Preparation method and application of probe for antenatal diagnosis

Abstract

The invention relates to the field of molecular biology, in particular to a preparation method and application of a probe for antenatal diagnosis, a probe composition comprises a 13q14.2 / 21q22.13 double-color probe and a CEP18 / CEPX / CEPY three-color probe, common gene abnormality in antenatal screening can be comprehensively detected, the probe marks a specific area, and the probe is used for detecting gene abnormality in antenatal screening. The specificity of the probe is improved, the accuracy of a detection result is improved, furthermore, a small amount of unlocked nucleotide is doped into the probe composition, the specificity of the probe is further improved, background noise is remarkably reduced, and the difficulty of result analysis is reduced.

Description

Technical Field

[0001] This application relates to the field of molecular biology, and particularly to a method for preparing a probe for prenatal diagnosis and its application. Background Art

[0002] Prenatal diagnosis, also known as intrauterine diagnosis, is to make an accurate diagnosis on whether an embryo or fetus has a certain genetic disease or congenital malformation before birth based on genetic counseling. Diseases that can be diagnosed prenatally include chromosomal diseases, congenital metabolic diseases caused by specific enzyme defects, genetic diseases that can be detected by DNA, neural tube defects with polygenic inheritance, and congenital malformations with obvious morphological changes.

[0003] The most common fetal chromosomal abnormalities occur in autosomes No. 13, 18, 21 and sex chromosomes X and Y. Chromosomal numerical abnormalities or copy number changes, including trisomy 21 (Down syndrome), trisomy 18 (Edward syndrome), trisomy 13 (Patau syndrome), 45,X (Turner syndrome), 47,XXY (Klinefelter syndrome) and triploidy, account for about 80% of chromosomally abnormal cases with clinical significance in prenatal diagnosis.

[0004] Trisomy 13 (Patau syndrome) is a congenital disease reported by Dr. Klaus Patau in 1960. This disease is caused by an extra copy of chromosome 13. Other changes in chromosome 13, such as translocation and mosaicism, also lead to similar phenotypes and are classified as Patau syndrome. This syndrome can cause severe physical and mental abnormalities, including nerve damage, facial defects, heart disease and mental retardation, etc.

[0005] Common fetal malformations in trisomy 18 (Edward syndrome) include: fetal growth restriction (accounting for 80%), central nervous system abnormalities, choroid plexus cysts, heart malformations, umbilical hernia, diaphragmatic hernia, abnormal hand - clenching posture (unilateral or bilateral fingers clenched tightly without finger - opening movement), etc.

[0006] Down Syndrome (DS), also known as Down syndrome, is a common autosomal abnormality. It was first described by Langdon Down in 1866 and confirmed by Le Jeune et al. in 1959 as being caused by trisomy of chromosome 21. This syndrome is the most common cause of congenital mental retardation in children and one of the most common genetic diseases. The main clinical features of trisomy 21 are a distinctive face, low nose bridge, epicanthus, upturned outer corners of the eyes, small and low-positioned ears, upward nostrils, often ectropion of the tongue, short neck, webbed neck, and intellectual retardation. 50% have congenital heart malformations, with ventricular septal defect and atrioventricular channel malformation being the most common. The special face of premature infants is sometimes atypical, but they often have obvious hypotonia in infancy.

[0007] X (Turner syndrome) is the most common sex chromosome abnormality. 99% of Turner syndrome cases result in spontaneous abortion during the embryonic period, accounting for about 15% of spontaneous abortion cases during early pregnancy. Its main clinical features are: female phenotype, low birth weight, short or deformed fourth and fifth phalanges, slow physical development, especially lack of puberty development, which makes the adult stature significantly short, only between 120-140cm; low back hairline, hair can extend all the way to the back; 50% of individuals have webbed necks; there may also be shield chest, elbow valgus, wide distance between two nipples, abnormal texture, etc. The secondary sexual characteristics are poorly developed, manifested as immature adult vulva, sparse pubic hair, underdeveloped breasts, uterine dysplasia, no ovarian follicles, primary amenorrhea, and thus infertility.

[0008] 47,XXY (Klinefelter syndrome) is a congenital testicular dysgenesis, first proposed by Klinefelter in 1942. It is the most common sex chromosome abnormality in men. The most common chromosome karyotype of this disease is 47,XXY. This disease is also the main cause of infertility caused by genetic abnormalities. Due to the lack of specific clinical manifestations in the early stage, this disease is easily missed. Summary of the invention

[0009] In order to solve at least one of the above technical problems, a method for preparing a probe composition for prenatal diagnosis and its application are developed.

