acid and can consist of a single continuous sequence within the nucleic acid (e.g., a single filler nucleic acid at a single position) or multiple sequences (e.g., more than one filler nucleic acid at more than one position (e.g., 2 positions, 3 positions, etc.)). In some embodiments, the filler nucleic acid can be located downstream of the nucleic acid sequence encoding the variant PAH polypeptide. In an embodiment, the filler nucleic acid can be located upstream of the nucleic acid sequence encoding the variant PAH polypeptide (e.g., between the promoter and the nucleic acid sequence encoding the variant PAH polypeptide). As will also be understood by those skilled in the art, various nucleic acids can be used as the filler nucleic acid. In some embodiments, the filler nucleic acid comprises all or a portion of the human α-1-antitrypsin (AAT) filler sequence or the C16 P1 chromosome 16P1 clone (human C16) filler sequence. In some embodiments, the filler sequence comprises all or a portion of a gene. For example, the filler sequence comprises a portion of the human AAT sequence. Those skilled in the art will understand that different portions of a gene (e.g., the human AAT sequence) can be used as filler fragments. For example, the filler fragment can be from the 5' end of the gene, the 3' end of the gene, the middle portion of the gene, the non-coding portion of the gene (e.g., an intron), the coding region of the gene (e.g., an exon), or a mixture of the non-coding and coding portions of the gene. Those skilled in the art will also understand that all or a portion of the filler sequence can be used as the filler sequence. In some embodiments, the filler sequence is modified to remove internal ATG codons. In some embodiments, the filler sequence comprises the nucleotide sequence of SEQ ID NO:16.

[0256] In some embodiments, the isolated nucleic acid encoding a human PAH polypeptide is codon-optimized. In some embodiments, the isolated nucleic acid encoding a human PAH polypeptide is codon-optimized for expression in a particular cell, such as a eukaryotic cell. The eukaryotic cell can be those of a particular organism or derived from a particular organism, such as a mammal, including but not limited to human, mouse, rat, rabbit, dog, or non-human primate. Generally, codon optimization refers to the process of modifying a nucleic acid sequence by replacing at least one codon of the native sequence with a codon that is more frequently or most frequently used in the genes of the host cell of interest, while maintaining the native amino acid sequence. Various species exhibit a particular preference for certain codons of a particular amino acid. Codon usage tables are readily available, for example, in the "Codon Usage Database", and these tables can be modified in a variety of ways (e.g., see Nakamura, Y. et al. (2000) Nucleic Acids Res. 28:292). Computer algorithms for codon-optimizing a particular sequence for expression in a particular host cell are also available, such as Gene Forge (Aptagen; Jacobus, PA), DNA2.0, GeneArt (GA), or Genscript (GS), as well as the GS algorithm in combination with a reduction in CpG content. In some embodiments, the nucleic acid encoding the PAH polypeptide is codon-optimized using the GA algorithm. In some embodiments, the nucleic acid sequence is at least 80% identical to the nucleic acid sequence of SEQ ID NO:14. In some embodiments, the nucleic acid comprises the nucleic acid sequence of SEQ ID NO:14.

[0257] IV. Liver-Specific Expression Cassette

[0258] In some aspects, the present invention provides an expression cassette for expressing a transgene in hepatocytes, wherein the expression cassette comprises a transgene operably linked to a promoter and an enhancer, wherein the promoter comprises the mouse transthyretin (mTTR) promoter, and the enhancer comprises one or two modified prothrombin enhancers (mPrT2), one or two modified α1-microbikunin enhancers (mA1MB2), a modified mouse albumin enhancer (mEalb), hepatitis B virus enhancer II (HEII), or CRM8 enhancer. In some embodiments, the mTTR promoter is the mTTR482 promoter. In some embodiments, the enhancer is on the 5' side of the mTTR promoter. In some embodiments, the transgene encodes a variant PAH polypeptide as described herein.

[0259] In some embodiments, the present invention provides an expression cassette for expressing a transgene in hepatocytes, wherein the expression cassette comprises a transgene operably linked to a promoter and a 3'-element, wherein the promoter comprises a mouse transthyretin (mTTR) promoter, and the 3'-element is an albumin 3'-element (3'Alb) or an albumin 3'-element linked to a human α1-antitrypsin scaffold / matrix attachment region (SMAR) (3'AlbSMAR). In some embodiments, the mTTR promoter is the mTTR482 promoter. In some embodiments, the 3'-element is located on the 3'-side of the transgene. In some embodiments, the transgene encodes a variant PAH polypeptide as described herein.

[0260] In some embodiments, the present invention provides an expression cassette for expressing a transgene in hepatocytes, wherein the expression cassette comprises a transgene operably linked to a promoter, an enhancer and a 3'-element, wherein the promoter comprises a mouse transthyretin (mTTR) promoter, and the enhancer comprises one or two modified prothrombin enhancers (mPrT2), one or two modified α1-microbikunin enhancers (mA1MB2), a modified mouse albumin enhancer (mEalb), a hepatitis B virus enhancer II (HEII) or a CRM8 enhancer, and wherein the 3'-element is an albumin 3'-element (3'Alb) or an albumin 3'-element linked to a human α1-antitrypsin scaffold / matrix attachment region (SMAR) (3'AlbSMAR). In some embodiments, the mTTR promoter is the mTTR482 promoter. In some embodiments, the enhancer is on the 5'-side of the mTTR promoter. In some embodiments, the 3'-element is located on the 3'-side of the transgene. In some embodiments, the transgene encodes a variant PAH polypeptide as described herein.

[0261] In some embodiments, the expression cassette further comprises an intron. In some embodiments, the intron is an MVM intron, a FIX truncated intron 1, a β-globin SD / immunoglobulin heavy chain SA, an adenovirus SD / immunoglobulin SA, an SV40 late SD / SA (19S / 16S) or a hybrid adenovirus SD / IgG SA. In some embodiments, the intron is a chicken β-actin (CBA) / rabbit β-globin hybrid intron.

[0262] In some embodiments, the expression cassette further comprises a polyadenylation signal. In some embodiments, the polyadenylation signal is a bovine growth hormone polyadenylation signal, an SV40 polyadenylation signal or an HSV TK pA.

[0263] In some embodiments, the expression cassette is incorporated into a vector. In some embodiments, the expression cassette is incorporated into a viral vector. In some embodiments, the viral vector is an rAAV vector as described herein.

[0264] V. Vectors and Viral Particles

[0265] In certain aspects, a nucleic acid encoding a variant PAH polypeptide is contained within a vector. In some embodiments, the present invention contemplates the use of a recombinant viral genome to introduce a nucleic acid sequence encoding a variant PAH polypeptide for packaging into viral particles, such as the viral particles described below. The recombinant viral genome can include any elements that establish the expression of the variant PAH polypeptide, such as promoters, ITRs, ribosome binding elements, terminators, enhancers, selectable markers, introns, polyA signals, and / or origins of replication. Exemplary viral genome elements and delivery methods for viral particles are described in more detail below.

[0266] Non-Viral Delivery Systems

[0267] Conventional non-viral gene transfer methods can also be used to introduce nucleic acids into cells or target tissues. Non-viral vector delivery systems include DNA plasmids, naked nucleic acids, and nucleic acids complexed with delivery systems. For example, the vector can be complexed with lipids (such as cationic or neutral lipids), liposomes, polycations, nanoparticles, or reagents that enhance cellular uptake of nucleic acids. The vector can be complexed with reagents suitable for any of the delivery methods described herein. In some embodiments, the nucleic acid comprises one or more viral ITRs (such as AAV ITRs).

[0268] Viral Particles

[0269] In some embodiments, the vector containing the nucleic acid encoding a variant PAH polypeptide is a recombinant adeno-associated virus (rAAV) vector, a recombinant adenovirus vector, a recombinant lentivirus vector, or a recombinant herpes simplex virus (HSV) vector.

[0270] rAAV Particles

[0271] In some embodiments, the vector is a recombinant AAV (rAAV) vector. In some embodiments, the nucleic acid encoding a variant PAH polypeptide is flanked by one or more AAV inverted terminal repeat (ITR) sequences. In some embodiments, the viral particle is a recombinant AAV particle containing a nucleic acid comprising a nucleic acid encoding a variant PAH polypeptide flanked by one or two ITRs. In some embodiments, the nucleic acid encoding a variant PAH polypeptide is flanked by two AAV ITRs.

[0272] In some embodiments, a nucleic acid encoding a variant PAH polypeptide of the present disclosure is operably linked to components, control sequences (including transcriptional start and stop sequences) in the transcriptional orientation to form an expression cassette. Flanking the 5' and 3' ends of the expression cassette are at least one functional AAV ITR sequence. A "functional AAV ITR sequence" means an ITR sequence function that is intended for rescue, replication, and packaging of AAV viral particles. See Davidson et al., PNAS, 2000, 97(7)3428-32; Passini et al., J. Virol., 2003, 77(12):7034-40; and Pechan et al., Gene Ther., 2009, 16:10-16, which are hereby incorporated by reference in their entirety. To practice some aspects of the invention, the recombinant vector contains at least all AAV sequences necessary for encapsidation and the physical structure for infection by rAAV. The AAV ITRs for the vectors of the present invention need not have a wild-type nucleotide sequence (e.g., as described in Kotin, Hum. Gene Ther., 1994, 5:793-801), and can be altered by insertions, deletions, or substitutions of nucleotides, or the AAV ITRs can be derived from any of several AAV serotypes. Over 40 AAV serotypes are currently known, and new serotypes and variants of existing serotypes are still being identified. See Gao et al., PNAS, 2002, 99(18):11854-6; Gao et al., PNAS, 2003, 100(10):6081-6; and Bossis et al., J. Virol., 2003, 77(12):6799-810.

[0273] The use of any AAV serotype is considered to be within the scope of the present invention. In some embodiments, the rAAV vector is a vector derived from an AAV serotype, including but not limited to, the AAV ITR being AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, caprine AAV, bovine AAV, or murine AAV ITR, etc. In some embodiments, the nucleic acid in AAV contains the ITR of an AAV ITR, and the AAV ITR is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, caprine AAV, bovine AAV, or murine AAV, etc. In certain embodiments, the AAV ITR is the AAV2 ITR.

[0274] In some embodiments, the vector can include filler nucleic acid. In some embodiments, the filler nucleic acid can encode green fluorescent protein. In some embodiments, the filler nucleic acid can be located 3' to the nucleic acid encoding the variant PAH polypeptide of the present disclosure.

[0275] In some aspects, the invention provides viral particles comprising a recombinant self-complementary genome. In some embodiments, the vector is a self-complementary vector. AAV viral particles having a self-complementary genome and methods of using self-complementary AAV genomes are described in the following: U.S. Patent Nos. 6,596,535; 7,125,717; 7,765,583; 7,785,888; 7,790,154; 7,846,729; 8,093,054; and 8,361,457; and Wang Z., et al., (2003) Gene Ther 10:2105-2111, each of which is incorporated herein by reference in its entirety. rAAV comprising a self-complementary genome will rapidly form double-stranded DNA molecules by virtue of its partially complementary sequences (e.g., the complementary coding and non-coding strands of the transgene). In some embodiments, the invention provides AAV viral particles comprising an AAV genome, wherein the rAAV genome comprises a first heterologous polynucleotide sequence (e.g., the coding strand of the variant PAH polypeptide of the invention) and a second heterologous polynucleotide sequence (e.g., the non-coding or antisense strand of the variant PAH polypeptide of the present disclosure), wherein the first heterologous polynucleotide sequence can form intrastrand base pairs with the second polynucleotide sequence along most or all of its length.

[0276] In some embodiments, the first heterologous polynucleotide sequence and the second heterologous polynucleotide sequence are joined by a sequence that promotes intrastrand base pairing; e.g., a hairpin DNA structure. Hairpin structures are known in the art, e.g., in siRNA molecules. In some embodiments, the first heterologous polynucleotide sequence and the second heterologous polynucleotide sequence are joined by a mutated ITR (e.g., the right ITR). The mutated ITR contains a deletion of the D region containing the terminal unwinding sequence. Thus, upon replication of the AAV viral genome, the rep protein will not cleave the viral genome at the mutated ITR, and thus, a recombinant viral genome comprising in 5' to 3' order: AAV ITR, a first heterologous polynucleotide sequence including regulatory sequences, a mutated AAV ITR, a second heterologous polynucleotide that is reverse to the first heterologous polynucleotide, and a third AAV ITR will be packaged in the viral capsid.

[0277] In some embodiments, the first heterologous nucleic acid sequence and the second heterologous nucleic acid sequence are joined by a mutated ITR (e.g., the right ITR). In some embodiments, the ITR comprises the polynucleotide sequence 5'-CACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCA AAGGTCGCCCACGCCCGGGCTTTGCCCGGGCG-3' (SEQ ID NO:17). The mutated ITR comprises a deletion of the D region containing the terminal unwinding sequence. Thus, upon replication of the AAV viral genome, the rep protein will not cleave the viral genome at the mutated ITR, and thus, a recombinant viral genome comprising, in 5' to 3' order, the following will be packaged in the viral capsid: AAV ITR, a first heterologous polynucleotide sequence comprising regulatory sequences, a mutated AAV ITR, a second heterologous polynucleotide that is reverse to the first heterologous polynucleotide, and a third AAV ITR.

[0278] In some embodiments, the vector is encapsidated in a viral particle. In some embodiments, the viral particle is a recombinant AAV viral particle comprising a recombinant AAV vector. Different AAV serotypes are used to optimize transduction of a particular target cell or to target a particular cell type within a particular target tissue (e.g., ocular tissue). The rAAV particles can comprise viral proteins and viral nucleic acids of the same serotype or a mixed serotype. For example, in some embodiments, the rAAV particles can comprise the AAV2 capsid protein of the present invention and at least one AAV2 ITR, or it can comprise the AAV2 capsid protein and at least one AAV1 ITR. Any combination of AAV serotypes for producing rAAV particles is provided herein as if each combination had been expressly set forth herein. In some embodiments, the present invention provides rAAV particles comprising the AAV2 capsid of the present invention. In some embodiments, the present invention provides rAAV particles comprising the AAVrh8R capsid of the present invention.

[0279] In some embodiments, the rAAV particles comprise an AAV1 capsid, an AAV2 capsid, an AAV3 capsid, an AAV4 capsid, an AAV5 capsid, an AAV6 capsid (e.g., a wild-type AAV6 capsid, or a variant AAV6 capsid such as ShH10, as described in U.S. Pre-Grant Publication 2012 / 0164106), an AAV7 capsid, an AAV8 capsid, an AAVrh8 capsid, an AAVrh8R capsid, an AAV9 capsid (e.g., a wild-type AAV9 capsid, or a modified AAV9 capsid as described in U.S. Pre-Grant Publication 2013 / 0323226), an AAV10 capsid, an AAVrh10 capsid, an AAV11 capsid, an AAV12 capsid, a tyrosine capsid mutant, a heparin-binding capsid mutant, an AAV2R471A capsid, an AAVAAV2 / 2-7m8 capsid, an AAV DJ capsid (e.g., an AAV-DJ / 8 capsid, an AAV-DJ / 9 capsid, or any other capsid described in U.S. Pre-Grant Publication 2012 / 0066783), an AAV2 N587A capsid, an AAV2 E548A capsid, an AAV2N708A capsid, an AAV V708K capsid, a caprine AAV capsid, an AAV1 / AAV2 chimeric capsid, a bovine AAV capsid, a murine AAV capsid, an rAAV2 / HBoV1 capsid, or an AAV capsid described in U.S. Patent No. 8,283,151 or International Publication No. WO / 2003 / 042397. In some embodiments, the mutant capsid protein retains the ability to form an AAV capsid. In some embodiments, the rAAV particles comprise an AAV5 tyrosine mutant capsid (Zhong L. et al., (2008) Proc Natl Acad Sci USA 105(22):7827-7832). In further embodiments, the rAAV particles comprise a capsid protein of an AAV serotype from Clades A-F (Gao et al., J. Virol. 2004, 78(12):6381). In some embodiments, the rAAV particles comprise an AAV1 capsid protein or a mutant thereof. In other embodiments, the rAAV particles comprise an AAV2 capsid protein or a mutant thereof. In some embodiments, the AAV serotype is AAV1, AAV2, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, or AAVrh10. In some embodiments, the rAAV particles comprise an AAV serotype 1 (AAV1) capsid. In some embodiments, the rAAV particles comprise an AAV serotype 2 (AAV2) capsid. In some embodiments, the recombinant AAV viral particles comprise an AAV1, AAV2, AAV8, AAVrh8R, AAV9, and / or AAVrh10 capsid.In some embodiments, AAV1, AAV2, AAV8, AAVrh8R, AAV9, and / or AAVrh10 capsids contain tyrosine mutations or heparan binding mutations, as described below, for example. In some embodiments, the capsid is a liver-targeting capsid; such as, but not limited to, the LK03 capsid, the HSC15 capsid, or the 17 capsid. In some embodiments, the capsid is an engineered AAV capsid (e.g., a shuffled capsid). Examples of engineered AAV capsids include, but are not limited to, DJ (Grimm D et al., J Virol. 2008, 82:5887-911), LK03 (Lisowski L et al., Nature, 2014, 506:382-6), and HSC15 and HSC17 (Smith LJ et al., Mol Ther, 2014 Sep;22(9):1625-34).

[0280] The capsids of AAVs (e.g., AAV2, AAV8, etc.) are known to include three capsid proteins: VP1, VP2, and VP3. These proteins contain a large amount of overlapping amino acid sequences and unique N-terminal sequences. The AAV2 capsid includes 60 subunits arranged in icosahedral symmetry (Xie, Q., et al. (2002) Proc. Natl. Acad. Sci. USA 99(16):10405-10). It has been found that VP1, VP2, and VP3 are present in a ratio of 1:1:10.

