Reverse transcription transposon ERV1 as ovarian aging biomarker and application thereof

By using the retrotransposon ERV1 as a biomarker, its expression level is detected to evaluate the status of ovarian aging, and using the CRISPRa system to inhibit ERV1 activation, the problem of lack of effective evaluation and delayed ovarian aging in the prior art is solved, and effective evaluation and intervention on ovarian aging is achieved.

CN120350106APending Publication Date: 2025-07-22SUZHOU MUNICIPAL HOSPITAL
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311577680.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2023-11-24
Publication Date
2025-07-22

AI Technical Summary

Technical Problem

There is a lack of effective molecular biomarkers in the prior art for evaluating and delaying ovarian aging in women, especially inadequate causal explanations for transposons and ovarian aging.

Method used

The retrotransposon ERV1 was used as a biomarker to evaluate the status of ovarian aging by detecting its expression level, and the CRISPRa system was used to inhibit ERV1 activation to delay ovarian aging.

Benefits of technology

A convenient and fast method is provided to evaluate the status of ovarian aging in women, providing a molecular target for intervention in ovarian aging. By detecting the mRNA expression level of ERV1, it reflects the degree of ovarian aging. In vivo experiments prove that ERV1 activation promotes ovarian aging.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120350106A_ABST
    Figure CN120350106A_ABST
Patent Text Reader

Abstract

The invention provides an application of a reverse transcription transposon ERV1 as a biomarker in evaluation of ovarian aging of a subject and / or delaying of ovarian aging of the subject. The invention proves that the female ovarian senescence activity can be evaluated through the mRNA expression level of ERV1, the expression level of ERV1 in ovaries of infertility patients of old women and menopausal women can be conveniently and quickly detected, the ovarian senescence state can be reflected, and a basis is provided for a molecular target for intervening ovarian senescence.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of obstetrics and gynecology, and particularly relates to an ovarian aging biomarker and its application. Background Art

[0002] With the increase of age, a series of degenerative changes occur in the tissues and organs of the body, and cell functions gradually decline and tend to die, which is called aging. The ovary is one of the earliest aging organs. Ovarian aging is manifested as a decrease in the number of follicles, a decline in the quality of oocytes, changes in the menstrual cycle, a decline in fertility and subsequent loss, and ultimately menopause. Due to various factors, many contemporary young women choose to postpone marriage and childbirth, and thus will also face the risk of missing the optimal childbearing age. After a woman reaches 35 years old, ovarian function will decline rapidly. At the same time, ovarian aging is also considered as the pacemaker of female body aging, and the decline of ovarian function will trigger the aging of multiple organs in the body. The research on ovarian aging is of great significance. On the one hand, it is related to the physical and mental health of women, and on the other hand, it is related to female reproductive ability and the reproduction of offspring. Therefore, it is urgent to deeply explore the mechanism of female ovarian aging and effective delaying strategies.

[0003] At present, the biomarkers of aging are still some functional biomarkers, such as cardiovascular health, maximum oxygen consumption, grip strength, and muscle mass. The related research on molecular biomarkers and the process of ovarian aging is still lacking, especially the causal explanation of transposons and ovarian aging.

[0004] In recent years, more and more research has been carried out on the non-coding part of genes related to aging. For example, the long interspersed nuclear element-1 (LINE1) retrotransposon, which is a member of the non-long terminal repeat (non-LTR) retrotransposons, can be activated during the aging process, thus triggering the innate immune response. Endogenous retrovirus ERV, belonging to the long terminal repeat (LTR) retrotransposons, occupies about 8% of the human genome sequence. ERV viruses can integrate and reverse transcribe into the nuclear genome of host cells, stably inherit and cause diseases. The important gene components of ERV, gag (encoding the structural protein of the virus core), pol (encoding reverse transcriptase, integrase, and protease), and env (encoding the outer shell protein of the virus), are crucial for the invasion, replication, escape, and transmission of the virus. ERV includes multiple families such as ERVK and ERV1. Research reports that the activation of ERVK caused by epigenetic instability drives programmed cell aging and can be used as a driving force and measurement biomarker for cell aging. It is of great significance to explore ERV biomarkers related to female ovarian aging and use them for the diagnosis and delaying treatment of premature ovarian failure. Summary of the Invention

[0005] To solve the above technical problems, through multi-angle research, the present invention discovers that the elevated expression level of the retrotransposon ERV1 causes ovarian aging, and ERV1 can be used as a biomarker for ovarian aging.