[0010] In a first aspect, the present application provides a method for preparing a probe composition for diagnosing prenatal chromosomal abnormalities, comprising the following steps: (1) Download the BAC clone gene sequences corresponding to the following gene loci from the UCSC Genome Browser, 13q14.2: RP11-1150C12, RP11-798D7, RP11-795G6; 21q22.13: RP11-980O13, RP11-95G19; (2) The BAC clone gene sequences corresponding to each locus obtained in step (1) are respectively segmented into 1-kb blocks using the perl plug-in program chunks.pl and duplicate sequences are removed; the segmented blocks are batch-imported into the OligoArray software for probe design and probe screening, and then the screened probes and SEQ No 1, SEQ No 2, and SEQ No 3 are exported to an EXCEL table. Then, a 17-bp tag sequence is added to the 5' end and an 18-bp tag sequence is added to the 3' end of each probe to obtain a series of probe sequences with tag sequences. SEQ No 1 is the centromeric region gene sequence corresponding to CEP18, SEQ No 2 is the centromeric region gene sequence corresponding to CEPX, and SEQ No 3 is the centromeric region gene sequence corresponding to CEPY; SEQ No 1: CTGCAGCGTTCTGAGAAACATCTTTGTGATGTTTGTATTCAGGACACAGAGTTGAACATT CCCTATCATAGAGCAGGTTGGATCACTCCTTTTGTAGTATCTGGAAGTGGACATTTGGAG CGCTTTCAGGCCTATTTTGGAAAGGGAAATATCTTCCCGTAACAACTATGCAGAAGCATTCTCAGAAACTTGTTTGTGATGTGTGCCCTCTACTGACA; SEQ No 2: CTTTTGGCAGAATCTGCAAGTGGACATTTGGAGCGCTTTCAGGCCTGTGGTGGAAAAGC CTGAAAGCCTTTTCGCTTTATCTTCACAGAAAGACGAGAGAGAAGCATTGTCAGAAACT TCTTTGTGATGATTGCATTCAACTCACAGAGTTGAAGATTCCTTTTGAAACAGCAGTTTCGAAACACTCTTTCTGTGGGATCCGCAAGGGATATTTGGACCTCTTTG; SEQ No 3: ACCATTCCACTCCGGTTGATTCCATTCCATTCCATTCCTTTCCATTCCATTCAATTCCACTC GGGTTCAATACATTCCATTCCATTCCATTCTTTTCCTTTCCATTCCATTCCATTCAAATCGT GTTGATTCCATTCCATTCCATTCCCTTCCATTCCGTTCAATTCCATTCCTCTCGGGTTTATTTCATTCCATAGAATTCATCTCAATTA; (3) Chemically synthesize the gene probe sequences with tag sequences obtained in step (2) using a DNA synthesizer, mix the chemically synthesized probes at the same locus, and prepare probe libraries for each locus respectively; (4) Chemically synthesize a universal primer with a green fluorescent group at the 5' end, a universal primer with a red fluorescent group at the 5' end, and a universal primer with a cyan fluorescent group at the 5' end respectively, and use the universal primers of different colors to perform amplification labeling reactions on the probes at different loci. Approximately 5% to approximately 10% of UNA triphosphate is optionally added to the total amount of nucleotide raw materials in the amplification labeling reaction; (5) Purify and dilute the amplification labeling products of the probe libraries obtained in step (4) to obtain a fluorescently labeled probe library.

[0011] Most cases of trisomy 21 have a complete trisomy of chromosome 21, but there are also a few cases with partial trisomy of chromosome 21, accompanied by some characteristics of Down syndrome. These cases suggest the existence of a critical region on chromosome 21, which has an important impact on the development of Down syndrome. The most reported critical region of Down syndrome is located in the region of about 1.6 Mb between D21S55 near the long arm of human chromosome 21, D21S17 and the ERG gene. The probe in this application is designed in this region, and the labeled region is at 21q22.13, labeled with a red fluorescent group. The BAC clones used are: RP11-980O13, RP11-95G19. Trisomy 13 is caused by an increase in the copy number of chromosome 13. Since the satellite repeat sequences in the centromeric regions of chromosomes 21 and 13 are highly homologous, the probe targeting the centromere will show fluorescence signals on both sets of chromosomes and cannot be distinguished. Related reports show that the probability of recombination in the 13q14 region of chromosome 13 is relatively low. Therefore, the probe in this application is designed in this section, labeled with a green fluorescent group. The BAC clones used are: RP11-1150C12, RP11-798D7, RP11-795G6.

[0012] In the preferred embodiment of this application, the 17bp tag sequence in step (2) is TGTAAAACGACGGCCAG, and the 18bp tag sequence is GGTCATAGCTGTTTCCTG.

[0013] Adding tag sequences to both ends of the probe can facilitate PCR amplification using universal primers, greatly reducing the primer design and screening work, enabling the above-mentioned probe amplification by PCR. The above tag sequences are carefully designed and screened by the applicant and have been verified to be able to be used for the amplification of BAC clone sequence probes corresponding to multiple target genes.

[0014] In a preferred embodiment of the present application, the probe screening conditions in step (2) are as follows: the probe length is 50 - 150 bp, the TM value is 85 - 99 °C, the GC ratio is 40 - 80%, it does not contain TTTT / GGGG / AAAA / CCCC, and the minimum interval between probes is 5 bp.

[0015] The above parameters for probe screening can be adjusted according to specific experimental purposes and requirements. Among them, the probe length is 50 - 150 bp, which is to ensure that the probe length is within a suitable range, neither too short to reduce specificity nor too long to increase synthesis costs. The TM value is 85 - 99 °C, which is to ensure that the melting temperature (Tm) of the probe is within a suitable range to ensure the specificity and stability of the probe in the experiment. The GC ratio is 40 - 80%, which is to ensure that the GC content of the probe is within a suitable range to ensure the stability and specificity of the probe. It does not contain TTTT / GGGG / AAAA / CCCC, which is to avoid the occurrence of repetitive sequences in the probe, thereby reducing the possibility of non-specific binding.

[0016] In a preferred embodiment of the present application, the universal primer sequences in step (4) are TGTAAAACGACGGCCAGT and CAGGAAACAGCTATGACC.

[0017] Using the above universal primers, in combination with the above tag sequences, can specifically recognize each probe sequence and perform efficient amplification to obtain a probe library suitable for FISH detection.

[0018] In a preferred embodiment of the present application, the polymerase used in the amplification labeling reaction is Therminator DNA polymerase.

[0019] Therminator DNA polymerase is a DNA polymerase widely used in molecular biology experiments, characterized by high fidelity, high stability, and high efficiency. Therefore, it is widely used in experiments such as DNA replication, PCR amplification, and gene cloning. Therminator DNA polymerase can simultaneously recognize natural deoxynucleoside triphosphate substrates and UNA triphosphate substrates and perform high-fidelity PCR amplification. Using the above polymerase and adding a certain amount of 5% - 10% UNA triphosphate substrate to the reaction substrate, a probe sequence incorporated with a small amount of open-ring nucleotides can be obtained.

[0020] In a preferred embodiment of the present application, the UNA triphosphate is selected from UNA-A triphosphate, UNA-T triphosphate, UNA-G triphosphate, and UNA-C triphosphate. Preferably, the molar mass ratio of UNA-A triphosphate, UNA-T triphosphate, UNA-G triphosphate, and UNA-C triphosphate is 1:1:1:1.