[0281] In some embodiments, the rAAV particle comprises a) an rAAV capsid comprising rAAV capsid proteins, the rAAV capsid proteins comprising one or more amino acid substitutions at one or more positions that interact with heparan sulfate proteoglycan, and b) an rAAV vector comprising a heterologous nucleic acid and at least one AAV inverted terminal repeat.

[0282] In some embodiments, the rAAV particles comprise one or more amino acid substitutions in the capsid protein, the amino acid substitutions reducing or eliminating the binding of the rAAV particles to heparan sulfate proteoglycan, and / or wherein the one or more amino acid substitutions are located at positions 484, 487, 532, 585, or 588 numbered based on AAV2 VP1 numbering. As used herein, "AAV2-based VP1 numbering" refers to the amino acids of the capsid protein corresponding to those of AAV2 VP1. For example, if one or more amino acid substitutions are located at positions 347, 350, 390, 395, 448, 451, 484, 487, 527, 532, 585, and / or 588 numbered based on AAV2 VP1 numbering, then the one or more amino acid substitutions are located at one or more amino acids of the capsid protein corresponding to amino acids 347, 350, 390, 395, 448, 451, 484, 487, 527, 532, 585, and / or 588 of AAV2 VP1. In some embodiments, the one or more amino acid substitutions are located at positions 484, 487, 532, 585, or 588 of AAV2 VP1. In some embodiments, the one or more amino acid substitutions are located at positions 484, 487, 532, 585, or 588 of AAV3 VP1 numbered based on AAV2 VP1 numbering. In some embodiments, the one or more amino acid substitutions are located at positions 485, 488, 528, 533, 586, or 589 numbered based on AAVrh8R VP1 numbering. In some embodiments, one or more amino acids at one or more positions corresponding to amino acids 585 and / or 588 (based on AAV2 VP1 numbering) are replaced with arginine residues (e.g., S586 and / or T589 of AAV1 or AAV6; S586 and / or A589 of AAV9; A586 and / or T589 of AAVrh8R; Q588 and / or T591 of AAV8; and Q588 and / or A591 of AAVrh10). In other embodiments, one or more amino acids (such as arginine or lysine) at one or more positions corresponding to amino acids 484, 487, 527, and / or 532 (based on AAV2 VP1 numbering) are replaced with one or more non-positively charged amino acids (such as alanine) (e.g., R485, R488, K528, and / or K533 of AAV1 or AAV6; RR485, R488, K528, and / or R533 of AAV9 or AAVrh8; and R487, R490, K530, and / or R535 of AAV8 or AAVrh10).

[0283] Production of AAV particles

[0284] Many methods are known in the art for generating rAAV vectors, including transfection, stable cell line production, and infectious hybrid virus production systems, including adenovirus-AAV hybrids, herpesvirus-AAV hybrids (Conway, JE et al. (1997) J. Virology 71(11):8780-8789) and baculovirus-AAV hybrids (Urabe, M. et al. (2002) Human Gene Therapy 13(16):1935-1943; Kotin, R. (2011) Hum Mol Genet. 20(R1):R2-R6). All rAAV production cultures for generating rAAV virions require: 1) a suitable host cell; 2) suitable helper virus functions; 3) AAV rep and cap genes and gene products; 4) a nucleic acid (such as a therapeutic nucleic acid) flanked by at least one AAV ITR sequence (e.g., an AAV genome encoding a variant PAH polypeptide); and 5) a suitable culture medium and culture medium components that support rAAV production. In some embodiments, the suitable host cell is a primate host cell. In some embodiments, the suitable host cell is a human cell line, such as HeLa, A549, 293, or Perc.6 cells. In some embodiments, the suitable helper virus functions are provided by wild-type or mutant adenoviruses (such as temperature-sensitive adenoviruses), herpesviruses (HSV), baculoviruses, or plasmid constructs that provide helper functions. In some embodiments, the AAV rep and cap gene products can be from any AAV serotype. Generally but not necessarily, the AAV rep gene product has the same serotype as the ITR of the rAAV vector genome, as long as the rep gene product can function to replicate and package the rAAV genome. Suitable culture media known in the art can be used to generate rAAV vectors. These media include, but are not limited to, media produced by Hyclone Laboratories and JRH, including Modified Eagle Medium (MEM); Dulbecco's Modified Eagle Medium (DMEM); custom formulations, such as those described in U.S. Patent No. 6,566,118; and Sf-900 II SFM medium as described in U.S. Patent No. 6,723,551, each patent (specifically regarding custom culture medium formulations for generating recombinant AAV vectors) is incorporated herein by reference in its entirety. In some embodiments, the AAV helper function is provided by adenovirus or HSV. In some embodiments, the AAV helper function is provided by baculovirus, and the host cell is an insect cell (e.g., Spodoptera frugiperda (Sf9) cells).

[0285] One method for generating rAAV particles is the triple transfection method. Briefly, plasmids containing the rep gene and the capsid gene can be transfected (e.g., using the calcium phosphate method) into a cell line (e.g., HEK-293 cells) together with an auxiliary adenovirus plasmid, and the virus can be collected and optionally purified. Thus, in some embodiments, rAAV particles are generated by triple transfection of a nucleic acid encoding an rAAV vector, a nucleic acid encoding AAV rep and cap, and a nucleic acid encoding AAV auxiliary virus functions into a host cell, wherein transfection of the nucleic acids into the host cell generates a host cell capable of generating rAAV particles.

[0286] In some embodiments, rAAV particles can be generated by the producer cell line method (see Martin et al., (2013) Human Gene Therapy Methods 24:253-269; U.S. Patent Application Publication No. US2004 / 0224411; and Liu, X.L. et al. (1999) Gene Ther. 6:293-299). Briefly, a cell line (e.g., HeLa, 293, A549, or Perc.6 cell line) can be stably transfected with a plasmid containing the rep gene, the capsid gene, and a vector genome containing a promoter - heterologous nucleic acid sequence (e.g., a variant PAH polypeptide). The cell line can be screened to select a lead clone for rAAV production, which can then be amplified to a production bioreactor and infected with an auxiliary virus (e.g., adenovirus or HSV) to initiate rAAV production. Subsequently, the virus can be harvested, the adenovirus can be inactivated (e.g., by heating) and / or removed, and the rAAV particles can be purified. Thus, in some embodiments, rAAV particles are generated by a producer cell line comprising one or more of a nucleic acid encoding an rAAV vector, a nucleic acid encoding AAV rep and cap, and a nucleic acid encoding AAV auxiliary virus functions. As described herein, the producer cell line method may be advantageous for generating rAAV particles with an overly large genome compared to the triple transfection method.

[0287] In some embodiments, the nucleic acids encoding the AAV rep and cap genes and / or the rAAV genome are stably maintained in the production cell line. In some embodiments, the nucleic acids encoding the AAV rep and cap genes and / or the rAAV genome are introduced into the cell line on one or more plasmids to generate the production cell line. In some embodiments, the AAV rep, AAV cap, and rAAV genome are introduced into the cell on the same plasmid. In other embodiments, the AAV rep, AAV cap, and rAAV genome are introduced into the cell on different plasmids. In some embodiments, a cell line stably transfected with the plasmid maintains the plasmid through multiple passages of the cell line (e.g., 5, 10, 20, 30, 40, 50, or more than 50 cell passages). For example, the one or more plasmids may replicate upon cell replication, or the one or more plasmids may integrate into the cell genome. A variety of sequences that enable plasmids to replicate autonomously in cells (e.g., human cells) have been identified (see, e.g., Krysan, P.J. et al. (1989) Mol. Cell Biol. 9:1026-1033). In some embodiments, the one or more plasmids may contain a selectable marker (e.g., an antibiotic resistance marker) that allows selection of cells that maintain the plasmid. Selectable markers commonly used for mammalian cells include, but are not limited to, blasticidin, G418, hygromycin B, bleomycin, puromycin, and their derivatives. Methods for introducing nucleic acids into cells are known in the art and include, but are not limited to, viral transduction, cationic transfection (e.g., using cationic polymers such as DEAE-dextran or cationic lipids such as lipofectamine), calcium phosphate transfection, microinjection, particle bombardment, electroporation, and nanoparticle transfection (for more details, see, e.g., Kim, T.K. and Eberwine, J.H. (2010) Anal. Bioanal. Chem. 397:3173-3178).

[0288] In some embodiments, the nucleic acids encoding the AAV rep and cap genes and / or the rAAV genome are stably integrated into the genome of the production cell line. In some embodiments, the nucleic acids encoding the AAV rep and cap genes and / or the rAAV genome are introduced into the cell line on one or more plasmids to generate the production cell line. In some embodiments, the AAV rep, AAV cap, and rAAV genome are introduced into the cell on the same plasmid. In other embodiments, the AAV rep, AAV cap, and rAAV genome are introduced into the cell on different plasmids. In some embodiments, the one or more plasmids may contain a selectable marker (e.g., an antibiotic resistance marker) that permits selection of cells that maintain the plasmid. Methods for stably integrating nucleic acids into a variety of host cell lines are known in the art. For example, repeated selection (e.g., by using a selectable marker) can be used to select cells that have integrated a nucleic acid containing the selectable marker (and the AAV cap and rep genes and / or the rAAV genome). In other embodiments, the nucleic acid can be integrated into the cell line in a site-specific manner to generate the production cell line. Some site-specific recombination systems are known in the art, such as FLP / FRT (see, e.g., O'Gorman, S. et al. (1991) Science 251:1351-1355), Cre / loxP (see, e.g., Sauer, B. and Henderson, N. (1988) Proc. Natl. Acad. Sci. 85:5166-5170), and phi C31-att (see, e.g., Groth, A.C. et al. (2000) Proc. Natl. Acad. Sci. 97:5995-6000).

[0289] In some embodiments, the production cell line is derived from a primate cell line (e.g., a non-human primate cell line such as the Vero or FRhL-2 cell line). In some embodiments, the cell line is derived from a human cell line. In some embodiments, the production cell line is derived from HeLa, 293, A549 or (Crucell) cells. For example, prior to introducing and / or stably maintaining / integrating the nucleic acids encoding the AAV rep and cap genes and / or an oversized rAAV genome into the cell line to generate the production cell line, the cell line is a HeLa, 293, A549 or (Crucell) cell line or a derivative thereof.

[0290] In some embodiments, the production cell line is adapted to grow in suspension. As is known in the art, anchorage-dependent cells typically cannot grow in suspension without a substrate (such as microcarrier beads). Adapting the cell line to grow in suspension can include, for example, using a medium lacking calcium and magnesium ions to prevent clumping (and optionally an antifoaming agent), using a culture vessel coated with a siliconizing compound, growing the cell line in a spinner culture with a stirrer paddle, and selecting cells from the culture (rather than in chunks or on the side of the vessel) at each passage. For further description, see, for example, the ATCC Frequently Asked Questions document (available at www.atcc.org / Global / FAQs / 9 / 1 / Adapting%20a%20monolayer%20cell%20line%20to%20suspension-40.aspx) and the references cited therein.

[0291] In some aspects, methods are provided for producing any of the rAAV particles disclosed herein, the methods comprising (a) culturing a host cell under conditions that produce rAAV particles, wherein the host cell comprises (i) one or more AAV packaging genes, wherein each of the AAV packaging genes encodes an AAV replication protein and / or a capsidization protein; (ii) an rAAV pre-vector that comprises a nucleic acid encoding a heterologous nucleic acid as described herein, flanked by at least one AAV ITR, and (iii) AAV helper functions; and (b) recovering the rAAV particles produced by the host cell. In some embodiments, the at least one AAV ITR is selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, caprine AAV, bovine AAV, or murine AAV serotype ITRs, etc. For example, in some embodiments, the AAV serotype is AAV1, AAV2, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, or AAVrh10. In certain embodiments, the nucleic acid in the AAV comprises AAV2 ITRs. In some embodiments, the capsidization protein is selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV2 / 2-7m8, AAV DJ, AAV2 N587A, AAV2 E548A, AAV2 N708A, AAV V708K, caprine AAV, AAV1 / AAV2 chimeric, bovine AAV, or murine AAV capsid rAAV2 / HBoV1 serotype capsid protein or mutants thereof. In some embodiments, the capsidization protein is the AAV8 capsid protein. In some embodiments, the rAAV particle comprises an AAV8 capsid and a recombinant genome comprising AAV2 ITRs, and a nucleic acid encoding a therapeutic transgene / nucleic acid (e.g., a nucleic acid encoding a variant PAH polypeptide).

[0292] Suitable rAAV production media for the present invention can be supplemented with serum or serum-derived recombinant proteins at levels of 0.5% - 20% (v / v or w / v). Alternatively, as is known in the art, rAAV vectors can be produced under serum-free conditions, which can also be referred to as media free of animal-derived products. One of ordinary skill in the art will understand that commercial or custom media designed to support rAAV vector production can also be supplemented with one or more cell culture components known in the art, including but not limited to glucose, vitamins, amino acids, and / or growth factors, in order to increase the titer of rAAV in the production culture.

[0293] rAAV production cultures can be grown under a variety of conditions (over a wide temperature range, for different lengths of time, etc.) suitable for the particular host cell used. As is known in the art, rAAV production cultures include adherent-dependent cultures, which can be cultured in suitable adherent-dependent vessels (such as roller bottles, hollow fiber filters, microcarriers, and packed bed or fluidized bed bioreactors). rAAV vector production cultures can also include suspension-adapted host cells, such as HeLa, 293, and SF-9 cells, which can be cultured in a variety of ways, including for example spinner flasks, stirred tank bioreactors, and single-use systems such as Wave bag systems.

[0294] The rAAV vector particles of the present invention can be harvested from rAAV production cultures by lysing the host cells of the production culture or by harvesting the spent media from the production culture, provided that the cells are cultured under conditions known in the art to cause the release of rAAV particles from intact cells into the media, as more fully described in U.S. Patent No. 6,566,118. Suitable methods for lysing cells are also known in the art and include, for example, multiple freeze / thaw cycles, sonication, microfluidization, and treatment with chemicals (such as detergents and / or proteases).

[0295] In another embodiment, the rAAV particles are purified. As used herein, the term "purified" includes preparations of rAAV particles that lack at least some of the other components that may also be present where the rAAV particles occur naturally or are initially prepared. Thus, for example, isolated rAAV particles can be prepared by enriching them from a source mixture (such as a culture lysate or production culture supernatant) using purification techniques. Enrichment can be measured in a variety of ways, such as by the ratio of DNase-resistant particles (DRP) or genomic copies (gc) present in the solution, or by infectivity, or it can be measured based on the presence of a second potential interfering substance (such as contaminants, including production culture contaminants or in-process contaminants, including helper viruses, media components, etc.) present in the source mixture.

[0296] In some embodiments, the rAAV production culture harvest is clarified to remove host cell debris. In some embodiments, the production culture harvest is clarified by filtering through a series of depth filters, including, for example, DOHC grade Millipore Millistak+HC Pod filters, A1HC grade Millipore Millistak+HC Pod filters, and 0.2 μm Filter Opticap XL10 Millipore Express SHC hydrophilic membrane filters. Clarification can also be achieved by a variety of other standard techniques known in the art, such as centrifugation or filtration through any cellulose acetate filter having a pore size of 0.2 μm or greater known in the art.

[0297] In some embodiments, the rAAV production culture harvest is further processed to digest any high molecular weight DNA present in the production culture. In some embodiments, the digestion is carried out under standard conditions known in the art, the standard conditions including, for example, a final concentration of 1 - 2.5 units / ml of for a period of 30 minutes to several hours at a temperature ranging from ambient temperature to 37°C.

[0298] The rAAV particles can be isolated or purified using one or more of the following purification steps: equilibrium centrifugation; flow-through anion exchange filtration; tangential flow filtration (TFF) for concentrating rAAV particles; capture of rAAV by hydroxyapatite chromatography; heat inactivation of helper virus; capture of rAAV by hydrophobic interaction chromatography; buffer exchange by size exclusion chromatography (SEC); nanofiltration; and capture of rAAV by anion exchange chromatography, cation exchange chromatography, or affinity chromatography. These steps can be used alone, in various combinations, or in different orders. In some embodiments, the method includes all steps in the order described below. Methods for purifying rAAV particles are described, for example, in the following references: Xiao et al., (1998) Journal of Virology 72:2224 - 2232; U.S. Patent Nos. 6,989,264 and 8,137,948; and WO 2010 / 148143.

[0299] VI. Treatment Methods

[0300] Certain aspects of the present disclosure relate to methods of treating phenylketonuria and / or reducing phenylalanine levels in an individual in need thereof. Phenylketonuria (PKU) is caused by a deficiency in phenylalanine hydroxylase (PAH), which results in elevated blood Phe levels that are toxic to the brain and subsequently lead to severe mental disorders without treatment. Current treatment by dietary restriction is effective, but non-compliance in adolescents and adults is a major problem.

[0301] Efforts to treat PKU have been hampered by low human PAH activity in gene therapy vectors. The present methods are based in part on the discovery of variant PAH polypeptides having improved protein stability and enzymatic activity compared to endogenous human PAH polypeptides. Treatment of PKU by gene therapy using an rAAV vector encoding a variant PAH polypeptide described herein results in better reduction of blood and brain Phe levels compared to vectors encoding endogenous human PAH. In addition, while both hPAH and hPAH-V1 improve the transport of Tyr and Trp to the brain, only animals treated with the variant PAH have normalized levels of brain neurotransmitters (including dopamine and serotonin), indicating different sensitivities to the effects of Phe.