[0006] Specifically, in the first aspect of the present invention, there is provided the use of the retrotransposon ERV1 as a biomarker in the assessment of ovarian aging in a subject and / or in delaying ovarian aging in a subject.

[0007] In the second aspect of the present invention, there is provided the use of a reagent for detecting the activation level of the retrotransposon ERV1 in the preparation of a kit for assessing ovarian aging in a subject; preferably, the test sample of the kit is an ovarian tissue sample of the subject.

[0008] In the third aspect of the present invention, there is provided the use of a reagent for inhibiting the activation level of the retrotransposon ERV1 in the preparation of a drug for delaying ovarian aging in a subject.

[0009] In certain embodiments, the ERV1 activation level includes the ERV1 transcript level, the ERV1 protein level, and the ERV1 locus methylation level.

[0010] In certain embodiments, the reagent detects the level of ERV1 RNA by RNA-seq or RT-qPCR.

[0011] In certain embodiments, the subject is a female infertility patient.

[0012] In certain embodiments, the subject is a female patient aged 31 - 40 years old, or a postmenopausal female patient aged 50 - 60 years old.

[0013] In the fourth aspect of the present invention, there is provided a kit for assessing ovarian granulosa cell aging, the kit comprising: a reagent for detecting the activation level of the retrotransposon ERV1 and / or a reagent for detecting the activity of proteins related to cell proliferation and apoptosis.

[0014] In certain embodiments, the reagent detects the level of ERV1 RNA by the RT-qPCR method; and detects the level of the proteins related to cell proliferation and apoptosis by one or a combination of several methods among BCA protein quantification, Western blot, and immunofluorescence staining.

[0015] In certain embodiments, the detection reagent for the activity of the proteins related to proliferation and apoptosis includes specific antibodies against P21, P27, and P53; preferably, the cell senescence activity is detected by β-galactosidase staining.

[0016] The fifth aspect of the present invention provides a method for evaluating the aging degree of ovarian samples of different ages for non-disease diagnosis and treatment purposes. The method includes detecting the transcription level of retrotransposons in tissues; using the transcription level value of ERV1 in ovarian granulosa cells that do not endogenously overexpress ERV1 and are untreated as a control; a higher transcription level of the ERV1 retrotransposon than the control indicates a more severe degree of ovarian aging.

[0017] The sixth aspect of the present invention provides a system for evaluating ovarian granulosa cell aging. The system includes: 1) reagents for detecting the transcription level of ERV1 and / or the levels of cell proliferation-related proteins P21, P27, and P53; 2) a device including a data input module, a data comparison module, and a conclusion output module.

[0018] In certain embodiments, the data input module is used to input the transcription level value of ERV1 in the sample to be tested; the data comparison module is used to compare the transcription level value of ERV1 in the sample to be tested with the control value; the control value is the transcription level of ERV1 in ovarian granulosa cells that do not endogenously overexpress ERV1 and are untreated; the conclusion output module is used to output a conclusion according to the following criteria: if the transcription level of ERV1 in the sample of the subject to be tested is higher than the control value, the degree of ovarian aging of the subject to be tested is more severe.

[0019] The beneficial effects of the present invention compared with the prior art are:

[0020] The RNA-seq data of the present invention show that there is a differential transposon expression profile in the ovaries of postmenopausal women compared with premenopausal women, including DNA transposons and retrotransposons. In the ovaries of postmenopausal women, 27 LTRs of ERV1 were identified with significantly increased expression. Further, using the CRISPRa system, by designing sgRNAs targeting the promoter LTR12F of ERV1, ERV1 was endogenously overexpressed in human KGN cells. The results showed that the KGN cells with endogenous overexpression of ERV1 showed signs of aging. Western blot experiments showed that after endogenous overexpression of ERV1, the protein expressions of cyclin-dependent kinase inhibitors P21, P27, and P53 increased. Ki67 protein immunofluorescence staining and β-galactosidase staining showed that endogenous overexpression of ERV1 affected the proliferation of KGN cells and promoted cell aging. The present invention confirmed in vivo and in vitro experiments that activating endogenous ERV1 can promote ovarian aging.