[0021] With the above technical solution, the cyclic nucleotide can change the conformation of the original sequence. The incorporation of a small amount of cyclic nucleotide enhances the specificity while maintaining the affinity of the probe for the target, reduces background noise, and simultaneously enhances the stability of the probe.

[0022] In a preferred embodiment of the present application, the 13q14.2 probe is labeled with a green fluorescent group, the 21q22.13 probe is labeled with a red fluorescent group, the CEPY probe is labeled with a red fluorescent group, the CEPX probe is labeled with a green fluorescent group, and the CEP18 probe is labeled with a cyan fluorescent group.

[0023] With the above technical solution, in the 13q14.2 / 21q22.13 probe composition, the 13q14.2 probe is labeled with a green fluorescent group, and 21q22.13 is labeled with a red fluorescent group. In the CEP18 / CEPX / CEPY probe composition, the CEPY probe is labeled with a red fluorescent group, the CEPX probe is labeled with a green fluorescent group, and the CEP18 probe is labeled with a cyan fluorescent group. First, the excitation and emission wavelengths of the red, green, and cyan fluorescent groups are different, and they can be observed separately through different filters, thereby reducing the problems of spectral overlap and crosstalk. Second, red and cyan or red and green are considered complementary colors because their positions on the color wheel are very different, so they can be clearly distinguished, and this characteristic can be used for image processing to improve the accuracy of analysis. Finally, there is a rich variety of red, green, and cyan fluorescent groups, and appropriate fluorescent groups can be selected according to experimental requirements.

[0024] In a preferred embodiment of the present application, the preparation method of the CEP18 probe includes the following steps: (1) Export the sequence of SEQ No 1 to an EXCEL spreadsheet, add a 17bp tag sequence to the 5' end of the sequence and an 18bp tag sequence to the 3' end to obtain a probe sequence with tag sequences.

[0025] (2) Use a DNA synthesizer to chemically synthesize the gene probe sequence with tag sequences obtained in step (1), and mix the chemically synthesized probes at the same locus to prepare a CEP18 probe library; (3) Synthesize a universal primer with a cyan fluorescent group at the 5' end and use this universal primer to perform an amplification labeling reaction on the CEP18 probe library synthesized in step (2), wherein 5% of the total molar amount of nucleotide raw materials is added with UNA triphosphate in the amplification labeling reaction; the universal primer sequences are TGTAAAACGACGGCCAGT and CAGGAAACAGCTATGACC.

[0026] (4) Purify and dilute the amplification labeling product of the probe library obtained in step (3) to obtain a fluorescently labeled CEP18 probe library.

[0027] In the preferred embodiment of this application, the preparation method of the CEPX probe includes the following steps: (1) Export the sequence of SEQ No 2 to an EXCEL table, add a 17bp tag sequence at the 5' end of the sequence and an 18bp tag sequence at the 3' end to obtain a probe sequence with tag sequences.

[0028] (2) Use a DNA synthesizer to chemically synthesize the gene probe sequence with tag sequences obtained in step (1), and mix the chemically synthesized probes at the same locus to prepare a CEPX probe library; (3) Synthesize a universal primer with a green fluorescent group at the 5' end and use this universal primer to perform an amplification labeling reaction on the CEPX probe library synthesized in step (2), wherein 8% of the total molar amount of nucleotide raw materials is added with UNA triphosphate in the amplification labeling reaction; the universal primer sequences are TGTAAAACGACGGCCAGT and CAGGAAACAGCTATGACC.

[0029] (4) Purify and dilute the amplification labeling product of the probe library obtained in step (3) to obtain a fluorescently labeled CEPX probe library.

[0030] In the preferred embodiment of this application, the preparation method of the CEPY probe includes the following steps: (1) Export the sequence of SEQ No 3 to an EXCEL table, add a 17bp tag sequence at the 5' end of the sequence and an 18bp tag sequence at the 3' end to obtain a probe sequence with tag sequences.

[0031] (2) Use a DNA synthesizer to chemically synthesize the gene probe sequence with tag sequences obtained in step (1), and mix the chemically synthesized probes at the same locus to prepare a CEPY probe library; (3) Synthesize a universal primer with a red fluorescent group at the 5' end and use this universal primer to perform an amplification labeling reaction on the CEPY probe library synthesized in step (2), wherein 10% of the total molar amount of nucleotide raw materials is added as UNA triphosphate in the amplification labeling reaction; the sequences of the universal primer are TGTAAAACGACGGCCAGT and CAGGAAACAGCTATGACC.

[0032] (4) Purify and dilute the amplification labeling product of the probe library obtained in step (3) to obtain a fluorescently labeled CEPY probe library.

[0033] In a second aspect, the present application provides a probe composition prepared by the preparation method defined in any of the above technical solutions.

[0034] In a preferred embodiment of the present application, a two-color probe composition is prepared by mixing the 13q14.2 probe and the 21q22.13 probe at equal concentrations.

[0035] In a preferred embodiment of the present application, a three-color probe composition is prepared by mixing the CEP18 probe, the CEPX probe, and the CEPY probe at equal concentrations.

[0036] By adopting the above technical solution, the 13q14.2 probe and the 21q22.13 probe are used in combination to form a two-color probe. During the detection process, it can not only simultaneously detect the abnormalities of chromosome 13 and chromosome 21 that are common in prenatal screening, but also serve as internal reference probes for each other to improve the accuracy of the results. The CEP18 probe, the CEPX probe, and the CEPY probe are used in combination to form a three-color probe. During the prenatal screening process, it can detect gene abnormalities of chromosome 18, X, and Y. During the detection process, they can also serve as internal references for each other to exclude the influence of the probe composition itself and improve the accuracy of the detection results.

[0037] In a preferred embodiment of the present application, the concentration of the above probe is: 20 - 50 ng / μL for each probe composition.

[0038] In a preferred embodiment of the present application, the concentration of the above probe is: 20 ng / μL for each probe composition.