[0302] In some embodiments, the present invention provides a method for treating PKU, which comprises administering to an individual in need thereof a therapeutically effective amount of a variant PAH polypeptide as described herein. In some embodiments, the variant PAH polypeptide comprises at least three amino acid substitutions, wherein the amino acid substitutions are located at positions selected from M180, K199, S250, and G256 of the wild-type human PAH polypeptide. In some embodiments, the variant PAH polypeptide comprises four amino acid substitutions at positions M180, K199, S250, and G256 of the wild-type human PAH polypeptide. In some embodiments, the variant PAH polypeptide comprises at least three amino acid substitutions selected from M180T, K199P, S250P, and G256A. In some embodiments, the variant PAH polypeptide comprises the amino acid substitutions M180T, K199P, S250P, and G256A. In some embodiments, the variant PAH polypeptide comprises amino acid substitutions including the following: K199P, S250P, and G256A; M180T, S250P, and G256A; M180T, K199P, and G256A; or M180T, K199P, and S250P. In some embodiments, the variant PAH polypeptide comprises the amino acid substitutions M180T, K199P, S250P, and G256A. In some embodiments, the variant PAH polypeptide further comprises the amino acid substitutions H264P, G272A, G272P, P275L, P279Q, G272P, and P275L, or the amino acid substitutions T323R and F327T. In some embodiments, the variant PAH polypeptide is any one of the variant PAH polypeptides listed in Tables 1-3. In some embodiments, the variant PAH polypeptide comprises the amino acid substitutions M180T, K199P, S250P, and G256A, and comprises additional amino acid substitutions while at least substantially maintaining the phenylalanine hydroxylase activity of the wild-type PAH. In some embodiments, the positions of the amino acid substitutions are based on the wild-type human PAH polypeptide; for example, the human PAH polypeptide comprising the amino acid sequence of SEQ ID NO:1. In some embodiments, the variant PAH polypeptide is a fusion polypeptide. In some embodiments, the variant PAH polypeptide is a fusion polypeptide fused with a tissue-targeting peptide. In some embodiments, the variant PAH polypeptide is a fusion polypeptide fused with a liver-targeting polypeptide. Examples of liver-targeting polypeptides include, but are not limited to, a fragment of human hepatocyte growth factor (Eavri and Lorberboum-Galkski, J Biol Chem 2007, 282:23402-23409) or a glycoprotein that binds to the asialoglycoprotein receptor of hepatocytes (Huang, et al., Bioconjugate Chemistry 2017, 28:283-295).

[0303] In some embodiments, the present invention provides methods of treating PKU by administering an effective amount of a variant PAH polypeptide of the present disclosure. The variant PAH polypeptide can be administered to a particular tissue of interest or can be administered systemically. In some embodiments, an effective amount of the variant PAH polypeptide can be administered parenterally. Parenteral administration routes can include, but are not limited to, intravenous, intraperitoneal, intraosseous, intraarterial, intracerebral, intramuscular, intrathecal, subcutaneous, intraventricular, intrahepatic, etc. In some embodiments, an effective amount of the variant PAH polypeptide can be administered by one route of administration. In some embodiments, an effective amount of the variant PAH polypeptide can be administered by a combination of more than one route of administration. In some embodiments, an effective amount of the variant PAH polypeptide is administered to one location. In other embodiments, an effective amount of the variant PAH polypeptide can be administered to more than one location.

[0304] In some embodiments, the present invention provides a method for treating PKU, which comprises administering to an individual in need thereof a therapeutically effective amount of a nucleic acid (e.g., DNA or mRNA) encoding a variant PAH polypeptide as described herein. In some embodiments, the nucleic acid encodes a variant PAH polypeptide comprising at least three amino acid substitutions, wherein the amino acid substitutions are located at positions selected from M180, K199, S250, and G256 of the wild-type human PAH polypeptide. In some embodiments, the nucleic acid encodes a variant PAH polypeptide comprising four amino acid substitutions at positions M180, K199, S250, and G256 of the wild-type human PAH polypeptide. In some embodiments, the nucleic acid encodes a variant PAH polypeptide comprising at least three amino acid substitutions selected from M180T, K199P, S250P, and G256A. In some embodiments, the nucleic acid encodes a variant PAH polypeptide comprising the amino acid substitutions M180T, K199P, S250P, and G256A. In some embodiments, the nucleic acid encodes a variant PAH polypeptide comprising amino acid substitutions including: K199P, S250P, and G256A; M180T, S250P, and G256A; M180T, K199P, and G256A; or M180T, K199P, and S250P. In some embodiments, the nucleic acid encodes a variant PAH polypeptide comprising the amino acid substitutions M180T, K199P, S250P, and G256A. In some embodiments, the nucleic acid encodes a variant PAH polypeptide further comprising amino acid substitutions H264P, G272A, G272P, P275L, P279Q, G272P, and P275L, or T323R and F327T amino acid substitutions. In some embodiments, the nucleic acid encoding is a variant PAH polypeptide of any of the variant PAH polypeptides listed in Tables 1-3. In some embodiments, the nucleic acid encodes a variant PAH polypeptide comprising the amino acid substitutions M180T, K199P, S250P, and G256A and comprising additional amino acid substitutions while at least substantially maintaining the phenylalanine hydroxylase activity of wild-type PAH. In some embodiments, the positions of the amino acid substitutions encoded by the nucleic acid are based on the wild-type human PAH polypeptide; for example, a human PAH polypeptide comprising the amino acid sequence of SEQ ID NO:1.

[0305] In some embodiments, the nucleic acid encodes a variant human PAH polypeptide. In some embodiments, the nucleic acid encodes a variant PAH polypeptide comprising the amino acid sequence of SEQ ID NO: 3. In some embodiments, the nucleic acid encodes a variant PAH polypeptide comprising an amino acid sequence having at least about 80%, 85%, 90%, 95%, or 99% identity to the amino acid sequence of SEQ ID NO: 3. In some embodiments, the nucleic acid encodes a variant PAH polypeptide comprising an amino acid sequence having at least about 80%, 85%, 90%, 95%, or 99% identity to the amino acid sequence of SEQ ID NO: 3 and having at least about 25%, 50%, 75%, 100%, or greater than 100% of the phenylalanine hydroxylase activity of wild-type PAH. In some embodiments, the nucleic acid encodes a variant PAH polypeptide comprising an amino acid sequence having at least about 80%, 85%, 90%, 95%, or 99% identity to the amino acid sequence of SEQ ID NO: 3 and having at least about 25%, 50%, 75%, 100%, or greater than 100% of the phenylalanine hydroxylase activity of wild-type PAH of SEQ ID NO: 1. In some embodiments, the nucleic acid encoding the variant PAH polypeptide is DNA. In some embodiments, the nucleic acid encoding the variant PAH polypeptide is RNA (e.g., mRNA).

[0306] In some embodiments, the nucleic acid encodes a variant PAH polypeptide that is a truncated PAH polypeptide maintaining phenylalanine hydroxylase activity. In some embodiments, the nucleic acid encoding comprises a truncated PAH polypeptide with an N-terminal truncation. In some embodiments, the nucleic acid encoding is a partial or complete truncation of the N-terminal regulatory domain, an N-terminal truncation. In some embodiments, the nucleic acid encoding comprises an N-terminal truncation with a deletion of amino acid residues 1 to about amino acid residue 102 of the wild-type human PAH polypeptide (e.g., the PAH polypeptide of SEQ ID NO:1). In some embodiments, the nucleic acid encoding comprises a truncated PAH polypeptide with a C-terminal truncation. In some embodiments, the nucleic acid encoding is a partial or complete truncation of the tetramerization domain, a C-terminal truncation. In some embodiments, the nucleic acid encoding comprises a C-terminal truncation with a deletion of amino acid residues approximately 429 to 452 of the wild-type human PAH polypeptide (e.g., the PAH polypeptide of SEQ ID NO:1). In some embodiments, the nucleic acid encoding comprises a variant PAH polypeptide with both an N-terminal truncation and a C-terminal truncation. In some embodiments, the truncated PAH polypeptide comprises a partial or complete truncation of the N-terminal regulatory sequence and a partial or complete truncation of the tetramerization domain. In some embodiments, the truncated PAH polypeptide comprises deletions of amino acid residues 1 to about amino acid residue 102 and approximately 429 to about 452 of the wild-type human PAH polypeptide (e.g., the PAH polypeptide of SEQ ID NO:1). In some embodiments, the nucleic acid encoding comprises a variant PAH polypeptide with an amino acid sequence corresponding to amino acid residues approximately 102 to about 428 of the wild-type human PAH polypeptide (e.g., the PAH polypeptide of SEQ ID NO:1). In some embodiments, the nucleic acid encoding comprises a variant PAH polypeptide with an amino acid sequence corresponding to amino acid residues 102 to 428 of the wild-type human PAH polypeptide (e.g., the PAH polypeptide of SEQ ID NO:1). In some embodiments, the nucleic acid encoding further comprises a truncated PAH polypeptide with four amino acid substitutions at positions M180, K199, S250, and G256 of the wild-type human PAH polypeptide (e.g., the PAH polypeptide of SEQ ID NO:1). In some embodiments, the nucleic acid encoding comprises a truncated PAH polypeptide with four amino acid substitutions selected from M180T, K199P, S250P, and G256A. In some embodiments, the nucleic acid encoding further comprises a truncated variant PAH polypeptide with any combination of the amino acid substitutions listed in Tables 1-3. In some embodiments, the nucleic acid encoding has a truncated PAH polypeptide with at least about 25%, 50%, 75%, 100%, or greater than 100% of the phenylalanine hydroxylase activity of wild-type PAH (e.g., the PAH polypeptide of SEQ ID NO:1). In some embodiments, the nucleic acid encoding a variant PAH polypeptide encodes a fusion polypeptide fused to a tissue-targeting peptide.In some embodiments, the variant PAH polypeptide is a fusion polypeptide fused to a liver-targeting peptide. In some embodiments, the nucleic acid encoding the variant PAH polypeptide is DNA. In some embodiments, the nucleic acid encoding the variant PAH polypeptide is RNA (e.g., mRNA).

[0307] In some embodiments, the present invention provides a method for treating PKU by administering an effective amount of a nucleic acid encoding a variant PAH polypeptide of the present disclosure. The nucleic acid encoding the variant PAH polypeptide can be administered to a specific tissue of interest or can be administered systemically. In some embodiments, an effective amount of the nucleic acid encoding the variant PAH polypeptide can be administered parenterally. Parenteral administration routes can include, but are not limited to, intravenous, intraperitoneal, intraosseous, intraarterial, intracerebral, intramuscular, intrathecal, subcutaneous, intraventricular, intrahepatic, etc. In some embodiments, the expression of variant PAH from tissues other than the liver may require the presence of the cofactor BH4 (e.g., systemic delivery or co-expression from the nucleic acid) Ding et al., Mol Ther 2008, 16:673-681. In some embodiments, an effective amount of the nucleic acid encoding the variant PAH polypeptide can be administered by one administration route. In some embodiments, an effective amount of the nucleic acid encoding the variant PAH polypeptide can be administered by a combination of more than one administration route. In some embodiments, an effective amount of the nucleic acid encoding the variant PAH polypeptide can be administered to one location. In other embodiments, an effective amount of the variant PAH polypeptide can be administered to more than one location. In some embodiments, the nucleic acid encoding the variant PAH polypeptide is DNA. In some embodiments, the nucleic acid encoding the variant PAH polypeptide is RNA (e.g., mRNA).

[0308] In some aspects of the present invention, the nucleic acid encoding the variant PAH polypeptide is delivered to an individual by a viral vector. Viral vectors for gene therapy are known in the art. In some aspects, the present invention provides a method for treating PKU by administering an effective amount of lentiviral particles encoding a variant PAH polypeptide of the present disclosure. In some aspects, the present invention provides a method for treating PKU by administering an effective amount of rAAV particles encoding a variant PAH polypeptide of the present disclosure. The rAAV can be administered to a specific tissue of interest or can be administered systemically. In some embodiments, an effective amount of rAAV can be administered parenterally. Parenteral administration routes can include, but are not limited to, intravenous, intraperitoneal, intraosseous, intraarterial, intracerebral, intramuscular, intrathecal, subcutaneous, intraventricular, intrahepatic, etc. In some embodiments, an effective amount of rAAV can be administered by one administration route. In some embodiments, an effective amount of rAAV can be administered by a combination of more than one administration route. In some embodiments, an effective amount of rAAV is administered to one location. In other embodiments, an effective amount of rAAV can be administered to more than one location.

[0309] For a therapeutic purpose, an effective amount of rAAV (in particle form in some embodiments) is administered. For example, when a low percentage of transduction can achieve the desired therapeutic effect, the goal of treatment is generally to reach or exceed this transduction level. In some cases, such a transduction level can be achieved by transducing only about 1% to 5% of the target cells of the desired tissue type, in some embodiments at least about 20% of the cells of the desired tissue type, in some embodiments at least about 50%, in some embodiments at least about 80%, in some embodiments at least about 95%, in some embodiments at least about 99% of the cells of the desired tissue type. The rAAV composition can be administered by one or more administrations during the same procedure or at intervals of days, weeks, months, or years. One or more of any of the administration routes described herein can be used. In some embodiments, multiple vectors can be used to treat a human.

[0310] Methods for identifying cells transduced by AAV viral particles are known in the art; for example, immunohistochemistry or the use of markers such as enhanced green fluorescent protein can be used to detect the transduction of viral particles; for example, viral particles comprising an rAAV capsid having one or more amino acid substitutions.

[0311] In some embodiments, an effective amount of rAAV particles is administered to more than one location simultaneously or sequentially. In other embodiments, an effective amount of rAAV particles is administered to a single location more than once (e.g., repeatedly). In some embodiments, multiple injections of rAAV viral particles are spaced no more than 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 9 hours, 12 hours, or 24 hours apart.

[0312] In some embodiments, the present invention provides a method for treating a human having PKU by administering a pharmaceutical composition comprising an effective amount of a recombinant viral vector encoding a variant PAH polypeptide of the present disclosure. In some embodiments, the pharmaceutical composition comprises one or more pharmaceutically acceptable excipients.

[0313] In some embodiments, the method comprises administering a pharmaceutical composition comprising an effective amount of a recombinant viral vector encoding a variant PAH polypeptide of the present disclosure to treat PKU in an individual in need thereof. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is at least about any of the following: 5×10 12 、6×10 12 、7×10 12 、8×10 12 、9×10 12 、10×10 12 、11×10 12, 15 × 10 12 , 20 × 10 12 , 25 × 10 12 , 30 × 10 12 or 50 × 10 12 genome copies / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is about any one of the following: 5 × 10 12 to 6 × 10 12 , 6 × 10 12 to 7 × 10 12 , 7 × 10 12 to 8 × 10 12 , 8 × 10 12 to 9 × 10 12 , 9 × 10 12 to 10 × 10 12 , 10 × 10 12 to 11 × 10 12 , 11 × 10 12 to 15 × 10 12 , 15 × 10 12 to 20 × 10 12 , 20 × 10 12 to 25 × 10 12 , 25 × 10 12 to 30 × 10 12 , 30 × 10 12 to 50 × 10 12 or 50 × 10 12 to 100 × 10 12 genome copies / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is about any one of the following: 5 × 10 12 to 10 × 10 12 , 10 × 10 12 to 25 × 10 12 or 25 × 10 12 to 50 × 10 12 genome copies / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is at least about any one of the following: 5 × 10 9 , 6 × 10 9 , 7 × 10 9 , 8 × 10 9 , 9 × 10 9 , 10 × 10 9 , 11 × 10 9 , 15 × 10 9 , 20 × 10 9 , 25 × 10 9 , 30 × 109 or 50×10 9 transducing units / mL. In some embodiments, the viral titer of viral particles (e.g., rAAV particles) is about any one of the following: 5×10 9 to 6×10 9 、6×10 9 to 7×10 9 、7×10 9 to 8×10 9 、8×10 9 to 9×10 9 、9×10 9 to 10×10 9 、10×10 9 to 11×10 9 、11×10 9 to 15×10 9 、15×10 9 to 20×10 9 、20×10 9 to 25×10 9 、25×10 9 to 30×10 9 、30×10 9 to 50×10 9 or 50×10 9 to 100×10 9 transducing units / mL. In some embodiments, the viral titer of viral particles (e.g., rAAV particles) is about any one of the following: 5×10 9 to 10×10 9 、10×10 9 to 15×10 9 、15×10 9 to 25×10 9 or 25×10 9 to 50×10 9 transducing units / mL. In some embodiments, the viral titer of viral particles (e.g., rAAV particles) is at least about any one of the following: 5×10 10 、6×10 10 、7×10 10 、8×10 10 、9×10 10 、10×10 10 、11×10 10 、15×10 10 、20×10 10 、25×10 10 、30×10 10 、40×10 10 or 50×1010 infectious units / mL. In some embodiments, the viral titer of viral particles (e.g., rAAV particles) is at least about any one of the following: 5×10 10 to 6×10 10 、6×10 10 to 7×10 10 、7×10 10 to 8×10 10 、8×10 10 to 9×10 10 、9×10 10 to 10×10 10 、10×10 10 to 11×10 10 、11×10 10 to 15×10 10 、15×10 10 to 20×10 10 、20×10 10 to 25×10 10 、25×10 10 to 30×10 10 、30×10 10 to 40×10 10 、40×10 10 to 50×10 10 or 50×10 10 to 100×10 10 infectious units / mL. In some embodiments, the viral titer of viral particles (e.g., rAAV particles) is at least about any one of the following: 5×10 10 to 10×10 10 、10×10 10 to 15×10 10 、15×10 10 to 25×10 10 or 25×10 10 to 50×10 10 infectious units / mL.

[0314] In some embodiments, the dose of viral particles administered to an individual is at least about any one of the following: 1×10 8 to about 6×10 13 genomic copies / kg body weight. In some embodiments, the dose of viral particles administered to an individual is about any one of the following: 1×10 8 to about 6×10 13 genomic copies / kg body weight.