[0021] The present invention proves that the aging activity of the female ovary can be evaluated by the mRNA expression level of ERV1. Conveniently and quickly detecting the expression level of ERV1 in the ovaries of elderly women and postmenopausal female infertility patients will be able to reflect the ovarian aging state and provide a basis for molecular targets for intervening in ovarian aging. Description of the Drawings

[0022] Other features, objectives, and advantages of the present invention will become more apparent by reading the following detailed description of non-limiting embodiments with reference to the accompanying drawings:

[0023] Figure 1 It shows an increase in the expression of the retrotransposon ERV1 LTR in the ovaries of postmenopausal women. Figure 1 A is the RNA expression level of LTR in ovarian tissues of the fetal group (Fet), young group (Yng), premenopausal group (Old), and postmenopausal group (Mop); Figure 1 B shows that the RNA expression levels of all types of transposons, including LTR and non-LTR transposons, are increased in the ovarian tissues of the Mop group compared to the Old group; Figure 1 C shows that the RNA expression of 27 LTRs belonging to the ERV1 family is significantly increased in the ovarian tissues of the Mop group compared to the Old group.

[0024] Figure 2 It shows that the designed sgRNA of LTR12F promotes the endogenous overexpression of ERV1 in ovarian granulosa cells. Figure 2 A is to design sgRNA according to the ERV1 promoter LTR12F, overexpress ERV1 in KGN cells using the CRISPRa system, and subsequently label it as the sgERV1 group; Figure 2 B is to perform qPCR detection on the RNA expressions of the gene components pol, env, and gag, which are crucial for the invasion, replication, escape, and spread of the ERV1 viral genome, to clarify whether ERV1 is overexpressed and whether the CRISPRa system is effective.

[0025] Figure 3 It shows that the overexpression of ERV1 leads to an increase in the expression of cell cycle kinase inhibitors in ovarian granulosa cells. Figure 3 A is to detect the protein expression level of cell cycle kinase inhibitors in KGN cells of the control group and the ERV1 endogenous overexpression group by Western Blot; Figure 3 B is for Figure 3 Performing grayscale value analysis on the Western Blot results in A.

[0026] Figure 4 After the overexpression of ERV1, the proliferation ability of ovarian granulosa cells is weakened, and the cell senescence activity is increased. Figure 4 A is the Ki67 staining of KGN cells in the control group and the ERV1 endogenous overexpression group to detect cell proliferation activity; Figure 4 B is to perform statistical analysis on the number of positive cells stained by Ki67; Figure 4 C is the β-galactosidase staining (SA-β-gal) of KGN cells in the control group and the ERV1 endogenous overexpression group to detect cell senescence activity;Figure 4 D is to statistically analyze the number of SA-β-gal stained positive cells. Detailed implementation manners

[0027] To make the objectives, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings of the embodiments of the present invention. Obviously, the described embodiments are some but not all of the embodiments of the present invention. All other embodiments obtained by those of ordinary skill in the art based on the described embodiments of the present invention without creative efforts shall fall within the scope of protection of the present invention.

[0028] Unless otherwise defined, the technical terms or scientific terms used herein shall have the ordinary meanings understood by those of ordinary skill in the art to which the present invention pertains.

[0029] Example 1 RNA analysis of human ovarian tissue samples

[0030] 1.1 Collection of clinical female ovarian samples:

[0031] Fetal group (Fet): Second trimester, n = 3;

[0032] Young group (Yng): 22 - 30 years old, n = 3;

[0033] Pre-menopausal group (Old): 31 to 40 years old, n = 2;

[0034] Menopausal group (Mop): 50 - 60 years old and confirmed to be completely menopausal, n = 2.

[0035] 1.2 RNA extraction:

[0036] The ovarian samples were ground with liquid nitrogen and then 1 mL of RNAiso Plus (Takara, 9108Q) was added, and lysed at room temperature for 5 minutes. 1 / 5 volume of chloroform of RNAiso Plus was added, and after thorough mixing, it was left standing at room temperature for 5 minutes. Centrifuged at 12,000 g at 4 °C for 15 minutes. The supernatant was aspirated and transferred to another new centrifuge tube. 0.5 - 1 times the volume of RNAiso Plus of isopropanol was added to the supernatant, and after thorough mixing, it was left standing at room temperature for 10 minutes. Centrifuged at 12,000 g at 4 °C for 10 minutes. The supernatant was discarded, 1 mL of 75% ethanol was added, centrifuged at 7,500 g at 4 °C for 5 minutes, and the supernatant was discarded. After the precipitate was dried, an appropriate amount of RNase-free water was added to dissolve the precipitate.