[0039] In a preferred embodiment of the present application, the concentration of the above probe is: 30 ng / μL for each probe composition.

[0040] In a preferred embodiment of the present application, the concentration of the above probe is: 40 ng / μL for each probe composition.

[0041] In a preferred embodiment of the present application, the concentration of the above probe is: 50 ng / μL for each probe composition.

[0042] In a preferred embodiment of the present application, the amplification labeling reaction system is as follows: (1) Reaction buffer (2) Deoxynucleoside triphosphate substrates and 5%-10% UNA triphosphate substrates; (3) Prepared probe library template; (4) Synthesized fluorescently labeled universal primer; (5) DNA polymerase.

[0043] In a preferred embodiment of the present application, the conditions for the amplification labeling reaction are: 95°C for 5 min; 94°C for 30 s, 58°C for 30 s, 72°C for 30 s, for a total of 35 cycles; 72°C for 10 min.

[0044] In a third aspect, the present application provides a kit, which contains (1) A mixture of the probe composition prepared by the preparation method defined in any of the above technical solutions and a hybridization buffer; (2) DAPI counterstain.

[0045] In a fourth aspect, the present application provides an application of the probe composition or kit prepared by the preparation method defined in any of the above technical solutions in the preparation of prenatal diagnostic products.

[0046] In a fifth aspect of the present application, the present application provides an application of the above kit in prenatal diagnosis, and the application includes the following steps: (1) Sample treatment: After dropping and fixing the cells collected from the amniocentesis sample on a slide, place it in a container containing 2×SSC, heat it in a microwave oven at high power for 3 min until the liquid boils, and then continue to heat it at medium-low power for 10 min. After the treatment is completed, immediately place the slide in pre-cooled gradient alcohol at -20°C for dehydration and drying, and divide the sample into two parts, numbered 1-2, for standby; (2) Preparation of the probe hybridization mixture: Mix the fluorescently labeled probe compositions 13q14.2 / 21q22.13 and CEP18 / CEPX / CEPY and the hybridization buffer in a volume ratio of 1:9 respectively; (3) Probe-sample co-denaturation: Hybridize and mix the sample No. 1 with 10 μL of the 13q14.2 / 21q22.13 probe hybridization mixture in step (2), and hybridize and mix the sample No. 2 with 10 μL of the CEP18 / CEPX / CEPY probe hybridization mixture in step (2). Cover the slide with a 22×22 mm coverslip, seal the slide with rubber glue, and after sealing, place the slide in a hybridization instrument at 90°C for denaturation for 1 min and hybridize at 37°C for 30-60 min; (4) Post-hybridization washing: After hybridization is completed, remove the coverslip, and place the slide in a pre-warmed washing solution at 60°C to wash away the unbound probes; (5) Counterstaining and microscopic examination: Add 10 μL of anti-quenching mounting medium to the air-dried glass slide for mounting, and then observe the hybridization result under a fluorescence microscope.

[0047] Definitions and Explanations Unless otherwise specified, the following terms and phrases used herein are intended to have the following meanings. A particular term or phrase should not be considered indeterminate or unclear without a special definition, but should be understood in the meaning understood by those of ordinary skill in the art. When a trade name appears in this article, it is intended to refer to its corresponding product or its active ingredient.

[0048] In the present invention, unless otherwise specified, the terms "comprising", "including" and "containing" or equivalents are open-ended expressions, meaning that in addition to the listed elements, components or steps, other unspecified elements, components or steps may also be covered.

[0049] Unless otherwise specified, the "multi-" in the term "multiple" of the present invention refers to an integer greater than or equal to 2, including but not limited to 2, 3, 4, 5, 6, 7, 8, 9 and 10, up to the maximum number of items in the options.

[0050] Unless otherwise specified, the "optional" and / or "optionally" in the terms of this application means that it can be selected or not selected. When not selected, it means that this step, this limitation or this component does not exist. When selected, it means to perform relevant operations or limitations according to the following description.

[0051] Unless otherwise specified, the term "UNA" in this application represents a novel acyclic RNA derivative, similar to DNA or RNA, and the general structural formula of UNA is where B represents the natural bases adenine, thymine, guanine and cytosine.

[0052] Unless otherwise specified, the general structural formula of UNA triphosphate is

[0053] Unless otherwise specified, the structural formula of "UNA-A triphosphate" in this application is

[0054] Unless otherwise specified, the structural formula of "UNA-T triphosphate" in this application is

[0055] Unless otherwise specified, the structural formula of "UNA-G triphosphate" in this application is

[0056] Unless otherwise specified, the structural formula of "UNA-C triphosphate" in this application is

[0057] In summary, the present invention includes at least one of the following beneficial effects: 1. The present application marks the regions with strong specificity on the long arms of chromosomes 21 and 13, avoids using the centromeric regions with high homology to satellite repeats, enhances the specificity of the probe, improves the accuracy of the detection results, and reduces the difficulty of result analysis.

[0058] 2. The present application uses SEQ No 1, SEQ No 2, and SEQ No 3 probes with high specificity and low similarity to other sequences to detect the centromeric regions of CEP18, CEPX, and CEPY respectively, which can improve the specificity of the detection and reduce background noise.

[0059] 3. A small amount of unlocked nucleic acid (UNA) is contained in the probe of the present application. On the basis of a slight increase in fluorescence after probe binding, it can further improve the specificity and stability of the probe and reduce background noise.

[0060] 4. The present application uses two sets of probes to comprehensively detect common types of gene abnormalities during prenatal diagnosis, which can improve the detection rate of gene abnormalities and reduce the possibility of missed detection.