[0315] In some embodiments, the total amount of viral particles administered to an individual is at least about any of the following: 1×10 9 to about 1×10 14 genomic copies. In some embodiments, the total amount of viral particles administered to an individual is about any of the following: 1×10 9 to about 1×10 14 genomic copies.

[0316] The compositions of the present invention (e.g., recombinant viral particles comprising a vector encoding a variant PAH polypeptide of the present disclosure) can be used alone or in combination with one or more additional therapeutic agents for the treatment of PKU. The interval between successive administrations can be at least (or, alternatively, less than) minutes, hours, or days.

[0317] For therapeutic purposes, an effective amount of rAAV (in particle form in some embodiments) is administered. For example, when a low percentage of transduction can achieve the desired therapeutic effect, the goal of treatment is typically to reach or exceed this transduction level. In some cases, such a transduction level can be achieved by transducing only about 1% to 5% of the target cells, in some embodiments at least about 20% of the cells of the desired tissue type, in some embodiments at least about 50%, in some embodiments at least about 80%, in some embodiments at least about 95%, in some embodiments at least about 99% of the cells of the desired tissue type. The rAAV composition can be administered by one or more administrations during the same procedure or spaced days, weeks, months, or years apart. In some embodiments, multiple vectors can be used to treat a mammal (e.g., a human).

[0318] In some embodiments, the rAAV compositions of the present disclosure can be used for administration to humans. In some embodiments, the rAAV compositions of the present disclosure can be used for pediatric administration. Without wishing to be bound by theory, since many of the symptoms of PKU are developmental in nature (e.g., severe mental impairment), it may be particularly advantageous to treat PKU as early as possible. In some embodiments, an effective amount of rAAV (in particle form in some embodiments) is administered to a patient less than one month, less than two months, less than three months, less than four months, less than five months, less than six months, less than seven months, less than eight months, less than nine months, less than ten months, less than eleven months, less than one year, less than 13 months, less than 14 months, less than 15 months, less than 16 months, less than 17 months, less than 18 months, less than 19 months, less than 20 months, less than 21 months, less than 22 months, less than two years, or less than three years of age.

[0319] In some embodiments, the rAAV compositions of the present disclosure can be used for administration to young adults. In some embodiments, an effective amount of rAAV (in some embodiments in particle form) is administered to a patient who is less than 12 years old, less than 13 years old, less than 14 years old, less than 15 years old, less than 16 years old, less than 17 years old, less than 18 years old, less than 19 years old, less than 20 years old, less than 21 years old, less than 22 years old, less than 23 years old, less than 24 years old, or less than 25 years old.

[0320] In some embodiments, the present invention provides a method for treating PKU, which comprises administering to an individual in need thereof a therapeutically effective amount of a cell comprising a nucleic acid encoding a variant PAH polypeptide as described herein. In some embodiments, the cell comprises a nucleic acid encoding a variant PAH polypeptide comprising at least three amino acid substitutions, wherein the amino acid substitutions are located at positions selected from M180, K199, S250, and G256 of the wild-type human PAH polypeptide. In some embodiments, the nucleic acid in the cell encodes a variant PAH polypeptide comprising four amino acid substitutions at positions M180, K199, S250, and G256 of the wild-type human PAH polypeptide. In some embodiments, the nucleic acid in the cell encodes a variant PAH polypeptide comprising at least three amino acid substitutions selected from M180T, K199P, S250P, and G256A. In some embodiments, the nucleic acid in the cell encodes a variant PAH polypeptide comprising the amino acid substitutions M180T, K199P, S250P, and G256A. In some embodiments, the nucleic acid in the cell encodes a variant PAH polypeptide comprising amino acid substitutions including: K199P, S250P, and G256A; M180T, S250P, and G256A; M180T, K199P, and G256A; or M180T, K199P, and S250P. In some embodiments, the nucleic acid in the cell encodes a variant PAH polypeptide comprising the amino acid substitutions M180T, K199P, S250P, and G256A. In some embodiments, the nucleic acid in the cell encodes a variant PAH polypeptide further comprising amino acid substitutions H264P, G272A, G272P, P275L, P279Q, G272P, and P275L, or T323R and F327T amino acid substitutions. In some embodiments, the nucleic acid encoding in the cell is a variant PAH polypeptide of any of the variant PAH polypeptides listed in Tables 1-3. In some embodiments, the nucleic acid encoding in the cell comprises the amino acid substitutions M180T, K199P, S250P, and G256A, and comprises additional amino acid substitutions while at least substantially maintaining the phenylalanine hydroxylase activity of wild-type PAH. In some embodiments, the positions of the amino acid substitutions encoded by the nucleic acid in the cell are based on the wild-type human PAH polypeptide; for example, a human PAH polypeptide comprising the amino acid sequence of SEQ ID NO:1.

[0321] In some embodiments, the nucleic acid in the cell encodes a variant human PAH polypeptide. In some embodiments, the nucleic acid in the cell encodes a variant PAH polypeptide comprising the amino acid sequence of SEQ ID NO:3. In some embodiments, the nucleic acid in the cell encodes a variant PAH polypeptide comprising an amino acid sequence having at least about 80%, 85%, 90%, 95%, or 99% identity to the amino acid sequence of SEQ ID NO:3. In some embodiments, the nucleic acid in the cell encodes a variant PAH polypeptide comprising an amino acid sequence having at least about 80%, 85%, 90%, 95%, or 99% identity to the amino acid sequence of SEQ ID NO:3 and having at least about 25%, 50%, 75%, 100%, or greater than 100% of the phenylalanine hydroxylase activity of wild-type PAH. In some embodiments, the nucleic acid in the cell encodes a variant PAH polypeptide comprising an amino acid sequence having at least about 80%, 85%, 90%, 95%, or 99% identity to the amino acid sequence of SEQ ID NO:3 and having at least about 25%, 50%, 75%, 100%, or greater than 100% of the phenylalanine hydroxylase activity of wild-type PAH of SEQ ID NO:1.

[0322] In some embodiments, the nucleic acid encoding in the cell is a variant PAH polypeptide that truncates the PAH polypeptide while maintaining phenylalanine hydroxylase activity. In some embodiments, the nucleic acid encoding in the cell comprises a truncated PAH polypeptide with an N-terminal truncation. In some embodiments, the nucleic acid encoding in the cell is a partial or complete truncation of the N-terminal regulatory domain, an N-terminal truncation. In some embodiments, the nucleic acid encoding in the cell comprises an N-terminal truncation with a deletion of amino acid residues 1 to about amino acid residue 102 of the wild-type human PAH polypeptide (e.g., the PAH polypeptide of SEQ ID NO:1). In some embodiments, the nucleic acid encoding in the cell comprises a truncated PAH polypeptide with a C-terminal truncation. In some embodiments, the nucleic acid encoding in the cell is a partial or complete truncation of the tetramerization domain, a C-terminal truncation. In some embodiments, the nucleic acid encoding in the cell comprises a C-terminal truncation with a deletion of about amino acid residues 429 to 452 of the wild-type human PAH polypeptide (e.g., the PAH polypeptide of SEQ ID NO:1). In some embodiments, the nucleic acid encoding in the cell comprises a variant PAH polypeptide with both an N-terminal truncation and a C-terminal truncation. In some embodiments, the truncated PAH polypeptide comprises a partial or complete truncation of the N-terminal regulatory sequence and a partial or complete truncation of the tetramerization domain. In some embodiments, the truncated PAH polypeptide comprises deletions of amino acid residues 1 to about amino acid residue 102 and about amino acid residues 429 to about amino acid residue 452 of the wild-type human PAH polypeptide (e.g., the PAH polypeptide of SEQ ID NO:1). In some embodiments, the nucleic acid encoding in the cell comprises a variant PAH polypeptide corresponding to the amino acid sequence of about amino acid residues 102 to about amino acid residue 428 of the wild-type human PAH polypeptide (e.g., the PAH polypeptide of SEQ ID NO:1). In some embodiments, the nucleic acid encoding in the cell comprises a variant PAH polypeptide corresponding to the amino acid sequence of amino acid residues 102 to 428 of the wild-type human PAH polypeptide (e.g., the PAH polypeptide of SEQ ID NO:1). In some embodiments, the nucleic acid encoding in the cell further comprises a truncated PAH polypeptide with four amino acid substitutions at positions M180, K199, S250, and G256 of the wild-type human PAH polypeptide (e.g., the PAH polypeptide of SEQ ID NO:1). In some embodiments, the nucleic acid encoding in the cell comprises a truncated PAH polypeptide with four amino acid substitutions selected from M180T, K199P, S250P, and G256A. In some embodiments, the nucleic acid encoding in the cell further comprises a truncated variant PAH polypeptide with any combination of the amino acid substitutions listed in Tables 1-3.In some embodiments, the nucleic acid in the cell encodes a truncated PAH polypeptide having phenylalanine hydroxylase activity that is at least about 25%, 50%, 75%, 100%, or greater than 100% of wild-type PAH (e.g., the PAH polypeptide of SEQ ID NO:1).

[0323] In some embodiments, the present invention provides methods for treating PKU by administering an effective amount of a cell comprising a nucleic acid encoding a variant PAH polypeptide of the present disclosure. The cell comprising a nucleic acid encoding a variant PAH polypeptide can be administered to a particular tissue of interest or can be administered systemically. In some embodiments, an effective amount of a cell comprising a nucleic acid encoding a variant PAH polypeptide can be administered parenterally. Parenteral administration routes can include, but are not limited to, intravenous, intraperitoneal, intraosseous, intraarterial, intracerebral, intramuscular, intrathecal, subcutaneous, intraventricular, intrahepatic, etc. In some embodiments, the cell is encapsulated or in a device. In some embodiments, cells that express PAH outside the liver may require exogenous addition or co-expression of the cofactor BH4. In some embodiments, the cell is encapsulated or in a device that also contains BH4. In some embodiments, an effective amount of a cell comprising a nucleic acid encoding a variant PAH polypeptide can be administered by one route of administration. In some embodiments, an effective amount of a nucleic acid encoding a variant PAH polypeptide can be administered by a combination of more than one route of administration. In some embodiments, an effective amount of a nucleic acid encoding a variant PAH polypeptide can be administered to one location. In other embodiments, an effective amount of a variant PAH polypeptide can be administered to more than one location.

[0324] In some embodiments, the cell comprising a nucleic acid encoding a variant PAH polypeptide is a hepatocyte, muscle cell, fibroblast, endothelial cell, epithelial cell, blood cell, bone marrow cell, stem cell, or induced pluripotent stem cell. In some embodiments, the cell further comprises exogenously added cofactor BH4 and / or co-expressed cofactor BH4.

[0325] In some embodiments, the cell is a cell line (e.g., CHO cell line, HeLa cell line, etc.). In some embodiments, the present invention provides methods for producing a variant PAH polypeptide, which include culturing a cell comprising a nucleic acid encoding a variant PAH polypeptide (e.g., an expression vector encoding a variant PAH polypeptide) under conditions for producing the variant PAH polypeptide. In some embodiments, the method for producing a variant PAH polypeptide further comprises one or more steps of purifying the variant PAH polypeptide.

[0326] VII. Kits or Articles

[0327] Variant PAH polypeptides, nucleic acids, rAAV vectors, particles, and / or pharmaceutical compositions as described herein can be included, for example, in a kit or article of manufacture designed for one of the methods of the invention as described herein.

[0328] Generally, the system includes a cannula suitable for the methods of the invention, one or more syringes (e.g., 1, 2, 3, 4, or more), and one or more fluids (e.g., 1, 2, 3, 4, or more).

[0329] The syringe can be any suitable syringe so long as it can be connected to the cannula for delivering the fluid. In some embodiments, the system has one syringe. In some embodiments, the system has two syringes. In some embodiments, the system has three syringes. In some embodiments, the system has four or more syringes. Fluids suitable for the methods of the invention include the fluids described herein, e.g., one or more fluids each containing an effective amount of one or more carriers as described herein, and one or more fluids containing one or more therapeutic agents.

[0330] In some embodiments, the kit contains a single fluid (e.g., a pharmaceutically acceptable fluid containing an effective amount of a carrier). In some embodiments, the kit contains 2 fluids. In some embodiments, the kit contains 3 fluids. In some embodiments, the kit contains 4 or more fluids. The fluid can include a diluent, buffer, excipient, or any other liquid described herein or known in the art suitable for delivering, diluting, stabilizing, buffering, or otherwise transporting the variant PAH polypeptide or rAAV vector composition of the present disclosure. In some embodiments, the kit contains one or more buffers, such as an aqueous pH buffer solution. Examples of buffers can include, but are not limited to, phosphates, citrates, Tris, HEPES, and other organic acid buffers.

[0331] In some embodiments, the kit contains a container. Suitable containers can include, for example, vials, bags, syringes, and bottles. The container can be made of one or more materials, such as glass, metal, or plastic. In some embodiments, the container is used to hold the rAAV composition of the present disclosure. In some embodiments, the container can also hold fluids and / or other therapeutic agents.

[0332] In some embodiments, the kit comprises an additional therapeutic agent and an rAAV composition of the present disclosure. In some embodiments, the rAAV composition and the additional therapeutic agent may be mixed. In some embodiments, the rAAV composition and the additional therapeutic agent may be kept separate. In some embodiments, the rAAV composition and the additional therapeutic agent may be in the same container. In some embodiments, the rAAV composition and the additional therapeutic agent may be in different containers. In some embodiments, the rAAV composition and the additional therapeutic agent may be administered simultaneously. In some embodiments, the rAAV composition and the additional therapeutic agent may be administered on the same day. In some embodiments, the rAAV composition may be administered one, two, three, four, five, six, seven days, two weeks, three weeks, four weeks, two months, three months, four months, five months, or six months within the day of administering the additional therapeutic agent.

[0333] In some embodiments, the kit comprises a therapeutic agent that transiently suppresses the immune system prior to AAV administration. In some embodiments, the patient is transiently immunosuppressed shortly before and after injecting the virus to inhibit the T cell response to AAV particles (see, e.g., Ferreira et al., Hum. Gene Ther. 25:180 - 188, 2014). In some embodiments, the kit further provides cyclosporine, mycophenolate mofetil, and / or methylprednisolone.

[0334] The rAAV particles and / or compositions of the present invention may also be packaged into kits that include instructions for use. In some embodiments, the kit further includes a device for delivering (e.g., any type of parenteral administration described herein) the rAAV particle composition. In some embodiments, the instructions for use include instructions according to one of the methods described herein. In some embodiments, the instructions are printed on a label provided together with (e.g., attached to) the container. In some embodiments, the instructions for use include instructions for administering an effective amount of rAAV particles to an individual (e.g., a human), such as for treating PKU in an individual.

[0335] VIII. Exemplary Embodiments

[0336] Embodiment 1. A variant phenylalanine hydroxylase (PAH) polypeptide comprising two amino acid substitutions, wherein the amino acid substitutions are at positions selected from M180, K199, S250, and G256 of the wild - type human PAH polypeptide.

[0337] Embodiment 2. A variant phenylalanine hydroxylase (PAH) polypeptide comprising three amino acid substitutions, wherein the amino acid substitutions are at positions selected from M180, K199, S250, and G256 of the wild - type human PAH polypeptide.

[0338] Embodiment 3. A variant phenylalanine hydroxylase (PAH) polypeptide comprising four amino acid substitutions, said amino acid substitutions being at positions M180, K199, S250, and G256 of the wild-type human PAH polypeptide.

[0339] Embodiment 4. The variant PAH polypeptide of any one of Embodiments 1-3, wherein the amino acid substitutions comprise one or more of M180T, K199P, S250P, and G256A.

[0340] Embodiment 5. The variant PAH polypeptide of any one of Embodiments 1-4, wherein the amino acid substitutions comprise K199P, S250P, and G256A; M180T, S250P, and G256A; M180T, K199P, and G256A; or M180T, K199P, and S250P.

[0341] Embodiment 6. The variant PAH polypeptide of any one of Embodiments 1-5, wherein the amino acid substitutions comprise M180T, K199P, S250P, and G256A.

[0342] Embodiment 7. The variant PAH polypeptide of any one of Embodiments 1-6, wherein the variant PAH polypeptide further comprises H264P, G272A, G272P, P275L, P279Q, G272P, and P275L, or T323R and F327T amino acid substitutions.

[0343] Embodiment 8. The variant PAH polypeptide of any one of Embodiments 1-7, wherein the wild-type human PAH polypeptide comprises the amino acid sequence of SEQ ID NO:1.

[0344] Embodiment 9. The variant PAH polypeptide of any one of Embodiments 1-8, wherein the variant PAH polypeptide is a human PAH polypeptide.

[0345] Embodiment 10. The variant PAH polypeptide of any one of Embodiments 1-9, wherein the variant PAH polypeptide comprises an amino acid sequence that is at least about 80% identical to the amino acid sequence of SEQ ID NO:3.

[0346] Embodiment 11. The variant PAH polypeptide of any one of Embodiments 1-6, wherein the variant PAH polypeptide comprises the amino acid sequence of SEQ ID NO:3.

[0347] Embodiment 12. A variant PAH of any one of Embodiments 1-11, wherein the variant PAH polypeptide further comprises one or more amino acid substitutions selected from G33A, G46A, G46P, G103A, G139A, G139P, G148A, G188A, G218A, G239A, G247A, G257A, G272A, G289A, G307A, G312A, G332A, G337A, G344A, G352A, and G442A of the wild-type human PAH polypeptide.

[0348] Embodiment 13. A variant PAH of any one of Embodiments 1-12, wherein the variant PAH polypeptide further comprises one or more amino acid substitutions selected from P9G, G10V, G12S, K184R, K192R, S196A, Y206H, H220R, Q336E, E360D, I374C, N376E, N401T, I421V, I441V, S446H of the wild-type human PAH polypeptide, and an addition of S at position 453 of the wild-type human PAH polypeptide.