[0037] 1.3 RT-qPCR experiment

[0038] Extract RNA from ovarian tissue and cell samples, reverse transcribe, and configure according to the following system: 1 μL each of the forward and reverse primers for ERV1-gag or ERV1-pol or ERV1-env, 10 μL of SYB Green (Biosharp), 6 μL of enzyme-free water, and 2 μL of cDNA. Pol, env, and gag are the gene components of endogenous retroviruses and are crucial for the invasion, replication, escape, and transmission of the ERV1 viral genome. Perform qPCR on the three genes and calculate and analyze the results. The primer sequences are as follows:

[0039] ERV1-gag: For: ACGCTTTACAGCCCTAGACC (SEQ ID NO: 1)

[0040] Rev: GTCGGGAGCAGATTGGGTAA (SEQ ID NO: 2)

[0041] ERV1-pol: For: CGCCCTTCTTCCCAATCCAA (SEQ ID NO: 3)

[0042] Rev: GCCAAGGAGGGAGTAGAGGT (SEQ ID NO: 4)

[0043] ERV1-env: For: GTATGTCTGATGGGGGTGGAG (SEQ ID NO: 5)

[0044] Rev: CTAGTCCTTTGTAGGGGCTAGAG (SEQ ID NO: 6)

[0045] 1.4 Transposon data analysis

[0046] According to the UCSC human hg19-rmsk genomic sequence, use STAR (version 2.7.8a) with default settings. Then use BEDTools (version 2.29.2) to convert the obtained STAR results to bam format. To quantify the expression level of each locus, use featureCount (version 2.0.1) to quantify the expression level of each locus with the parameters "-p -t exon -g gene_id". The TPM value in the sequencing data is calculated as the signal density, as Figure 1 shown. Figure 1 A is the RNA expression level of LTR in ovarian tissues of the fetal group (Fet), young group (Yng), premenopausal group (Old), and postmenopausal group (Mop); Figure 1 B is that compared with the Old group, the RNA expression levels of all types of transposons in the ovarian tissues of the Mop group increase, including LTR and non-LTR transposons; Figure 1Compared with the Old group, the RNA expression of 27 LTRs belonging to the ERV1 family in the ovarian tissue of the Mop group was significantly increased.

[0047] Example 2: KGN cell culture and endogenous overexpression of ERV1

[0048] 2.1 KGN cell culture:

[0049] The human ovarian granulosa cell line KGN cells were maintained in DMEM culture medium (Gibco, C11995500cp) containing 10% FBS (Vivacell, C04001 - 500), penicillin - streptomycin double - antibody (100 IU / mL penicillin and 100 μg / mL streptomycin), and 10 μg / mL ciprofloxacin (Yeasen Biotech, 60201ES08), and cultured at 37°C, 5% CO2, and saturated humidity. When the cells grew to 90% confluence, they were routinely digested and passaged using a 0.25% trypsin (Trypsin - EDTA, Gibco, 25200 - 072) cell digestive solution.

[0050] 2.2 Construction of endogenous overexpression ERV1 plasmid:

[0051] According to the human hg19 genome sequence, based on the LTR12F (ERV1 promoter) sequence (RepeatMasker - annotated repetitive elements) and designing sgRNA (sgLTR12F: CCCATCAGCAGGACATGGGT, SEQ ID NO: 7, see Figure 2 A), it was cloned into the lentiSAM v2 vector (Addgene, #75112) and co - transfected into human ovarian granulosa cells with the lentiMPH v2 plasmid (Addgene, #89308).

[0052] 2.3 KGN cell transfection:

[0053] The KGN cells that grew to 90% confluence were routinely digested with 0.25% trypsin and plated in a six - well plate with 2.5×10 5 cells per well. After the cells adhered stably, according to the instructions of the transfection reagent (Roche, 6366236001), sgNTC (control sgRNA: AAGATGAAAGGAAAGGCGTT, SEQ ID NO: 8) connected to the lentiSAM v2 vector, sgLTR12F, and the lentiMPH v2 plasmid were co - transfected into KGN cells respectively. After 48 to 72 hours of transfection, KGN cells with endogenous overexpression of ERV1 and its control were obtained, and the cells were collected for subsequent experiments.

[0054] Figure 2 For genes B that are crucial for the invasion, replication, escape, and transmission of the ERV1 virus genome, qPCR was used to detect the RNA expression of pol, env, and gag respectively, to clarify whether ERV1 was overexpressed and whether the CRISPRa system was effective.