[0061] 5. The preparation method of the present application adds tag sequences at both ends of each probe, greatly reducing the screening and design work of primers, and enabling the probe preparation process to be amplified by the PCR method. BRIEF DESCRIPTION OF THE DRAWINGS

[0062] Figure 1 : Color development comparison between the 13q14.2 / 21q22.13 probe containing UNA and the 13q14.2 / 21q22.13 probe without UNA in the present application Figure 2 : Color development comparison between the CEP18 / CEPX / CEPY probe containing UNA and the CEP18 / CEPX / CEPY probe without UNA in the present application Figure 3 : Color development of the 13q14.2 / 21q22.13 containing UNA in the present application for trisomy 21 cells DETAILED DESCRIPTION OF THE INVENTION

[0063] The present invention will be described in detail below through examples, but this does not mean any adverse limitation to the present invention. The present invention has been described in detail herein, and its specific embodiments have also been disclosed. It will be obvious to those skilled in the art that various changes and improvements can be made to the specific embodiments of the present invention without departing from the spirit and scope of the present invention.

[0064] Preparation Example 1 Preparation of the 13q14.2 Probe Preparation method of 13q14.2 probe: (1) Download the BAC clone gene sequences RP11-1150C12, RP11-798D7 and RP11-795G6 corresponding to the 13q14.2 locus from UCSC Genome Browser.

[0065] (2) Use the perl plug-in program chunks.pl to split the sequences of RP11-1150C12, RP11-798D7 and RP11-795G6 obtained in step (1) into 1-kb blocks respectively and delete the repetitive sequences; batch import the split blocks into OligoArray software for probe design and probe screening, then export the screened probes to an EXCEL table, and add a 17-bp tag sequence to the 5' end and an 18-bp tag sequence to the 3' end of each probe respectively to obtain a series of probe sequences with tag sequences; the probe design and probe screening methods are that the probe length is 50-150 bp, the TM value is 85-99 °C, the GC ratio is 40-80%, it does not contain TTTT / GGGG / AAAA / CCCC, and the minimum interval between probes is 5 bp.

[0066] (3) Use a DNA synthesizer to chemically synthesize the gene probe sequences with tag sequences obtained in step (2) respectively, and mix the chemically synthesized probes at the same locus to prepare a 13q14.2 probe library; (4) Synthesize a universal primer with a green fluorescent group at the 5' end and use this universal primer to perform an amplification labeling reaction on the 13q14.2 probe library synthesized in step (3), wherein 5% of UNA triphosphate is added to the total molar amount of nucleotide raw materials in the amplification labeling reaction; the universal primer sequences are TGTAAAACGACGGCCAGT and CAGGAAACAGCTATGACC.

[0067] (5) Purify and dilute the amplification labeling product of the probe library obtained in step (4) to obtain a fluorescence-labeled 13q14.2 probe library.

[0068] Preparation Example 2 Preparation of 21q22.13 Probe Preparation method of 21q22.13 probe: (1) Download the BAC clone gene sequences RP11-980O13 and RP11-95G19 corresponding to the 21q22.13 locus from UCSC Genome Browser.

[0069] (2) The RP11-980O13 and RP11-95G19 obtained in step (1) are respectively segmented into 1-kb-sized blocks using the perl plug-in program chunks.pl and duplicate sequences are deleted; the segmented blocks are batch-imported into the OligoArray software for probe design and probe screening, and then the screened probes are exported to an EXCEL table. Then, a 17-bp tag sequence is added to the 5' end and an 18-bp tag sequence is added to the 3' end of each probe to obtain a series of probe sequences with tag sequences; the probe design and probe screening method is that the probe length is 50-150 bp, the TM value is 85-99 °C, the GC ratio is 40-80%, it does not contain TTTT / GGGG / AAAA / CCCC, and the minimum interval between probes is 5 bp.

[0070] (3) Use a DNA synthesizer to chemically synthesize the gene probe sequences with tag sequences obtained in step (2), and mix the chemically synthesized probes at the same locus to prepare a 21q22.13 probe library; (4) Synthesize a universal primer with a red fluorescent group at the 5' end and use this universal primer to perform an amplification labeling reaction on the 21q22.13 probe library synthesized in step (3), wherein 5% of UNA triphosphate is added to the total molar amount of nucleotide raw materials in the amplification labeling reaction; the universal primer sequences are TGTAAAACGACGGCCAGT and CAGGAAACAGCTATGACC.

[0071] (5) Purify and dilute the amplification labeling product of the probe library obtained in step (4) to obtain a fluorescently labeled 21q22.13 probe library.

[0072] Preparation Example 3 Preparation of CEP18 Probes Preparation method of CEP18 probes: (1) Export the sequence of SEQ No 1 to an EXCEL table, add a 17-bp tag sequence to the 5' end and an 18-bp tag sequence to the 3' end of the sequence to obtain a probe sequence with a tag sequence.

[0073] (2) Use a DNA synthesizer to chemically synthesize the gene probe sequences with tag sequences obtained in step (1), and mix the chemically synthesized probes at the same locus to prepare a CEP18 probe library; (3) Synthesize a universal primer with a cyan fluorescent group at the 5' end and use this universal primer to perform an amplification labeling reaction on the CEP18 probe library synthesized in step (2), wherein 5% of UNA triphosphate is added to the total molar amount of nucleotide raw materials in the amplification labeling reaction; the universal primer sequences are TGTAAAACGACGGCCAGT and CAGGAAACAGCTATGACC.

[0074] (4) Purify and dilute the amplified and labeled product of the probe library obtained in step (3) to obtain a fluorescently labeled CEP18 probe library.

[0075] Preparation Example 4: Preparation of CEPX Probe Preparation method of CEPX probe: (1) Export the sequence of SEQ No 2 to an EXCEL spreadsheet, add a 17bp tag sequence to the 5' end of the sequence and an 18bp tag sequence to the 3' end to obtain a probe sequence with tag sequences.

[0076] (2) Chemically synthesize the gene probe sequence with tag sequences obtained in step (1) using a DNA synthesizer, and mix the chemically synthesized probes at the same locus to prepare a CEPX probe library; (3) Synthesize a universal primer with a green fluorescent group at the 5' end and use this universal primer to perform an amplification and labeling reaction on the CEPX probe library synthesized in step (2), wherein 8% of the total molar amount of nucleotide raw materials is added with UNA triphosphate in the amplification and labeling reaction; the universal primer sequences are TGTAAAACGACGGCCAGT and CAGGAAACAGCTATGACC.