[0349] Embodiment 14. A variant PAH of any one of Embodiments 1-13, wherein the variant PAH polypeptide further comprises one or more amino acid substitutions selected from F240W, A246P, G247A, Y268W, C284F, T323R, F327Y, E319P, I306(Y,F), K113P, G188A, F191Y, T193R, Y206H, G337P, and N376P of the wild-type human PAH polypeptide.

[0350] Embodiment 15. A variant PAH polypeptide, wherein the variant PAH polypeptide comprises one or more amino acid substitutions selected from G33A, G46A, G46P, G103A, G139A, G139P, G148A, G188A, G218A, G239A, G247A, G257A, G272A, G289A, G307A, G312A, G332A, G337A, G344A, G352A, and G442A of the wild-type human PAH polypeptide.

[0351] Embodiment 16. A variant PAH polypeptide, wherein the variant PAH polypeptide comprises one or more amino acid substitutions selected from P9G, G10V, G12S, K184R, K192R, S196A, Y206H, H220R, Q336E, E360D, I374C, N376E, N401T, I421V, I441V, S446H of the wild-type human PAH polypeptide, and an addition of S at position 453 of the wild-type human PAH polypeptide.

[0352] Embodiment 17. A variant PAH polypeptide, wherein the variant PAH polypeptide comprises one or more amino acid substitutions selected from F240W, A246P, G247A, Y268W, C284F, T323R, F327Y, E319P, I306(Y,F), K113P, G188A, F191Y, T193R, Y206H, G337P, and N376P of the wild-type human PAH polypeptide.

[0353] Embodiment 18. The variant PAH polypeptide of any one of Embodiments 1-17, wherein the variant PAH polypeptide comprises an N-terminal truncation.

[0354] Embodiment 19. The variant PAH polypeptide of Embodiment 18, wherein the N-terminal truncation comprises truncation of the N-terminal regulatory domain.

[0355] Embodiment 20. The variant PAH polypeptide of Embodiment 18 or 19, wherein the N-terminal truncation comprises truncation of amino acid residues 1-102 of the wild-type PAH polypeptide.

[0356] Embodiment 21. The variant PAH polypeptide of any one of Embodiments 1-20, wherein the variant PAH polypeptide comprises a C-terminal truncation.

[0357] Embodiment 22. The variant PAH polypeptide of Embodiment 21, wherein the C-terminal truncation comprises truncation of the tetramerization domain.

[0358] Embodiment 23. The variant PAH polypeptide of Embodiment 21 or 22, wherein the C-terminal truncation comprises truncation of amino acid residues 429-452 of the wild-type PAH polypeptide.

[0359] Embodiment 24. The variant PAH polypeptide of any one of Embodiments 1-23, wherein the variant PAH polypeptide comprises an amino acid sequence corresponding to amino acid residues 103-428 of the wild-type PAH polypeptide.

[0360] Embodiment 25. The variant PAH polypeptide of any one of Embodiments 1-24, wherein the variant PAH polypeptide comprises one or more amino acid substitutions to eliminate potential protease cleavage sites.

[0361] Embodiment 26. The variant PAH polypeptide of Embodiment 25, wherein the one or more amino acid substitutions that eliminate potential protease cleavage sites are located at positions 270-295 and / or 380-405 of the wild-type PAH polypeptide.

[0362] Embodiment 27. The variant PAH polypeptide of any one of Embodiments 1-26, wherein the variant PAH polypeptide is fused to a liver-targeting polypeptide.

[0363] Embodiment 28. A variant PAH polypeptide of Embodiment 27, wherein the liver-targeting polypeptide is HGF or a fragment thereof or a glycoprotein that binds to the asialoglycoprotein receptor of hepatocytes.

[0364] Embodiment 29. A variant PAH polypeptide of any one of Embodiments 1-25, wherein the variant PAH polypeptide is pegylated and / or nitrosylated.

[0365] Embodiment 30. A variant PAH polypeptide of Embodiment 26, wherein the variant PAH polypeptide comprises an I374C amino acid substitution, and the cys residue at position 374 is nitrosylated.

[0366] Embodiment 31. A composition comprising a variant PAH polypeptide of any one of Embodiments 1-30.

[0367] Embodiment 32. The composition of Embodiment 31, wherein the composition further comprises a pharmaceutically acceptable carrier.

[0368] Embodiment 33. An isolated nucleic acid encoding a variant PAH polypeptide of any one of Embodiments 1-30.

[0369] Embodiment 34. The isolated nucleic acid of Embodiment 33, wherein the nucleic acid encoding the variant PAH polypeptide is operably linked to a promoter.

[0370] Embodiment 35. The isolated nucleic acid of Embodiment 34, wherein the promoter is selected from the cytomegalovirus (CMV) immediate-early promoter, RSV LTR, MoMLV LTR, phosphoglycerate kinase-1 (PGK) promoter, simian virus 40 (SV40) promoter, CK6 promoter, transthyretin promoter (TTR), mTTR482 promoter, mA1MB2-mTTR482 promoter, TK promoter, tetracycline-responsive promoter (TRE), HBV promoter, hAAT promoter, LSP promoter, LP1 promoter, chimeric liver-specific promoter (LSP), E2F promoter, telomerase (hTERT) promoter; cytomegalovirus enhancer / chicken β-actin / rabbit β-globin promoter (CAG) promoter, elongation factor 1-α promoter (EF1-α) promoter, human β-glucuronidase promoter, chicken β-actin (CBA) promoter, modified chicken β-actin (CBA) promoter or SEQ ID NO:17, Rous sarcoma virus (RSV) LTR promoter, dihydrofolate reductase promoter, and β-actin promoter.

[0371] Embodiment 36. The isolated nucleic acid of Embodiment 34 or 35, wherein the promoter is the LP1 promoter or the mA1MB2-mTTR482 promoter.

[0372] Embodiment 37. The isolated nucleic acid of any one of Embodiments 33-36, wherein the nucleic acid further comprises a polyadenylation signal.

[0373] Embodiment 38. The isolated nucleic acid of Embodiment 37, wherein the polyadenylation signal is a bovine growth hormone polyadenylation signal, an SV40 polyadenylation signal, or an HSV TK pA.

[0374] Embodiment 39. The isolated nucleic acid of any one of Embodiments 33-38, wherein the nucleic acid further comprises an intron.

[0375] Embodiment 40. The isolated nucleic acid of Embodiment 39, wherein the intron is a chicken β-actin (CBA) / rabbit β-globin hybrid intron.

[0376] Embodiment 41. The isolated nucleic acid of Embodiment 39, wherein the intron is a modified chicken β-actin (CBA) / rabbit β-globin hybrid intron of SEQ ID NO: 15.

[0377] Embodiment 42. The isolated nucleic acid of any one of Embodiments 33-41, wherein the nucleic acid further comprises one or more ITRs.

[0378] Embodiment 43. The isolated nucleic acid of any one of Embodiments 33-42, wherein the nucleic acid further comprises filler nucleic acid.

[0379] Embodiment 44. The isolated nucleic acid of Embodiment 43, wherein the filler nucleic acid is optimized to remove ATG sequences.

[0380] Embodiment 45. The isolated nucleic acid of Embodiment 44, wherein the filler nucleic acid is the A1AT intron filler sequence of SEQ ID NO: 16.

[0381] Embodiment 46. An isolated nucleic acid encoding a human PAH polypeptide, wherein the nucleic acid is codon-optimized.

[0382] Embodiment 47. The isolated nucleic acid of Embodiment 46, wherein the nucleic acid sequence is at least 80% identical to the nucleic acid sequence of SEQ ID NO: 14.

[0383] Embodiment 48. The isolated nucleic acid of Embodiment 46, wherein the nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 14.

[0384] Embodiment 49. The isolated nucleic acid of Embodiment 33, wherein the nucleic acid is mRNA.

[0385] Embodiment 50. A composition comprising the nucleic acid of any one of Embodiments 33-49.

[0386] Embodiment 51. The composition of Embodiment 50, wherein the composition further comprises a pharmaceutically acceptable carrier.

[0387] Embodiment 52. A carrier comprising the nucleic acid of any one of Embodiments 33-49.

[0388] Embodiment 53. The carrier of Embodiment 52, wherein the carrier is a recombinant adeno-associated virus (rAAV) carrier.

[0389] Embodiment 54. An rAAV carrier comprising the nucleic acid of any one of Embodiments 33-41 or 43-49, the nucleic acid being flanked by one or more AAV inverted terminal repeat (ITR) sequences.

[0390] Embodiment 55. The rAAV carrier of Embodiment 54, wherein the nucleic acid of any one of Embodiments 33-48 is flanked by two AAV ITRs.

[0391] Embodiment 56. The rAAV carrier of Embodiment 54 or 55, wherein the AAV ITR is an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV DJ, caprine AAV, bovine AAV or murine AAV serotype ITR.

[0392] Embodiment 57. The rAAV carrier of any one of Embodiments 54-56, wherein the AAV ITR is an AAV2 ITR.

[0393] Embodiment 58. The rAAV carrier of Embodiment 57, wherein the rAAV carrier comprises, from 5' to 3', an AAV2 ITR, a promoter, an intron, a nucleic acid encoding a PAH polypeptide, filler nucleic acid, a polyadenylation signal and an AAV2 ITR.

[0394] Embodiment 59. The rAAV carrier of Embodiment 58, wherein the promoter is the m1A1MB2-mTTR482 promoter or the LP1 promoter.

[0395] Embodiment 60. The rAAV carrier of Embodiment 58 or 59, wherein the intron is a chicken β-actin (CBA) / rabbit β-globin hybrid intron.

[0396] Embodiment 61. The rAAV carrier of any one of Embodiments 58-59, wherein the PAH polypeptide is a variant PAH polypeptide of any one of Embodiments 1-30.

[0397] Embodiment 62. The rAAV vector of any one of embodiments 58-60, wherein the nucleic acid encoding the PAH polypeptide is the codon-optimized nucleic acid of any one of embodiments 46-48.

[0398] Embodiment 63. The rAAV vector of any one of embodiments 58-62, wherein the filler nucleic acid comprises a nucleic acid from the intron of the human α1-antitrypsin gene.

[0399] Embodiment 64. The rAAV vector of embodiment 63, wherein the intron of the human α1-antitrypsin gene has been mutated to remove the ATG sequence.

[0400] Embodiment 65. The rAAV vector of any one of embodiments 58-64, wherein the polyadenylation signal is the bovine growth hormone polyadenylation signal.

[0401] Embodiment 66. The rAAV vector of any one of embodiments 53-65, wherein the vector is a self-complementary vector.

[0402] Embodiment 67. The rAAV vector of embodiment 66, wherein the vector comprises a first nucleic acid sequence encoding a PAH polypeptide and a second nucleic acid sequence encoding the complement of the PAH polypeptide, wherein the first nucleic acid sequence can form intra-strand base pairs with the second nucleic acid sequence along most or all of its length.

[0403] Embodiment 68. The rAAV vector of embodiment 67, wherein the first nucleic acid sequence and the second nucleic acid sequence are linked by a mutant AAV ITR, wherein the mutant AAV ITR comprises a deletion in the D region and a mutation in the terminal unwinding sequence.

[0404] Embodiment 69. An rAAV particle comprising the rAAV vector of any one of embodiments 53-68.

[0405] Embodiment 70. The rAAV particle of embodiment 69, wherein the AAV viral particle comprises an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV2 / 2-7m8, AAV DJ, AAV2 N587A, AAV2 E548A, AAV2 N708A, AAV2 V708K, caprine AAV, AAV1 / AAV2 chimera, bovine AAV, murine AAV or rAAV2 / HBoV1 serotype capsid.

[0406] Embodiment 71. The rAAV particle of Embodiment 69, wherein the AAV viral particle comprises an engineered AAV capsid.

[0407] Embodiment 72. The rAAV particle of Embodiment 71, wherein the engineered AAV capsid is a DJ capsid or an LK03 capsid.

[0408] Embodiment 73. The rAAV particle of Embodiment 69 or 70, wherein the ITR and capsid of the rAAV viral particle are derived from the same AAV serotype.

[0409] Embodiment 74. The rAAV particle of Embodiment 69 or 70, wherein the ITR and capsid of the rAAV viral particle are derived from different AAV serotypes.

[0410] Embodiment 75. The rAAV particle of any one of Embodiments 69-70 or 73-74, wherein the rAAV viral particle comprises an AAV8 capsid.

[0411] Embodiment 76. The rAAV particle of Embodiment 74, wherein the rAAV viral particle comprises an AAV8 capsid, and wherein the vector comprises AAV2 ITRs.

[0412] Embodiment 77. A composition comprising the rAAV particle of any one of Embodiments 69-76.

[0413] Embodiment 78. The composition of Embodiment 77, wherein the composition further comprises a pharmaceutically acceptable carrier.

[0414] Embodiment 79. A cell comprising the nucleic acid of any one of Embodiments 33-49 or the vector of Embodiment 52 or 53 or the rAAV vector of any one of Embodiments 54-68.

[0415] Embodiment 80. A method for producing a variant PAH polypeptide, the method comprising culturing the cell of Embodiment 79 under conditions for producing a variant PAH polypeptide.

[0416] Embodiment 81. The method of Embodiment 80, further comprising the step of purifying the variant PAH polypeptide.

[0417] Embodiment 82. A method for treating phenylketonuria in an individual in need thereof, the method comprising administering to the individual the variant PAH polypeptide of any one of Embodiments 1-30 or the composition of Embodiments 31 or 32.

[0418] Embodiment 83. A method for treating phenylketonuria in an individual in need thereof, the method comprising administering to the individual the nucleic acid encoding the variant PAH polypeptide of any one of Embodiments 1-30 or the nucleic acid of Embodiments 33, 34 or 49.

[0419] Embodiment 84. A method for treating phenylketonuria in an individual in need thereof, comprising administering to the individual an rAAV vector of any one of Embodiments 53-68.

[0420] Embodiment 85. A method for treating phenylketonuria in an individual in need thereof, comprising administering to the individual an rAAV particle of any one of Embodiments 69-76.

[0421] Embodiment 86. A method for treating phenylketonuria in an individual in need thereof, comprising administering to the individual a composition of Embodiment 31, 32, 50, 51, 77 or 78.

[0422] Embodiment 87. A method for treating phenylketonuria in an individual in need thereof, comprising administering to the individual a cell of Embodiment 79.

[0423] Embodiment 88. The method of any one of Embodiments 82-87, wherein the individual lacks PAH activity.

[0424] Embodiment 89. A method for reducing the level of phenylalanine in the blood of an individual in need thereof, comprising administering to the individual a variant PAH polypeptide of any one of Embodiments 1-30 or a composition of Embodiment 31 or 32.

[0425] Embodiment 90. A method for reducing the level of phenylalanine in the blood of an individual in need thereof, comprising administering to the individual a nucleic acid encoding a variant PAH polypeptide of any one of Embodiments 1-30 or a nucleic acid of Embodiment 33, 34 or 49.

[0426] Embodiment 91. A method for reducing the level of phenylalanine in the blood of an individual in need thereof, comprising administering to the individual an rAAV vector of any one of Embodiments 53-68.

[0427] Embodiment 92. A method for reducing the level of phenylalanine in the blood of an individual in need thereof, comprising administering to the individual an rAAV particle of any one of Embodiments 69-76.

[0428] Embodiment 93. A method for reducing the level of phenylalanine in the blood of an individual in need thereof, comprising administering to the individual a composition of Embodiment 31, 32, 50, 51, 77 or 78.

[0429] Embodiment 94. A method for reducing the level of phenylalanine in the blood of an individual in need thereof, comprising administering to the individual a cell of Embodiment 79.

[0430] Embodiment 95. The method of any one of embodiments 89-94, wherein the phenylalanine level in the blood of the individual before treatment is elevated compared to the phenylalanine level in the blood of an equivalently matched control individual.

[0431] Embodiment 96. The method of any one of embodiments 82-95, wherein the variant PAH polypeptide, nucleic acid, rAAV vector, rAAV particle, composition or cell is administered intravenously, intraarterially, intrahepatically, intraportally, intraperitoneally or subcutaneously.

[0432] Embodiment 97. The method of any one of embodiments 82-96, wherein the administration is in combination with another therapy.

[0433] Embodiment 98. The method of embodiment 97, wherein the other therapy is treatment with tetrahydrobiopterin, treatment with phenylalanine ammonia-lyase (PAL) or polyethylene glycolated PAL, or a phenylalanine-restricted diet.

[0434] Embodiment 99. A method for preparing a PAH polypeptide, which comprises culturing the cells of embodiment 79 under conditions for producing the PAH polypeptide.

[0435] Embodiment 100. The method of embodiment 99, which further comprises purifying the PAH polypeptide.

[0436] Embodiment 101. A kit, which comprises a variant PAH polypeptide of any one of embodiments 1-24.

[0437] Embodiment 102. A kit, which comprises a nucleic acid of any one of embodiments 33-46, an rAAV vector of any one of embodiments 53-68, an rAAV particle of any one of embodiments 69-76 or a composition of embodiment 77 or 78.

[0438] Embodiment 103. The kit of embodiment 101 or 102, wherein the kit further comprises instructions for use; a buffer and / or a pharmaceutically acceptable excipient; and / or a bottle, vial and / or syringe.

[0439] Embodiment 104. An expression cassette for expressing a transgene in hepatocytes, wherein the expression cassette comprises a transgene operably linked to a promoter and an enhancer, wherein the promoter comprises a mouse transthyretin (mTTR) promoter, and the enhancer comprises one or two modified prothrombin enhancers (pPrT2), one or two modified α1-microbikunin enhancers (mA1MB2), a modified mouse albumin enhancer (mEalb), a hepatitis B virus enhancer II (HEII) or a CRM8 enhancer.