[0055] Example 3 Immunoblot Experiment (Western Blot)

[0056] After the KGN cells were rinsed twice with pre-cooled PBS, cell lysis buffer [RIPA (Beyotime, P0013B), 1% protease inhibitor mixture (Beyotime, P1005), 0.05% PMSF (Beyotime, ST506)] was added, and the cells were scraped and collected, followed by rotary lysis at 4°C for 30 minutes; after centrifugation at 4°C and 12,000 rpm for 15 minutes, the supernatant was collected; the protein concentration was determined by the BCA method, 5×SDS-PAGE loading buffer was added, and the mixture was heated in a metal bath at 100°C for 10 minutes. 30 μg of protein was taken for separation by 10% SDS-PAGE gel electrophoresis, and transferred to a PVDF membrane (Millipore) using a rapid transfer solution (Xinsaimi, WB4600) for 35 minutes. The corresponding antibodies [anti-GAPDH (proteintech, 60004-1-Ig), anti-P21 (abcam, ab109520), anti-P27 (Proteintech, 25614-1-AP), anti-P53 (Proteintech, 60283-2-Ig)] were added and incubated overnight at 4°C. The membrane was washed three times on a horizontal shaker with TBST for 10 minutes each time, incubated with the secondary antibody at room temperature for 1 h, and then washed four times on a horizontal shaker with TBST for 10 minutes each time. The expression of related proteins was detected by an imager, as Figure 3 shown. Figure 3 A shows the protein expression levels of cell cycle kinase inhibitors in KGN cells of the control group and the ERV1 endogenous overexpression group detected by Western Blot; Figure 3 B is for Figure 3 gray value analysis of the Western Blot results in A. The results showed that the expressions of P21, P27, and P53 increased after ERV1 overexpression.

[0057] Example 4 Immunofluorescence Staining

[0058] Cover glasses of appropriate size were prepared, cleaned with 70% alcohol, sterilized over a Bunsen burner flame, placed in a 24-well plate, and irradiated with ultraviolet light for 15 minutes before use. 1 mL of 0.1% gelatin was added to the 24-well plate and treated in an incubator for 20 minutes. The KGN cells were digested and seeded at 5×10 per well 4Cells were seeded into 24-well plates and cultured for 24 - 48 h. The culture dishes were washed 3 times with 500 μL of PBS, and then 500 μL of 4% paraformaldehyde was added to fix for 10 minutes. After washing 3 times with PBS, 1 mL of 0.5% Triton-X 100 was added and the cells were treated at room temperature for 3 minutes, followed by washing 3 times with PBS. After incubating with 2 mL of 1% BSA for 10 minutes, 1 mg / mL of Ki67 antibody (abcam, ab15580) was added to the slides and incubated overnight at 4°C. The next day, the cells were washed 3 times with PBS, secondary antibody was added, and the cells were incubated at room temperature in the dark for 2 h, followed by washing 3 times with PBS for 5 minutes each time. The nuclei were stained with Hochest 33342 (1:2000) for 10 minutes. After washing 3 times with PBS, the coverslips were removed from the 24-well plates with forceps, placed on glass slides, and a larger coverslip was slowly covered, and then sealed with 50% glycerol, as Figure 4 shown in A and B. Figure 4 A shows the Ki67 staining of KGN cells in the control group and the ERV1 endogenous overexpression group to detect cell proliferation activity; Figure 4 B shows the statistical analysis of the number of Ki67-stained positive cells. Compared with the control group, after endogenous overexpression of ERV1, the number of KGN cells with positive Ki67 staining decreased, indicating that the cell proliferation activity was weakened.

[0059] Example 5 β-Galactosidase Staining

[0060] The senescence activity of human ovarian granulosa cells KGN was detected using a β-galactosidase staining kit. The specific steps are as follows:

[0061] a. For KGN cells that had reached 90% confluence, the cell culture medium was aspirated, the cells were washed once with PBS or HBSS, and then 1 mL of β-galactosidase staining fixative was added and fixed at room temperature for 15 minutes.

[0062] b. The cell fixative was aspirated, and the cells were washed 3 times with PBS or HBSS for 3 minutes each time.

[0063] c. The PBS or HBSS was aspirated, and 1 mL of staining working solution was added to each well. The preparation method of the staining working solution is as follows:

[0064] Mix 10 μL of β-galactosidase staining solution A, 10 μL of β-galactosidase staining solution B, 930 μL of β-galactosidase staining solution C, and 50 μL of X-Gal solution.