[0077] (4) Purify and dilute the amplified and labeled product of the probe library obtained in step (3) to obtain a fluorescently labeled CEPX probe library.

[0078] Preparation Example 5: Preparation of CEPY Probe Preparation method of CEPY probe: (1) Export the sequence of SEQ No 3 to an EXCEL spreadsheet, add a 17bp tag sequence to the 5' end of the sequence and an 18bp tag sequence to the 3' end to obtain a probe sequence with tag sequences.

[0079] (2) Chemically synthesize the gene probe sequence with tag sequences obtained in step (1) using a DNA synthesizer, and mix the chemically synthesized probes at the same locus to prepare a CEPY probe library; (3) Synthesize a universal primer with a red fluorescent group at the 5' end and use this universal primer to perform an amplification and labeling reaction on the CEPY probe library synthesized in step (2), wherein 10% of the total molar amount of nucleotide raw materials is added with UNA triphosphate in the amplification and labeling reaction; the universal primer sequences are TGTAAAACGACGGCCAGT and CAGGAAACAGCTATGACC.

[0080] (4) Purify and dilute the amplified and labeled product of the probe library obtained in step (3) to obtain a fluorescently labeled CEPY probe library.

[0081] Example 1 Preparation of 13q14.2 / 21q22.13 Dual-color Probe Preparation method of 13q14.2 / 21q22.13 dual-color probe: Mix the 13q14.2 probe and 21q22.13 probe prepared in the preparation example at equal concentrations, and the concentration of both probes is 30 ng / μL.

[0082] Example 2 Preparation of CEP18 / CEPX / CEPY Triple-color Probe Preparation method of CEP18 / CEPX / CEPY triple-color probe: Mix the CEP18 probe, CEPX probe and CEPY probe prepared in the preparation example at equal concentrations, and the probe concentration is 50 ng / μL.

[0083] Comparative Example 1 Preparation of 13q14.2 / 21q22.13 Probe without UNA Part 1: Preparation method of 13q14.2 probe without UNA: (1) Download the BAC clone gene sequences RP11-1150C12, RP11-798D7 and RP11-795G6 corresponding to the 13q14.2 locus from the UCSC Genome Browser.

[0084] (2) Use the perl plug-in program chunks.pl to split the sequences of RP11-1150C12, RP11-798D7 and RP11-795G6 obtained in step (1) into 1-kb blocks and delete the repeated sequences; Batch import the split blocks into the OligoArray software for probe design and probe screening, then export the screened probes to an EXCEL table, and add a 17-bp tag sequence to the 5' end and an 18-bp tag sequence to the 3' end of each probe to obtain a series of probe sequences with tag sequences; The probe design and probe screening methods are that the probe length is 50-150 bp, the TM value is 85-99 °C, the GC ratio is 40-80%, it does not contain TTTT / GGGG / AAAA / CCCC, and the minimum interval between probes is 5 bp.

[0085] (3) Use a DNA synthesizer to chemically synthesize the gene probe sequences with tag sequences obtained in step (2) respectively, and mix the chemically synthesized probes at the same locus to prepare a 13q14.2 probe library; (4) Synthesize a universal primer with a green fluorescent group at the 5' end and use this universal primer to perform an amplification labeling reaction on the 13q14.2 probe library synthesized in step (3). The universal primer sequences are TGTAAAACGACGGCCAGT and CAGGAAACAGCTATGACC.

[0086] (5) Purify and dilute the amplification labeling product of the probe library obtained in step (4) to obtain a fluorescently labeled 13q14.2 probe library.

[0087] Part Two: Preparation method of 21q22.13 probe without UNA: Preparation method of 21q22.13 probe: (1) Download the BAC clone gene sequences RP11-980O13 and RP11-95G19 corresponding to the 21q22.13 locus from the UCSC Genome Browser.

[0088] (2) Use the perl plug-in program chunks.pl to split the RP11-980O13 and RP11-95G19 sequences obtained in step (1) into 1 kb-sized blocks respectively and delete the repetitive sequences; batch import the split blocks into the OligoArray software for probe design and probe screening, then export the screened probes to an EXCEL spreadsheet, and add a 17 bp tag sequence to the 5' end and an 18 bp tag sequence to the 3' end of each probe respectively to obtain a series of probe sequences with tag sequences; the probe design and probe screening methods are that the probe length is 50 - 150 bp, the TM value is 85 - 99 °C, the GC ratio is 40 - 80%, it does not contain TTTT / GGGG / AAAA / CCCC, and the minimum interval between probes is 5 bp.

[0089] (3) Use a DNA synthesizer to chemically synthesize the gene probe sequences with tag sequences obtained in step (2) respectively, and mix the chemically synthesized probes at the same locus to prepare a 21q22.13 probe library; (4) Synthesize a universal primer with a red fluorescent group at the 5' end and use this universal primer to perform an amplification labeling reaction on the 21q22.13 probe library synthesized in step (3). The universal primer sequences are TGTAAAACGACGGCCAGT and CAGGAAACAGCTATGACC.

[0090] (5) Purify and dilute the amplification labeling product of the probe library obtained in step (4) to obtain a fluorescently labeled 21q22.13 probe library.

[0091] The UNA-free 13q14.2 probe prepared in Part 1 and the UNA-free 21q22.13 probe prepared in Part 2 were mixed at equal concentrations, and the concentration of both probes was 30 ng / μL.

[0092] Preparation of CEP18 / CEPX / CEPY Probes without UNA in Comparative Example 2 The preparation method of the UNA-free CEP18 probe differed from that of Preparation Example 3 only in that UNA was not added during the PCR amplification process; the preparation method of the UNA-free CEPX probe differed from that of Preparation Example 4 only in that UNA was not added during the PCR amplification process; the preparation method of the UNA-free CEPY probe differed from that of Preparation Example 5 only in that UNA was not added during the PCR amplification process; the above three UNA-free probes were mixed at equal concentrations, and the concentration of each probe was 50 ng / μL.