[0440] Embodiment 105. The expression cassette of Embodiment 104, wherein the mTTR promoter is the mTTR482 promoter.

[0441] Embodiment 106. The expression cassette of Embodiment 104 or 105, wherein the enhancer is on the 5' side of the mTTR promoter.

[0442] Embodiment 107. An expression cassette for expressing a transgene in hepatocytes, wherein the expression cassette comprises a transgene operably linked to a promoter and a 3' element, wherein the promoter comprises a murine thyroxine-binding globulin (mTTR) promoter, and the 3' element is an albumin 3' element (3'Alb) or an albumin 3' element linked to a human α1-antitrypsin scaffold / matrix attachment region (SMAR) (3'AlbSMAR).

[0443] Embodiment 108. The expression cassette of Embodiment 107, wherein the mTTR promoter is the mTTR482 promoter.

[0444] Embodiment 109. The expression cassette of Embodiment 107 or 108, wherein the 3' element is on the 3' side of the transgene.

[0445] Embodiment 110. An expression cassette for expressing a transgene in hepatocytes, wherein the expression cassette comprises a transgene operably linked to a promoter, an enhancer, and a 3' element, wherein the promoter comprises a murine thyroxine-binding globulin (mTTR) promoter, and the enhancer comprises one or two modified prothrombin enhancers (pPrT2), one or two modified α1-micro bikunin enhancers (mA1MB2), a modified murine albumin enhancer (mEalb), a hepatitis B virus enhancer II (HEII), or a CRM8 enhancer, and wherein the 3' element is an albumin 3' element (3'Alb) or an albumin 3' element linked to a human α1-antitrypsin scaffold / matrix attachment region (SMAR) (3'AlbSMAR).

[0446] Embodiment 111. The expression cassette of Embodiment 110, wherein the mTTR promoter is the mTTR482 promoter.

[0447] Embodiment 112. The expression cassette of Embodiment 110 or 111, wherein the enhancer is on the 5' side of the mTTR promoter.

[0448] Embodiment 113. The expression cassette of any one of Embodiments 110-112, wherein the 3' element is on the 3' side of the transgene.

[0449] Embodiment 114. The expression cassette of any one of embodiments 104-113, wherein the expression cassette further comprises an intron.

[0450] Embodiment 115. The expression cassette of embodiment 114, wherein the intron is a chicken β-actin / rabbit β-globin hybrid intron.

[0451] Embodiment 116. The expression cassette of any one of embodiments 104-115, wherein the expression cassette further comprises a polyadenylation signal.

[0452] Embodiment 117. The expression cassette of embodiment 116, wherein the polyadenylation signal is a bovine growth hormone polyadenylation signal.

[0453] Embodiment 118. The expression cassette of any one of embodiments 104-117, wherein the transgene encodes a PAH polypeptide or a variant PAH polypeptide.

[0454] Embodiment 119. The expression cassette of embodiment 118, wherein the variant PAH polypeptide is a variant PAH polypeptide of any one of embodiments 1-30.

[0455] Embodiment 120. A vector comprising the expression cassette of any one of embodiments 104-119.

[0456] Embodiment 121. The vector of embodiment 120, wherein the vector is a recombinant adeno-associated virus (rAAV) vector.

[0457] Embodiment 122. An rAAV vector comprising the expression cassette of any one of embodiments 104-119, the expression cassette being flanked by one or more AAV inverted terminal repeat (ITR) sequences.

[0458] Embodiment 123. The rAAV vector of embodiment 122, wherein the expression cassette of any one of embodiments 104-118 is flanked by two AAV ITRs.

[0459] Embodiment 124. The rAAV vector of embodiment 122 or 123, wherein the AAV ITR is an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV DJ, caprine AAV, bovine AAV or murine AAV serotype ITR.

[0460] Embodiment 125. The rAAV vector of any one of embodiments 122-124, wherein the AAV ITR is an AAV2 ITR.

[0461] Embodiment 126. The rAAV vector of any one of Embodiments 122-125, wherein the vector is a self-complementary vector.

[0462] Embodiment 127. The rAAV vector of Embodiment 126, wherein the vector comprises a first nucleic acid sequence encoding a PAH polypeptide and a second nucleic acid sequence encoding the complement of the PAH polypeptide, wherein the first nucleic acid sequence can form intrastrand base pairs with the second nucleic acid sequence along most or all of its length.

[0463] Embodiment 128. The rAAV vector of Embodiment 127, wherein the first nucleic acid sequence and the second nucleic acid sequence are linked by a mutant AAV ITR, wherein the mutant AAV ITR comprises a deletion in the D region and a mutation in the terminal unwinding sequence.

[0464] Embodiment 129. An rAAV particle comprising the rAAV vector of any one of Embodiments 122-127.

[0465] Embodiment 130. The rAAV particle of Embodiment 129, wherein the AAV viral particle comprises an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV2 / 2-7m8, AAV DJ, AAV2 N587A, AAV2 E548A, AAV2 N708A, AAV2V708K, caprine AAV, AAV1 / AAV2 chimeric, bovine AAV, murine AAV, or rAAV2 / HBoV1 serotype capsid.

[0466] Embodiment 131. The rAAV particle of Embodiment 130, wherein the AAV viral particle comprises an engineered AAV capsid.

[0467] Embodiment 132. The rAAV particle of Embodiment 131, wherein the engineered AAV capsid is a DJ capsid or an LK03 capsid.

[0468] Embodiment 133. The rAAV particle of Embodiment 131 or 132, wherein the ITR and capsid of the rAAV viral particle are derived from the same AAV serotype.

[0469] Embodiment 134. The rAAV particle of Embodiment 131 or 132, wherein the ITR and capsid of the rAAV viral particle are derived from different AAV serotypes.

[0470] Embodiment 135. A composition comprising the rAAV particles of any one of Embodiments 129-134.

[0471] Embodiment 136. The composition of Embodiment 135, wherein the composition further comprises a pharmaceutically acceptable carrier.

[0472] Embodiment 137. A cell comprising the expression cassette of any one of Embodiments 104-119 or the vector of any one of Embodiments 120-128.

[0473] Embodiment 138. A method for treating phenylketonuria in an individual in need thereof, comprising administering to the individual the expression cassette of any one of Embodiments 104-119.

[0474] Embodiment 139. A method for treating phenylketonuria in an individual in need thereof, comprising administering to the individual the rAAV vector of any one of Embodiments 122-128.

[0475] Embodiment 140. A method for treating phenylketonuria in an individual in need thereof, comprising administering to the individual the rAAV particles of any one of Embodiments 129-134.

[0476] Embodiment 141. A method for treating phenylketonuria in an individual in need thereof, comprising administering to the individual the composition of Embodiment 135 or 136.

[0477] Embodiment 142. A method for treating phenylketonuria in an individual in need thereof, comprising administering to the individual the cell of Embodiment 137.

[0478] Embodiment 143. The method of any one of Embodiments 138-142, wherein the individual lacks PAH activity.

[0479] Embodiment 144. A method for reducing the level of phenylalanine in the blood of an individual in need thereof, comprising administering to the individual the expression cassette of any one of Embodiments 104-119.

[0480] Embodiment 145. A method for reducing the level of phenylalanine in the blood of an individual in need thereof, comprising administering to the individual the rAAV vector of any one of Embodiments 122-128.

[0481] Embodiment 146. A method for reducing the level of phenylalanine in the blood of an individual in need thereof, comprising administering to the individual the rAAV particles of any one of Embodiments 129-134.

[0482] Embodiment 147. A method for reducing the level of phenylalanine in the blood of an individual in need thereof, comprising administering to the individual the composition of Embodiment 135 or 136.

[0483] Embodiment 148. A method for reducing the level of phenylalanine in the blood of an individual in need thereof, comprising administering to the individual the cells of Embodiment 137.

[0484] Embodiment 149. The method of any one of Embodiments 144 - 148, wherein the level of phenylalanine in the blood of the individual before treatment is elevated compared to the level of phenylalanine in the blood of an equivalently matched control individual.

[0485] Embodiment 150. The method of any one of Embodiments 138 - 149, wherein the nucleic acid, rAAV vector, rAAV particle, composition or cell is administered intravenously, intraarterially, intrahepatically, intraportally, intraperitoneally or subcutaneously.

[0486] Embodiment 151. The method of any one of Embodiments 138 - 150, wherein the administration is in combination with another therapy.

[0487] Embodiment 152. The method of Embodiment 151, wherein the other therapy is treatment with tetrahydrobiopterin, treatment with phenylalanine ammonia-lyase (PAL) or polyethylene glycolated PAL, or a phenylalanine-restricted diet.

[0488] Embodiment 153. A kit comprising the expression cassette of any one of Embodiments 104 - 119, the rAAV vector of any one of Embodiments 122 - 128, the rAAV particle of any one of Embodiments 129 - 134, or the composition of Embodiment 135 or 136.

[0489] Embodiment 154. The kit of Embodiment 153, wherein the kit further comprises instructions for use; a buffer and / or a pharmaceutically acceptable excipient; and / or a bottle, vial and / or syringe.

[0490] Examples

[0491] The present invention will be more fully understood by reference to the following examples. However, they should not be construed as limiting the scope of the invention. It should be understood that the examples and embodiments described herein are for illustrative purposes only, and various modifications or changes made in accordance with them will be known to those skilled in the art and should be included within the spirit and scope of the present application and the scope of the appended embodiments.

[0492] Example 1. Generation of a liver-specific expression cassette

[0493] The following studies were conducted to develop a strong expression construct for expressing a transgene in the liver of an individual.

[0494] Materials and Methods for Examples 1 - 3

[0495] Construction of the PAH expression cassette and rAAV vector

[0496] To increase the strength of the liver promoter, the plasmid mTTR482-HI-hFVIII-BGHpA containing the mouse transthyretin (mTTR) promoter, the endogenous mTTR enhancer, and the bovine growth hormone (BGH) polyadenylation (pA) site was used for additional modification (Kyostio-Moore 2016, Nambiar 2017). In this plasmid, the FVIII cDNA was replaced with the cDNA encoding secreted embryonic alkaline phosphatase (SEAP), and the existing intron was replaced with a 1069-bp chicken β-actin (CBA) / rabbit β-globin hybrid intron. Various liver enhancer sequences were cloned upstream of the mTTR482 enhancer. These included the modified prothrombin enhancer (mPrT2, two copies), the modified α1-microbikunin (mA1MB2, two copies) (McEachern 2006, Jacobs 2008), the modified mouse albumin enhancer (mEalb) (Kramer 2003), the hepatitis B virus enhancer II (E11) (Kramer 2003), and CRM8 (Chuah 2014). Additionally, two 3' elements, namely albumin (Alb 3') (Wooddell 2008) and albumin plus the A1AT1 SMAR element (AF156542) (Alb3' / SMAR) ( Figure 1A ) were tested and cloned downstream of the BGH pA. Modifications in some of the enhancers consisted of changing the hepatocyte nuclear factor (HNF) 3 and 4 binding sites to higher-affinity sequences, similar to the modifications previously performed on mTTR482 (Nambiar 2017; Supplement 1).

[0497] To generate human or murine PAH plasmid expression cassettes, the corresponding cDNA encoding full-length PAH (amino acids 1 - 452) was cloned into three expression plasmids. These plasmids contain liver-specific (LP1; Nathwani 2011), A1MB2-mTTR482 or CBA promoters, a hybrid intron, and pA sequences (BGH or simian virus 40 [SV40] pA) (Nathwani 2011, Kyostio-Moore 2016). All expression plasmids contain flanking AAV2 ITRs. mTTR482 (Nambiar 2017) was used as the backbone to evaluate various cDNAs encoding hPAH. Four codon-optimized cDNAs were generated by DNA2.0, GeneArt (GA), or Genscript (GS) and the GS algorithm incorporating reduced CpG content. In each expression plasmid, the PAH protein was tagged with an N-terminal 22-amino acid 3xFLAG peptide (MDYKDHDGDYKDHDIDYKDDDDK (SEQ ID NO:18)) for detection and quantification purposes.

[0498] The selected plasmid containing AAV2 ITRs, a liver promoter, a hybrid intron, PAH cDNA, and BGH pA was used for the production of rAAV vectors. Using the triple transfection method, followed by CsCl2 purification (Univ. Massachusetts Gene Therapy Core), rAAV vectors with an AAV8 serotype capsid were generated. Vector batches were quantified by qPCR targeting BGH pA (Nambiar 2017).

[0499] In vitro cell cultures

[0500] All tissue culture reagents were obtained from Irvine Scientific (Santa Ana, California) or Invitrogen. For transient transfection, human 293 or human hepatoma cells (Huh7 or HepG2) (8 × 10 5 cells / well) were plated on Dulbecco's Modified Eagle Medium (DMEM) in 6-well culture dishes, which had high glucose, 10% fetal bovine serum (FBS), and 10 ml / L Pen Strep (10 units / ml penicillin and 10 μg / ml streptomycin). The plasmid (2 μg) was transfected with Lipofectamine 2000 (Invitrogen). After 48 or 72 hours, cell lysates or media were harvested for PAH analysis or SEAP activity, respectively.

[0501] Quantification of SEAP activity

[0502] Collect conditioned medium or serum and heat the samples at 65 °C for 30 minutes to inactivate endogenous alkaline phosphatase. Measure SEAP activity using alkaline phosphatase (ALP)-SL reagent (Sekisui Diagnostics), incubate the samples for 10 minutes to 2 hours, and then read the absorbance at 405 nm. Use human alkaline phosphatase HPAP as a standard (Calbiochem). Express SEAP activity as μg / ml by dividing the sample value by the conversion factor 0.103 mU / ng.

[0503] Quantification of PAH protein and activity

[0504] After 48 hours, generate whole cell lysates by lysing the cells in lysis buffer or RIPA buffer. Additionally, in some experiments, sonication or shearing is used to enhance cell lysis. After thawing, spin the lysates at 14,000 g for 30 minutes prior to the assay. Quantify the level of FLAG fusion protein by FLAG ELISA (SE002-flag; ABSbio) according to the manufacturer's instructions and using the kit standard or internally purified 3xFLAG-mPAH-FL as a protein standard. Normalize in vivo samples by the total protein content measured by the BCA protein assay kit (Pierce). The enzymatic activity of PAH protein was measured as previously described by Yew et al. 2013 with some minor modifications. Perform western blotting for PAH detection using the standard protocol with anti-hPAH antibody (LS-C344145; LSBio) or anti-FLAG antibody (F1804; Sigma).

[0505] In vivo studies

[0506] A colony of BTBR-PAH enu2 / J mice (McDonald 1996) was raised at Taconic. Homozygous (HOM) and heterozygous (HET) male mice were obtained at 8 - 12 weeks of age and were housed and maintained according to the humane guidelines for animal care and use. For SEAP expression plasmid analysis, administer the plasmid (10 μg / mouse) in sterile saline by hydrodynamic tail vein injection to C57BL / 6 mice, with a minimum of n = 8 per test article. Administer recombinant AAV8 vectors via the intravenous route through the tail vein (6 - 10 animals / treatment). In most studies, the animals were sacrificed by isoflurane anesthesia 8 - 10 weeks later. Collect whole blood into EDTA collection tubes via the retro-orbital sinus, spin, and freeze for storage until analysis. Perfuse some animals with PBS via the left ventricle prior to tissue collection. Collect liver samples and freeze until analysis. For brain analysis, harvest the whole brain from the skull, weigh, cut sagittally, and freeze at -80 °C until analysis.

[0507] Blood and tissue analysis

[0508] Plasma Phe and Tyr levels were analyzed by UHPLC-MS / MS using a Transcend II LX4 multiplex system equipped with a Dionex Ultimate 3000 HPLC (Thermo Fisher, Waltham, MA, USA) coupled to an API 4000 triple quadrupole mass spectrometer (AB SCIEX, Framingham, MA, USA). Standard solutions were prepared using L-Phe and L-Tyr (Sigma-Aldrich, St. Louis, MO, USA), and labeled L-Phe-13C9,15N and labeled L-Tyr-13C9,15N (Sigma-Aldrich) were used as internal standards. MS / MS detection was performed in positive ion mode. The analysis was carried out using an Acquity BEH C18 column (1.7 μm, 2.1 × 30 mm) with gradient separation, which consisted of holding at 98% mobile phase A (0.1% formic acid in water) for 10 s, followed by holding at a gradient of 2%-45% mobile phase B (0.1% formic acid in acetonitrile) for 30 s, increasing to 75% B and holding for 15 s, washing at 75% B for 10 s, and re-equilibrating at 98% A for 1 min, with a flow rate of 0.5 mL / min. MS / MS transitions were: 166.1 / 120.1 for Phe, 182.1 / 136.1 for Tyr, 176.1 / 129.1 for labeled Phe, and 192.1 / 145.1 for labeled Tyr.