[0065] d. Incubate overnight at 37°C. The 6-well plates can be sealed with parafilm or plastic wrap to prevent evaporation.

[0066] e. Observe under an ordinary optical microscope.

[0067] As Figure 4 shown in C and D,Figure 4 C was the β-galactosidase staining (SA-β-gal) of KGN cells in the control group and the ERV1 endogenous overexpression group to detect the cell senescence activity; Figure 4 D was the statistical analysis of the number of SA-β-gal stained positive cells. Compared with the control group, after ERV1 endogenous overexpression, the number of SA-β-gal stained positive KGN cells increased, indicating an enhanced cell senescence activity.

[0068] The above has shown and described the basic principles, main features and advantages of the present invention. For those skilled in the art, it is obvious that the present invention is not limited to the details of the above exemplary embodiments, and can be implemented in other specific forms without departing from the spirit or basic features of the present invention. Therefore, from any point of view, the embodiments should be regarded as exemplary and non-restrictive. The scope of the present invention is defined by the appended claims rather than the above description. Therefore, all changes falling within the meaning and scope of the equivalent elements of the claims are intended to be embraced within the present invention. Any reference signs in the claims should not be construed as limiting the claims involved.

[0069] In addition, it should be understood that although this specification is described according to the embodiments, not every embodiment only contains an independent technical solution. This narrative way of the specification is only for clarity. Those skilled in the art should regard the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.

Claims

1. Use of the retrotransposon ERV1 as a biomarker in the assessment of ovarian aging in a subject and / or in delaying ovarian aging in a subject.

2. Use of a reagent for detecting the activation level of the retrotransposon ERV1 in the preparation of a kit for assessing ovarian aging in a subject; preferably, the test sample of the kit is an ovarian tissue sample of the subject.

3. Use of a reagent for inhibiting the activation level of the retrotransposon ERV1 in the preparation of a drug for delaying ovarian aging in a subject.

4. The use according to claim 2 or 3, characterized in that, The ERV1 activation level includes the ERV1 transcript level, the ERV1 protein level, and the ERV1 locus methylation level.

5. The use according to claim 2, characterized in that, The reagent detects the level of ERV1 RNA by RNA-seq or RT-qPCR.

6. The use according to any one of claims 1-5, characterized in that, The subject is a female infertility patient.

7. The use according to any one of claims 1-5, characterized in that, The subject is a female patient aged 31 - 40 years old, or a postmenopausal female patient aged 50 - 60 years old.

8. An ovarian granulosa cell senescence assessment kit, characterized in that The kit includes: a reagent for detecting the activation level of the retrotransposon ERV1 and / or a reagent for detecting the activity of proteins related to cell proliferation and apoptosis.

9. The kit according to claim 8, characterized in that, The reagent detects the level of ERV1 RNA by the RT-qPCR method; the level of proteins related to cell proliferation and apoptosis is detected by a combination of one or more of the methods of BCA protein quantification, Western blot, and immunofluorescence staining.

10. The kit according to claim 8 or 9, characterized in that, The reagent for detecting the activity of proteins related to proliferation and apoptosis includes specific antibodies against P21, P27, and P53; preferably, the activity of cell senescence is detected by β-galactosidase staining.

11. A method for evaluating the aging degree of ovarian samples of different ages for non-diagnostic and non-therapeutic purposes, characterized in that, The method includes detecting the transcriptional level of the retrotransposon in the tissue; taking the transcriptional level value of ERV1 in ovarian granulosa cells without endogenous overexpression of ERV1 and without any treatment as a control; a higher transcriptional level of the ERV1 retrotransposon than the control indicates a more severe degree of ovarian aging.

12. A system for evaluating ovarian granulosa cell senescence, characterized in that, The system includes: 1) a reagent for detecting the transcriptional level of ERV1 and / or the levels of cell proliferation-related proteins P21, P27, and P53; 2) a device including a data input module, a data comparison module, and a conclusion output module.

13. The system according to claim 12, wherein The data input module is used to input the transcriptional level value of ERV1 in the test sample; the data comparison module is used to compare the transcriptional level value of ERV1 in the test sample with the control value; the control value is the transcriptional level of ERV1 in ovarian granulosa cells without endogenous overexpression of ERV1 and without any treatment; the conclusion output module is used to output a conclusion according to the following criteria: if the transcriptional level of ERV1 in the sample of the tested person is higher than the control value, then the degree of ovarian aging of the tested person is more severe.