[0093] Test Example 1 Color Development Comparison between the 13q14.2 / 21q22.13 Probe Containing UNA and the 13q14.2 / 21q22.13 Probe without UNA in the Present Application I. Test Method: (1) Sample treatment: After dropping the cells collected by fixing the amniocentesis sample on a slide, the sample was placed in a container containing 2×SSC, heated in a microwave oven at high power for 3 min until the liquid boiled, and then continued to be heated at medium-low power for 10 min. After the treatment was completed, the slide was immediately dehydrated and air-dried in gradient alcohol pre-cooled at -20°C, and the sample was divided into two parts, No. 1 and No. 2, for standby; (2) Preparation of probe hybridization mixture: The fluorescently labeled 13q14.2 / 21q22.13 probe composition prepared in Example 1 and the hybridization buffer were mixed at a volume ratio of 1:9; (3) Preparation of control probe hybridization mixture: The UNA-free fluorescently labeled 13q14.2 / 21q22.13 probe composition prepared in Comparative Example 1 and the hybridization buffer were respectively mixed at a volume ratio of 1:9; (4) Probe-sample co-denaturation: The No. 1 sample was hybridized and mixed with 10 μL of the 13q14.2 / 21q22.13 probe hybridization mixture in step (2), and the No. 2 sample was hybridized and mixed with 10 μL of the UNA-free fluorescently labeled 13q14.2 / 21q22.13 probe hybridization mixture in step (3). Coverslips of 22×22 mm were respectively used to cover the samples, and rubber glue was used to seal the slides. After sealing, the slides were placed in a hybridization instrument and denatured at 90°C for 1 min and hybridized at 37°C for 30 - 60 min; (5) Post-hybridization washing: After the hybridization was completed, the coverslip was removed, and the slide was placed in a pre-warmed washing solution at 60°C to wash away the unbound probes; (6) Counterstaining and microscopic examination: Add 10 μL of anti-quenching mounting medium to the air-dried slide for mounting, and then observe the hybridization results under a fluorescence microscope respectively.

[0094] II. Experimental results are as shown in the appendix Figure 1 as follows Figure 1 (a) shows the color development results of the 13q14.2 / 21q22.13 probe composition of the present application for normal cells, Figure 1 (b) shows the color development results of the 13q14.2 / 21q22.13 probe composition in Comparative Example 1 for normal cells.

[0095] III. Experimental conclusions The 13q14.2 / 21q22.13 probe is used to detect whether there are abnormalities in chromosome 13 and chromosome 21. For normal cells, both the probe composition of the present application and the probe composition of Comparative Example 1 show detection signals of two red and two green, indicating that both the probe composition of the present application and the probe composition of Comparative Example 1 are normal and reliable. According to Figure 1 (a) and Figure 1 (b), through signal comparison and analysis, it can be known that the detection signal of the probe composition of the present application is clear and bright, and the background is clean, while the detection signal of the probe composition of Comparative Example 1 is scattered and unfocused, and there is background noise. The reason for the analysis is that the probe composition of the present application has strong specificity, strong binding to the target region, and is not easily dissociated after binding, while the probe composition of Comparative Example 1 has weak binding force to the target, dissociates easily after binding, and thus the signal is scattered and not concentrated.

[0096] Test Example 2 Color development comparison between the CEP18 / CEPX / CEPY probe containing UNA and the CEP18 / CEPX / CEPY probe without UNA of the present application I. Test method: (1) Sample treatment: After dropping the cells collected by fixing the amniocentesis sample on a slide, place the sample in a container containing 2×SSC, heat it in a microwave oven at high power for 3 min until the liquid boils, and then continue to heat it at medium and low power for 10 min. After the treatment is completed, immediately place the slide in gradient alcohol pre-cooled at -20°C for dehydration and air-drying. Divide the sample into two parts, No. 1-2, for standby; (2) Preparation of probe hybridization mixture: Mix the fluorescently labeled CEP18 / CEPX / CEPY probe composition prepared in Example 2 and the hybridization buffer in a volume ratio of 1:9; (3) Preparation of control probe hybridization mixture: Mix the fluorescently labeled CEP18 / CEPX / CEPY probe composition without UNA prepared in Comparative Example 2 and the hybridization buffer in a volume ratio of 1:9 respectively; (4) Probe sample co-variation: Sample No. 1 is hybridized and mixed with 10 μL of the CEP18 / CEPX / CEPY probe hybridization mixture in step (2), and sample No. 2 is hybridized and mixed with 10 μL of the fluorescence-labeled CEP18 / CEPX / CEPY probe hybridization mixture without UNA in step (3). A 22×22 mm cover glass is used to cover the samples respectively, and rubber cement is used to seal the slides. After sealing, the slides are placed in a hybridization instrument and denatured at 90 °C for 1 min, and hybridized at 37 °C for 30 - 60 min; (5) Post-hybridization washing: After hybridization is completed, the cover glass is removed, and the slides are placed in a pre-warmed washing solution at 60 °C to wash away the unbound probes; (6) Counterstaining and microscopy: 10 μL of anti-quenching mounting medium is added dropwise to the air-dried slides for sealing, and then the hybridization results are observed under a fluorescence microscope respectively.

[0097] II. Experimental results are as attached Figure 2 as shown Figure 2 (a) shows the color development results of the CEP18 / CEPX / CEPY probe composition of the present application for normal cells, Figure 2 (b) shows the color development results of the CEP18 / CEPX / CEPY probe composition in Comparative Example 2 for normal cells.