[0509] For the quantification of brain neurotransmitters, the brain was processed as described with slight modifications (Kankaanpaa 2001). Briefly, half of a sagittally cut, PBS-perfused brain was homogenized for 20 s at 4 °C at 4.85 m / s in ice-cold lysis buffer (1 mM oxalic acid, 3 mM cysteine, 0.1 M acetic acid) using a Bead Ruptor 24 (Omni). The samples were spun at 14K for 10 min and the supernatant was then frozen. Then, levodopa, dopamine, homovanillic acid (HVA), serotonin, 5-hydroxytryptophan (5-HTP), 5-hydroxyindoleacetic acid (5-HIAA), and norepinephrine levels in brain homogenates (200 mg / mL) were quantified by UPLC-MS / MS using an Acquity UPLC (Waters Corporation, Milford, MA, USA) coupled to an API 5000 triple quadrupole mass spectrometer (AB SCIEX, Framingham, MA, USA). To improve neurotransmitter stability, 0.1% formic acid (FA) and 300 ng / mL cysteine in acetonitrile were used as sample dilution buffer. Standards and standard solutions of each analyte (Sigma-Aldrich) were prepared similar to the samples described above. MS / MS detection was performed in positive ion mode (HVA was detected in negative ion mode). The analysis was performed using Acquity HSS C18 SB (1.7 μm, 2.1 x 100 mm) with gradient separation, which consisted of holding at 98% mobile phase A (0.1% FA in water) for 0.5 min, followed by a gradient of 2%-40% mobile phase B (0.1% FA in acetonitrile) for 3.5 min, increasing to 95% B and holding for 0.1 min, washing at 95% B for 0.5 min, and re-equilibrating at 98% A for 2.4 min at a flow rate of 0.5 mL / min. Positive ion MS / MS transitions were: 198 / 152 for levodopa, 177 / 160.1 for serotonin, 154 / 137.1 for dopamine, 192 / 146 for 5-HIAA, 170.1 / 107 for norepinephrine, and 221.1 / 201 for 5-HTP. HVA detection was performed in negative ion mode similar to the above method except for omitting the initial hold phase of the gradient. The MS / MS transition for HVA in negative ion mode was 181.1 / 137.1. The levels were expressed as μg / mL homogenate or μM. Brain Phe and Tyr levels were quantified as described in the previous section.

[0510] For liver samples, quantify vector genome, PAH activity, and protein levels. Quantify the copy number of the vector genome by qPCR (Martin 2013). Quantify the FLAG-tagged protein as follows. In a homogenizer (Bead Ruptor 24; Omni), homogenize liver samples in tubes with beads (15-340-153; Fisher Scientific) in 1× PBS or RIPA buffer containing 1× protease inhibitor at 5.65 rpm for 20 - 30 seconds at 4 °C. Spin the samples at 14,000 g for 30 minutes at 4 °C. Then use the supernatant for PAH quantification by FLAG ELISA and normalize by total protein (BCA Protein Assay Kit; Pierce). Perform PAH protein activity in liver homogenates as described above.

[0511] Results

[0512] The liver mTTR482 promoter has been previously described and contains the mouse thyroxine-binding globulin core promoter and its 5' enhancer elements (with modifications in the HNF-3 and HNF-4 binding sites) (Nambiar 2016). The goal of this study was to further increase promoter strength. Add various liver-based enhancers upstream of this promoter or 3' stability elements downstream of BGH pA to the expression cassette and then measure the secreted alkaline phosphatase (SEAP) levels in vitro as a reporter in two human liver lines ( Figure 1A ). Transient transfection of the SEAP plasmid into Huh7 and HepG2 cells showed that the expression cassette with the mA1MB2 enhancer (number 3) produced the highest SEAP levels in the medium and was approximately 2-fold higher than the parental mTTR482 construct in both cell lines ( Figure 1B 、 Figure 1C ). In vivo evaluation of the proviral plasmid by hydrodynamic injection in normal C57BL / 6 mice also showed the highest and most persistent SEAP expression for the plasmid containing the mA1MB2 enhancer. At days 1, 7, 14, and 28, the SEAP levels were 2.8, 4.4, 4, and 3.6-fold higher, respectively, than the levels detected in animals treated with the parental mTTR482-SEAP plasmid ( Figure 2A ). Evaluate the mTTR482 proviral plasmid with and without the mA1MB2 enhancer in PAH enu2 mice ( Figure 2B)。Plasmids containing the mA1MB2 enhancer consistently produced plasma SEAP levels that were 2-fold higher than the levels obtained with the parental mTTR482 construct. Although SEAP was stably secreted throughout the 28-day study, the SEAP levels in PKU mice were approximately 10-fold lower than the levels obtained with these plasmids in C57Bl / 6 mice. Based on this data, the mA1MB2-mTTR482 promoter was selected as a candidate liver promoter.

[0513] Example 2. PAH enu2 Comparison of optimized liver promoters with the LP1 promoter in mice

[0514] To validate our optimized liver promoter in a PKU disease model, an AAV8 / mA1MB2-mPAH vector was generated and compared with AAV8 / scLP1-mPAH, which can be compared with the vector used by Yagi et al. (2011). Both vectors were administered intravenously at two different doses (4e10 and 1e11, VG / mouse), and blood Phe levels were measured. At both doses, the mA1MB2-mTTR482 vector was more effective than the sc-LP1 vector in reducing blood Phe levels ( Figure 3A 、 Figure 3B ). Administration of both vectors at the higher dose (1e11 vg / mouse) increased blood Tyr levels; an increase was detected on day 7 (measured after the first administration) and remained elevated until day 56 (end of the study) ( Figure 3C ). Although an increase in blood Tyr was also detected in animals treated at the lower dose, the increase was not significantly different from the pre-treatment values of the corresponding animals. Quantification of viral vector genomes in the liver showed that the VG copies of the self-complementary vector increased 2- to 3-fold on day 56 ( Figure 3D ).

[0515] Because brain Phe levels are the main cause of pathology, Phe levels in the brain were measured. At the 1e11 dose, only the mA1MB2-mTTR482 construct provided low brain Phe levels similar to those of wild-type brain (HET) ( Figure 4A ). The decrease in brain Phe levels was closely correlated with the Phe levels measured in the blood ( Figure 4B ). Analysis of brain neurotransmitter levels showed that the increase in dopamine was comparable for both constructs ( Figure 4C ). Similar efficacy was also observed for the mA1MB2-mTTR482 construct at the lower (4e10) dose. Brain serotonin quantification showed that treatment with the mA1MB2-mTTR482 construct produced significantly more serotonin than treatment with the sc-LP1 vector ( Figure 4D)。In summary, the effective reduction of blood Phe levels with the mA1MB2-mTTR482 construct translated into a robust reduction of brain Phe levels and subsequent enhancement of dopamine and serotonin synthesis in the brains of treated animals.

[0516] Example 3. Evaluation of hPAH production by codon-optimized hPAH cDNA

[0517] Previously published studies have shown that in PAH enu2 mice, rAAV vectors encoding hPAH have poor efficacy. To test whether better-produced hPAH could achieve enhanced efficacy, the effects of various codon usages were tested. For this purpose, four different codon-optimized cDNAs of hPAH were generated based on different algorithms. The sequences obtained were cloned downstream of the mTTR482 promoter, and hPAH protein levels were evaluated in vitro and in vivo. Plasmid transfection into human Huh7 cells showed little difference between hPAH cDNAs (all within 2-fold) ( Figure 5A ). When the expression plasmids were delivered into the livers of normal C57BL / 6 mice via hydrodynamic injection, much greater differences were observed between the constructs ( Figure 5B ). Specifically, compared with the plasmid with the endogenous, unmodified (non) sequence, the expression plasmid with the hPAH cDNA generated by the GA algorithm resulted in a 7-fold higher detection of FLAG-tagged protein in liver lysates. Based on this, the human cDNA generated by the GA algorithm was used for subsequent studies.

[0518] Example 4: In vitro and in vivo comparison of human PAH and mouse PAH

[0519] Methods

[0520] Plasmid vector and recombinant AAV production.

[0521] The generation of liver-specific promoters (LP1 and mTTR482), heterologous introns, polyadenylation sites (bovine growth hormone [BGH] and simian virus 40 [SV40]) is known in the art and has been described in Nathwani (2012) and Nambiar (2017). Various plasmid vectors were constructed with liver-specific or chicken b-actin (CBA) promoters, heterologous introns, cDNAs encoding full-length (FL) human (h) or mouse (m) PAH and BGH polyA. Expression cassettes with double-truncated forms (DT; amino acids 103-428) of mPAH and hPAH or with various heterologous constructs were also generated. The amino acid modifications in hPAH-DT and mPAH were evaluated in plasmid vectors with CBA promoter, heterologous intron, PAH-DT, and BGH polyA. Amino acid changes in PAH-DT amino acid sequence variants (V) were generated by synthesizing altered DNA sequences or by introducing changes via site-directed mutagenesis (Genscript). For detection and quantification purposes, most constructs contained a sequence encoding an N-terminal 22-amino acid 3xFLAG-peptide (MDYKDHDG DYKDHDI DYKDDDDK (SEQ ID NO:18)) upstream of the PAH cDNA.

[0522] The selected PAH plasmid vectors with liver-specific promoters (LP1 or mA1MB2-mTTR482), 1069 bp chicken β-actin (CBA) / rabbit β-globin hybrid intron, hPAH cDNA (or variant) cDNA, and BGHpA were subcloned into a plasmid containing AAV2 ITRs. The final hPAH-V1 vector construct additionally contained a modified intron with the ATG removed and a 0.9 kb "filler" sequence from the α1-antitrypsin intron (reducing the ATG) to increase the vector genome size to 4.6 kb. All rAAV vectors were produced using the triple transfection method with AAV8 serotype capsid, followed by CsCl2 purification. The vector batches were quantified by qPCR targeting BGHpA (Martin 2013).

[0523] Purification of PAH protein.

[0524] According to the manufacturer's instructions, transient transfection of Expi293F cells (Life Technologies) was performed using the Expi293F expression system kit (Life Technologies) in a serum-free suspension culture environment. The pCBA-PAH-BGHpA expression plasmids encoding hPAH, hPAH-V1, and mPAH with 3xFLAG tag in FL or DT form were used for transfection. The cells were pelleted by spinning and whole cell lysates were generated in lysis buffer (50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1 mM EDTA, and 1% Triton X-100). Flag-tagged PAH proteins were purified using a FLAG affinity column (ANTI-FLAG M2 affinity gel; Sigma-Aldrich). Proteins were eluted using 0.1 M glycine-HCl (pH 3.5) or 100 μg / ml FLAG peptide (Sigma-Aldrich) in TBS. The proteins were resuspended in 50 mM Tris-HCl (pH 7.4), 150 mM NaCl (some batches additionally contained 10% mannitol for increased stability, Nascimento 2010). Proteins were analyzed on a SDS-PAGE 4%-12% Tris-BIS-MES gel and stained by Coomassie blue staining. Proteins were also analyzed by Western blotting using antibodies against FLAG peptide or PAH protein.

[0525] Quantification of PAH protein and activity levels.

[0526] HEK293T cells were transiently transfected with plasmids containing FLAG-tagged PAH expression cassette using Lipofectamine 2000 (Life Technologies). After 48 hours, whole cell lysates were generated by lysing the cells in lysis buffer or RIPA buffer (Pierce / ThermoFisher). Additionally, in some experiments, sonication or shearing was used to enhance cell lysis. After thawing, the lysates were spun at 14,000 g for 30 minutes before the assay. According to the manufacturer's instructions and using kit standards or internally purified 3xFLAG-mPAH-FL as protein standards, quantification of FLAG fusion protein levels was measured by FLAG ELISA (SE002-flag; ABSbio). The enzyme activity of PAH protein was measured as previously described (Yew 2013) with some minor modifications. Western blotting for PAH detection was performed using anti-hPAH antibody (LSBio) or anti-FLAG antibody (Sigma) using standard protocols known in the art.

[0527] Results

[0528] The production of human and mouse PAH proteins in Huh7 and 293 cells was evaluated in vitro. To quantify the production of hPAH and mPAH, all expressed proteins contained an N-terminal 3xFLAG tag. Data showed that the level of hPAH was lower in whole Huh7 cell lysates compared to mPAH and was independent of the expression cassette used ( Figure 6A ). Compared to mPAH, the full-length (F1, 1-452) and double-truncated (DT) forms of hPAH showed lower production of hPAH ( Figure 6B , Figure 6C ). The DT form is a shortened and constitutively active form of PAH composed of amino acids 103 to 428 and thus lacks the N-terminal regulatory domain and the C-terminal tetramerization domain of PAH.

[0529] mRNA quantification of each construct showed comparable levels of message, indicating that the difference in hPAH and mPAH protein levels is a post-transcriptional effect ( Figure 6D ). When hPAH and mPAH (FL and DT forms) were purified using a FLAG affinity column, human PAH (both FL and DT forms) showed a very different degradation pattern not observed for mouse PAH ( Figure 6E ).

[0530] In PAH enu2 mice, rAAV8 / sc-LP1 vectors encoding human and mPAH were tested. Animals treated with the vector encoding mPAH showed normal blood Phe levels, while in mice treated with a comparable dose of the hPAH vector, little reduction in blood Phe levels was observed ( Figure 6F ). The efficacy of the sc-LP1 vector encoding mPAH had been previously demonstrated (Yagi 2011).

[0531] Collectively, this data indicates that the endogenous form of hPAH is less efficient than mPAH and that this is associated with poor production / stability of hPAH protein observed in vitro.

[0532] Example 5: Generation of modified variants of human PAH

[0533] Hybrid hPAH constructs containing different lengths of N-terminal or C-terminal sequences derived from mPAH were generated ( Figure 7A ). The in vitro production of the FLAG-tagged proteins of these constructs was tested and showed that replacing either the N-terminal or C-terminal of hPAH with the corresponding mouse sequence did not increase protein levels ( Figure 7B , Figure 7C)。Therefore, the region containing the catalytic core (103 - 448, DT) is responsible for the stability of mPAH.

[0534] To improve the stability of the hPAH core region, various modifications were introduced into the hPAH - DT backbone. Using the hPAH - DT backbone, various amino acid modifications were introduced into the hPAH sequence. Amino acid changes were modeled based on the amino acid sequences of PAH in other species, including mouse, chicken, and bacteria (Table 1). All constructs also contained a 3x - FLAG - tag in the flexible N - terminus. Human variants (V; V1 - 13) were expressed in 293 cells in vitro, and PAH protein and activity levels were quantified in whole - cell lysates and compared with the DT forms of hPAH and mPAH ( Figure 8A ). Protein quantification showed that some hPAH variants, such as V1, V5 (with one additional change compared to V1), and V8 (two amino acid changes different from V1), had increased protein levels compared to unmodified hPAH. However, when testing the PAH enzyme activity of these variants, only V1 had a significantly increased PAH activity ( Figure 8B ). V1 consists of four amino acid changes (M180T, K199P, S250P, and G256A) located in three different parts of the catalytic domain. No changes were observed in constructs V9 - 13 (data not shown).

[0535] Table 1. Description of human PAH variants

[0536]

[0537] Additional derivatives of V1 were generated. The first group included constructs with only one amino acid change (V14 - 17, Table 1). PAH activity results showed that the PAH levels and activities of all these constructs were poor, comparable to unmodified hPAH, and thus indicated that none of these changes could provide any improvement alone ( Figures 9A - 9C 、 Figures 10A - 10C ). The second group of constructs was derivatives of V1 in which one of the four amino acids was reverted to the human wild - type amino acid.

[0538] Table 2. Human PAH variant - 1 derivatives

[0539] Description Variations Variant No. 22 M180T, K199P, S250P, G256A, H264P Variant No. 23 M180T, K199P, S250P, G256A, G272A Variant No. 24 M180T, K199P, S250P, G256A, G272P Variant No. 25 M180T, K199P, S250P, G256A, P275L Variant No. 26 M180T, K199P, S250P, G256A, P279Q Variant No. 27 M180T, K199P, S250P, G256A, G272P, P275L Variant No. 28 M180T, K199P, S250P, G256A, T323R, F327T Variant No. 29 M180T, G256A Variant No. 30 K199P, G256A Variant No. 31 S250P, G256A

[0540] Then it was determined whether three amino acid changes were sufficient (V18 - 21). The best of these was V20, which lacked the S250P change and had approximately 67% of the activity of V1 ( Figure 9A ). Interestingly, this variant had a 2 - fold higher specific activity compared to the parental V1, although it had a lower total enzyme activity due to a reduced PAH protein level ( Figure 9B 、Figure 9C )。

[0541] A set of double mutant derivatives of human PAH variant - 1 was also tested. Different from the single mutant series (V14 - 17), the double mutants V29 and V30 obtained some improvement in activity, but not as much as V1 improvement ( Figure 10D )。

[0542] To further improve V1, additional changes were introduced, some of which were aimed at increasing the specific activity (V22 - 28, Table 2). Although none of these changes increased the overall PAH activity, some modifications did increase the PAH protein level or its specific activity. For example, V23 has a PAH protein that is 2 - fold higher than hPAH - V1.

[0543] "Reverse" mutagenesis of mPAH was carried out by changing two or three residues at a time in those residues present within the region 103 - 428 in hPAH. Activity tests of five constructs spanning this region showed that none of these changes led to a reduction in mPAH production to the level observed for hPAH (data not shown).

[0544] Table 3. Mouse PAH Variants

[0545] Description Variations Mouse Variant No. 1 E114K, N116D, T180M Mouse Variant No. 2 R184K, R192K, A196S Mouse Variant No. 3 H206Y, R220H, E336Q Mouse Variant No. 4 D360E, C374I, E376N Mouse Variant No. 5 T401N, V421I

[0546] An expression cassette was constructed that encodes the best - performing variant (V1), which is expressed as a full - length protein from the A1MB2 - mTTR promoter. After transfection of the plasmid into Huh7 cells, this construct was compared with comparable mouse PAH and hPAH expression plasmids for PAH protein production and activity. The data showed that hPAH - V1 increased PAH protein production and activity by approximately 10 - fold compared to endogenous hPAH ( Figures 11A - 11C )。All PAH proteins have a comparable activity - to - protein ratio, indicating that the specific activities are roughly similar.

[0547] In summary, the data demonstrated the feasibility of improving human PAH characteristics through amino acid changes (e.g., 2, 3, 4, 5, or 6 amino acid changes), all of which contributed to the observed improvements.

[0548] Example 6: Correction of Hyperphenylalaninemia by PAH - V1

[0549] Methods

[0550] Blood and tissue analysis.

[0551] Brain and tissue analysis was performed as described in Examples 1 - 3.

[0552] Animal experiments.

[0553] Animal experiments were conducted as described in Examples 1-3.

[0554] Results

[0555] To test the efficacy of the modified hPAH in vivo, rAAV8 vectors encoding hPAH-V1, as well as similar vectors with murine or hPAH (both in the FL form), were generated. The vector expressing hPAH-V1 showed a rapid decrease in blood Phe levels and an increase in blood Tyr in the PAH enu2 mouse model ([ Figure 12A , Figure 12B ). Similar effects were observed for various Phe metabolites measured in the blood ([ Figure 12C ). Overall, the modified hPAH-V1 was more effective for all these endpoints compared to endogenous hPAH. The increased efficacy of hPAH-V1 was directly correlated with increased PAH protein levels and activity in the liver ([ Figure 13A , Figure 13B ). All treatment groups had comparable vector genome copies in the liver ([ Figure 13C ).

[0556] Different brain endpoints were analyzed (performed on the 3e11 VG / mouse treatment group). The data showed that Phe levels in the brains of treated mice were significantly reduced and Tyr levels were increased compared to the initial PAH enu2 mice ([ Figure 14A , Figure 14B ). The change in brain Phe levels was closely correlated with the decrease in blood Phe levels and also showed better control of Phe in the hPAH-V1 treatment group ([ Figure 14C ). Since the amino acids Phe, Tyr, and Trp all use the same large neutral amino acid transporter (LAT1), similar improvements were observed in brain Trp levels ([ Figure 14D ). Both hPAH and hPAH-V1 led to comparable increases in the levels of these amino acids in the brain.

[0557] The levels of the neurotransmitters dopamine and serotonin and their metabolites in the brains of treated mice were measured. The data showed that the increases in these neurotransmitters were significantly higher in animals treated with hPAH-V1 compared to hPAH ([ Figures 15A - 15D ).

[0558] In summary, the improved properties of the hPAH-V1 protein translate into an enhanced ability to reduce blood and brain Phe levels and increase brain Tyr and neurotransmitter levels. Since there were comparable vector genome levels in the liver, the data indicate that higher potency was achieved with the vector encoding hPAH-V1.

[0559] A 4.6 kb genome for the mA1MB2 - mTTR482 promoter / hPAH - V1 vector was generated. Except for the filler sequence introduced downstream of the BGH pA, this genome does not contain an "ATG" sequence in the intron sequence ( Figure 16A ). When this vector was tested in PAH enu2 mice, significantly better efficacy was observed as measured by a decrease in blood Phe levels when compared to the parental 3.8 kb vector ( Figure 16B ). This experiment also included a 4.6 kb vector that lacked the N - terminal FLAG tag for measuring PAH protein levels. The data showed that removing this tag did not alter the efficacy of the vector genome. In summary, the modified hPAH - V1 confers higher potency relative to endogenous hPAH and, therefore, is expected to provide efficacy at a lower vector dose compared to vectors encoding hPAH.

[0560] Example 7. Increased hPAH - V1 protein levels in NHP livers

[0561] Materials and Methods:

[0562] Construction of recombinant AAV vectors

[0563] Except for using a hybrid capsid, the production of the A1MB2 - HI - hPAH and A1MB2 - HI - hPAH - V1 vectors was performed as described in Example 4.

[0564] Animal experiments

[0565] Male cynomolgus monkeys (Macaca fascicularis) aged 2 - 3 years (2 - 4 kg) received 10 ml of the test article by slow intravenous infusion (1 ml / min) into the saphenous vein. The treatment groups consisted of a vehicle group (PBS, n = 1), rAAV / hPAH (n = 3), and rAAV / hPAH - V1 (n = 3). The animals were humanely euthanized two weeks later, and various tissues were collected and frozen at - 80 °C until analysis.

[0566] Quantification of vector genome, mRNA, and PAH protein

[0567] As described in Examples 1 - 3, the copies of the vector genome and vector - derived mRNA in the liver and spleen were quantified by qPCR using primers / probes against BGHpA. The levels of human PAH protein in liver homogenates were analyzed by Western blotting against the FLAG tag as described in Examples 1 - 3.

[0568] Results:

[0569] To test the function of the A1MB2-mTTR promoter in the NHP liver, the production levels of mRNA and PAH were evaluated at two times after vector delivery. On average, comparable levels of vector and vector-derived mRNA (normalized to vector genomic copies) were detected in the livers of all vector-treated animals ( Figure 17A 、 Figure 17B ). The liver specificity of expression was analyzed by comparing vector mRNA in the liver and spleen (mRNA levels in both tissues were normalized to vector genomic copies), and it was demonstrated that the transcript / VG ratio in the liver was higher than that in the spleen ( Figure 17B ). Transduction was also evaluated by testing for the detection of vector-derived FLAG-tagged PAH protein in the liver. All animals treated with the vector encoding PAH-V1 demonstrated the presence of correctly sized hPAH-V1 in the liver. In contrast, little to no hPAH protein was detected in animals treated with the vector encoding hPAH ( Figure 17C ). Since both vector genomic and mRNA levels were comparable in the two treatment groups, these results indicate better stability of the hPAH-V1 protein in the NHP liver. These observations are similar to studies conducted in mice and in vitro studies using human hepatocyte lines, indicating the superiority of hPAH-V1 in all tested systems.

[0570] References

[0571] Kochhar JS,et al.,Drug Deliv Transl Res 2012,2:223-237.

[0572] Ho G,Christodoulou J.Transl Pediatr 2014,4:49-62.

[0573] Blau N,Longo N.Expert Opin Pharmacother 2015,16:791-800.

[0574] Flydal MI,Martinez A.IUBMB Life 2013,65:341-349.

[0575] Erlandsen H,et al.,Pediatrics 2003,112:1557-1565.

[0576] Knappskog PM,et al.,Eur J Biochem 1996,242:813-821.

[0577] Jaffe E, et al., Arch Biochem Biophys 2013, 530:73-82.

[0578] Arturo EC, et al., PNAS 2016, 113:2394-2399.

[0579] Waisbren SE, et al., Mol Genet Metab 2007, 92:63-70.

[0580] Thomas J, et al., J Inborn Errors Metabolism & Screening 5:1-9.

[0581] Cleary M, et al., Mol Gen Metab 2013, 110:418-423.

[0582] Gonzales MJ, et al., Semin Pediatr Neurol 2016, 23:332-340.

[0583] Vogel KR, et al., J Inherit Metab Dis 2017, 40:227-235.

[0584] Burton B, et al., Mol Gen Metab 2015, 114:415-424.

[0585] Longo N, et al., Lancet 2014, 384:37-44.

[0586] Mochizuki S, et al., Gene Ther 2004, 11:1081-1086.

[0587] Ding Z, et al., Gene Therapy 2006, 13:587-593.

[0588] Harding CO, et al., Gene Therapy 2006, 13:457-462.

[0589] Yagi H, et al., J Gene Med 2011, 13:114-122.

[0590] Yagi H, et al., NeuroReport 2012, 23: 30 - 34.

[0591] Winn SR, et al., Mol Gen Metabolism 2018, 123: 6 - 20.

[0592] Oh H-J, et al., Pediatric Research 2004, 56: 278 - 284.

[0593] Nathwani AC, et al., Blood 2006, 107: 2653 - 2661.

[0594] Nambiar B, et al., Hum Gene Ther Methods 2017, 28: 23 - 38.

[0595] Martin J, et al., Hum Gene Ther Methods 2013;24: 253 - 269.

[0596] Yew NS et al., Mol Gen Metab 2013, 109: 339 - 344.

[0597] McDonald JD, Charlton CK. Genomics 1996, 39: 402 - 405.

[0598] Kyostio-Moore S, et al., Mol Ther Methods Clin Dev 2016, 3: 16006.

[0599] Nascimento C, et al., Appl Biochem Biotechnol 2010, 162: 192 - 207.

[0600] Baker RE, Shiman R. J Biol Chem 19: 9633 - 9639.

[0601] Ledley FD, et al., Biochem J 1990, 267: 399 - 406.

[0602] Aquado C, et al., FEBs Letters 2006, 580: 1697 - 1701.

[0603] Doskeland AP, Flatmark T. Biochim Biophys Acta 2001, 1547: 379 - 386.

[0604] Solstad T, Flatmark T. Eur J Biochem 2000, 267: 6302 - 6310.

[0605] Andersen OA, et al., J Mol Bio 2002, 320: 1095 - 1108.

[0606] Erlandsen H, et al., J Mol Bio 2002, 320: 645 - 661

[0607] Ziegler RJ, et al., Mol Ther 2007, 15: 492 - 500.

[0608] Finn JD, et al., Blood 2010, 116: 5842 - 5848.

[0609] George LA, et al., N Eng J Med 2017, 377: 2215 - 2227.

[0610] Walter JH, et al., The Lancet 2002, 360: 55 - 56.

[0611] Anderson PJ, Leuzzi V. Mol Gen Metab 2010, 99: S3 - S9.

[0612] Garcia MI, et al., Mol Gen Metab 2017, 11: 54 - 58.

[0613] Harding CO, et al., Mol Genet Metab 2018, March 31 (abstract)

[0614] Thomas J, et al., Mol Genet Metab 2018, March 18 (abstract).

[0615] McEachern KA, et al., J Gene Med 2006, 8: 719 - 729.

[0616] Jacobs F, et al., Gene Ther 2008, 15: 594 - 603.

[0617] Kramer MG, et al., Mol Ther 2003, 7: 375 - 385.

[0618] Chuah MK, et al., Mol Ther 2014, 9: 1605 - 1613.

[0619] Wooddell CI, et al., Gene Med 2008, 10: 551 - 563.

[0620] Nathwani AC, et al., NEJM 2011, 365: 2357 - 2365.

[0621] Jiang, H, et al., Blood 2006;108: 107 - 115.

[0622] Park JW, et al., Exp Mol Med 2010, 42: 105 - 115.

[0623] Charron CE, Lewin AS, Laipis PJ. Mol Ther 2004, 9: S334.

[0624] Grimm D, et al., J Virol. 2008, 82: 5887 - 911.

[0625] Lisowski L, et al., Nature, 2014, 506: 382 - 6.

[0626] Smith LJ, et al., Mol Ther. 2014Sep;22(9): 1625 - 34.

[0627] Sequence

[0628] Human phenylalanine hydroxylase (GenBank AAA60082.1 and AAC51772.1) - Amino acid sequence

[0629] MSTAVLENPGLGRKLSDFGQETSYIEDNCNQNGAISLIFSLKEEVGALAKVLRLFEENDVNLTHIESRPSRLKKDEYEFFTHLDKRSLPALTNIIKILRHDIGATVHELSRDKKKDTVPWFPRTIQELDRFANQILSYGAELDADHPGFKDPVYRARRKQFADIAYNYRHGQPIPRVEYMEEEKKTWGTVFKTLKSLYKTHACYEYNHIFPLLEKYCGFHEDNIPQLEDVSQFLQTCTGFRLRPVAGLLSSRDFLGGLAFRVFHCTQYIRHGSKPMYTPEPDICHELLGHVPLFSDRSFAQFSQEIGLASLGAPDEYIEKLATIYWFTVEFGLCKQGDSIKAYGAGLLSSFGELQYCLSEKPKLLPLELEKTAIQNYTVTEFQPLYYVAESFNDAKEKVRNFAATIPRPFSVRYDPYTQRIEVLDNTQQLKILADSINSEIGILCSALQKIK(SEQ ID NO:1)

[0630] Human phenylalanine hydroxylase (GenBank AAH26251.1) - Amino acid sequence

[0631]

[0632] Human PAH-V1 amino acid sequence (M180T, K199P, S250P and G256A)

[0633]

[0634] Human PAH-V1 DNA sequence

[0635]

[0636] 3.8 kb optimized vector genomic sequence (ITR-A1MB2-mTTR-HI-hPAHV1-BGHpA-ITR)

[0637]

[0638] 4.6 kb optimized vector genomic sequence (ITR-A1MB2-mTTR-HI[noATGs]-hPAH V1-BGHpA-Fill-in Nucleic acid - ITR) (4561 bp)

[0639]

[0640] 5' and 3' sequences used in the liver expression cassette

[0641] Modified PrT2 enhancer sequence

[0642]

[0643] Underlined, hepatocyte nuclear factor binding site; bold, modifications introduced to create binding sites with higher affinity; italic, repeat sequences

[0644] Modified A1MB2 enhancer

[0645]

[0646] Underlined, hepatocyte nuclear factor binding site; bold, modifications introduced to create binding sites with higher affinity; italic, repeat sequences

[0647] Modified Ealb sequence

[0648]

[0649] Underlined, hepatocyte nuclear factor binding site; bold, modifications introduced to create binding sites with higher affinity; italic, repeat sequences

[0650] HEII enhancer CCATCAGATCCTGCCCAAGGTCTTACATAAGA GGACTCTTGGAC TCCCAGCAATGTCAACGACCGACCTTGAGGCCTACTTCAAAGACTGTGTGTTTAAGGACTGGGAGGAGCTGGGGGAGGAGATTAGGTTAAAGGTCTTTGTATTAGGAGGCTG(SEQ ID NO:10)

[0651] CRM8 enhancer

[0652] GGGGAGGCTGCTGGTGAATATTAACCAAGGTCACCCCAGTTATCGGAGGAGCAAACAGGGGCTAAGTCCAC(SEQ ID NO:11)

[0653] 3'Alb stability element

[0654] CTCAATTGGATGACACTAGTCATCACATTTAAAAGCATCTCAGGTAACTATATTTTGAATTTTTTAAAAAAGTAACTATAATAGTTATTATTAAAATAGCAAAGATTGACCATTTCCAAGAGCCATATAGACCAGCACCGACCACTATTCTAAACTATTTATGTATGTAAATATTAGCTTTTAAAATTCTCAAAATAGTTGCTGAGTTGGGAACCACTATTATTTCTATCGATTCAGCAGCCGTAAGTCTAGGACAGGCTTAAATTGTTTTCACTGGTGTAAATTGCAGAAAGATGATCTAAGTAATTTGGCATTTATTTTAATAGGTTTGAAAAACACATGCCATTTTACAAATAAGACTTATATTTGTCCTTTTGTTTTTCAGCCTACCATGAGAATAAGAGAAAGAAAATGAAGATCAAAAGCTTATTCATCTGTTTTTCTTTTTCGTTGGTGTAAAGCCAACACCCTGTCTAAAAAACATAAATTTCTTTAATCATTTTGCCTCTTTTCTCTGTGCTTCAATTAATAAAAAATGGAAAGAATCTAATAGAGTGGTACAGCACTGTTATTTTTCAAAGATGTGTTGCTATCCTGAAAATTCTGTAGGTTCTGTGGAAGTTCCAGTGTTCTCTCTTATTCCACTTCGGTAGAGGATTTCTAGTTTCTTGTGGGCTAATTAAATAAATCATTAATACTCTTCTAAGTTATGGATTATAAACATTCAAAATAATATTTTGACATTATGATAATTCTGAATAAAAGAACAAAAACCATGGTATAGGTAAGGAATATAAAACATGGCTTTTACCTTAGAAAAAACAATTCTAAAATTCATATGGAATCAAAAAAGAGCCTGCAGGTACCCT(SEQ ID NO:12)

[0655] 3'alb and SMAR stability elements

[0656]

[0657] Codon-optimized human PAH cDNA

[0658]

[0659] Modified chicken β-actin (CBA) / rabbit β-globin hybrid promoter / intron

[0660]

[0661]

[0662] Bold = change to T to eliminate G, A, A, A, A of ATG (5 changes)

[0663] 0.9 kb A1AT intron fill-in sequence

[0664]

[0665] Bold = change to eliminate 7 bases of ATG; all A are changed to T.

Claims

1. A variant phenylalanine hydroxylase (PAH) polypeptide comprising two amino acid substitutions, wherein the amino acid substitutions are located at positions selected from M180, K199, S250, and G256 of the wild-type human PAH polypeptide.

2. A variant phenylalanine hydroxylase (PAH) polypeptide comprising three amino acid substitutions, wherein the amino acid substitutions are located at positions selected from M180, K199, S250, and G256 of the wild-type human PAH polypeptide.

3. A variant phenylalanine hydroxylase (PAH) polypeptide comprising four amino acid substitutions, the amino acid substitutions being located at positions M180, K199, S250, and G256 of the wild-type human PAH polypeptide.

4. The variant PAH polypeptide according to any one of claims 1-3, wherein the amino acid substitutions include one or more of M180T, K199P, S250P, and G256A.

5. The variant PAH polypeptide according to any one of claims 1-4, wherein the amino acid substitutions include K199P, S250P, and G256A; M180T, S250P, and G256A; M180T, K199P, and G256A; or M180T, K199P, and S250P.

6. The variant PAH polypeptide according to any one of claims 1-5, wherein the amino acid substitutions include M180T, K199P, S250P, and G256A.

7. The variant PAH polypeptide according to any one of claims 1-6, wherein the variant PAH polypeptide further comprises H264P, G272A, G272P, P275L, P279Q, G272P, and P275L, or T323R and F327T amino acid substitutions.

8. The variant PAH polypeptide according to any one of claims 1-7, wherein the wild-type human PAH polypeptide comprises the amino acid sequence of SEQ ID NO:

1.

9. The variant PAH polypeptide according to any one of claims 1-8, wherein the variant PAH polypeptide is a human PAH polypeptide.

10. The variant PAH polypeptide according to any one of claims 1-9, wherein the variant PAH polypeptide comprises an amino acid sequence that is at least about 80% identical to the amino acid sequence of SEQ ID NO:3.

Images