[0098] III. Experimental conclusions The CEP18 / CEPX / CEPY probe composition is used to detect whether there are abnormalities in chromosome 18, chromosome X, and chromosome Y. For normal cells, both the probe composition of the present application and the probe composition of Comparative Example 1 show detection signals of two blues, one red, and one green, indicating that both the probe composition of the present application and the probe composition of Comparative Example 2 are normal and reliable. According to Figure 2 (a) and Figure 2 (b), through signal comparison and analysis, it can be known that the detection signal of the probe composition of the present application is clear and bright, and the background is clean, while the detection signal of the probe composition of Comparative Example 2 is scattered and unfocused, and there is background noise. The reason for the analysis is that the probe composition of the present application has strong specificity, strong binding to the target region, and is not easily dissociated after binding, while the probe composition of Comparative Example 2 has weak binding force to the target, is easily dissociated after binding, and thus the signal is scattered and not concentrated.

[0099] Test Example 3 Color development of the 13q14.2 / 21q22.13 probe of the present application for trisomy 21 cells I. Test method: (1) Sample treatment: The drop-slide sample of trisomy 21 cells is placed in a container containing 2×SSC, heated in a microwave oven at high power for 3 min until the liquid boils, and then continued to be heated at medium-low power for 10 min. After the treatment is completed, the slides are immediately placed in gradient alcohol pre-cooled at -20 °C for dehydration and air-drying, and reserved; (2) Preparation of the probe hybridization mixture: Mix the fluorescently labeled 13q14.2 / 21q22.13 probe composition prepared in Example 1 and the hybridization buffer in a volume ratio of 1:9; (3) Co-denaturation of the probe sample: Hybridize and mix the sample with 10 μL of the 13q14.2 / 21q22.13 probe hybridization mixture in step (2), cover with a 22×22 mm coverslip, seal the slide with rubber cement, and place the slide in a hybridization instrument for denaturation at 90 °C for 1 min and hybridization at 37 °C for 30 - 60 min; (4) Post-hybridization washing: After hybridization is completed, remove the coverslip, and place the slide in a pre-warmed washing solution at 60 °C to wash away the unbound probes; (5) Counterstaining and microscopy: Drop 10 μL of anti-quenching mounting medium on the air-dried slide to seal the slide, and then observe the hybridization results under a fluorescence microscope respectively.

[0100] II. Experimental results are as shown in the Figure 3 appendix III. Experimental conclusion Using the 13q14.2 / 21q22.13 probe of the present application to detect trisomy 21 cells, the color development result is clear and bright, the background noise is low, and it clearly shows the presence of trisomy of chromosome 21 in the cells. The probe composition prepared by the preparation method of the present application has strong specificity and strong binding to the target chromosome. Therefore, the background of the color development result is clean, the edges of the signal points are clear, and the signals are bright, making the diagnosis result of trisomy 21 syndrome using the probe composition of the present application easy to analyze, accurate and reliable, and reducing missed diagnosis and misdiagnosis.

[0101] The above are all preferred embodiments of the present application. Without limiting the protection scope of the present application accordingly, therefore: All equivalent changes made according to the structure, shape, and principle of the present application should be covered within the protection scope of the present application.

Claims

1. A preparation method of a probe for prenatal diagnosis, characterized in that, Comprising the following steps, (1) Download the BAC clone gene sequences corresponding to the following gene loci from the UCSC Genome Browser, 13q14.2: RP11-1150C12, RP11-798D7, RP11-795G6; 21q22.13: RP11-980O13, RP11-95G19; (2) Use the perl plug-in program chunks.pl to split the BAC clone gene sequences corresponding to each locus obtained in step (1) into 1-kb-sized blocks and remove duplicate sequences; batch import the split blocks into the OligoArray software for probe design and probe screening, and then export the screened probes and SEQ No 1, SEQ No 2, and SEQ No 3 to an EXCEL spreadsheet. Then, add a 17-bp tag sequence to the 5' end and an 18-bp tag sequence to the 3' end of each probe to obtain a series of probe sequences with tag sequences. The SEQ No 1 is the centromeric region gene sequence corresponding to CEP18, the SEQ No 2 is the centromeric region gene sequence corresponding to CEPX, and the SEQ No 3 is the centromeric region gene sequence corresponding to CEPY; (3) Use a DNA synthesizer to chemically synthesize the gene probe sequences with tag sequences obtained in step (2), and mix the chemically synthesized probes at the same locus to prepare probe libraries for each locus respectively; (4) Chemically synthesize a universal primer with a green fluorescent group at the 5' end, a universal primer with a red fluorescent group at the 5' end, and a universal primer with a cyan fluorescent group at the 5' end, and use the universal primers of different colors to perform amplification labeling reactions on the probes at different loci. Approximately 5% to approximately 10% of the total molar amount of nucleotide raw materials is optionally added as UNA triphosphate in the amplification labeling reaction; (5) Purify and dilute the amplification labeling products of the probe libraries obtained in step (4) to obtain a fluorescence-labeled probe library.

2. The preparation method according to claim 1, wherein, The 17-bp tag sequence in step (2) is TGTAAAACGACGGCCAG, and the 18-bp tag sequence is GGTCATAGCTGTTTCCTG.

3. The preparation method according to claim 1, wherein The probe screening conditions in step (2) are: probe length 50-150 bp, TM value 85-99 °C, GC ratio 40-80%, without TTTT / GGGG / AAAA / CCCC, and the minimum interval between probes is 5 bp.

4. The preparation method according to claim 1, wherein, The universal primer sequences in step (4) are TGTAAAACGACGGCCAGT and CAGGAAACAGCTATGACC.

5. The preparation method according to claim 1, wherein The polymerase used in the amplification labeling reaction is Therminator DNA polymerase.

6. The preparation method according to claim 1, wherein Wherein the UNA triphosphate is selected from UNA-A triphosphate, UNA-T triphosphate, UNA-G triphosphate and UNA-C triphosphate, and preferably the molar mass ratio of UNA-A triphosphate, UNA-T triphosphate, UNA-G triphosphate and UNA-C triphosphate is 1:1:1:

1.

7. The preparation method according to claim 1, characterized in that, The 13q14.2 probe is labeled with a green fluorescent group, the 21q22.13 probe is labeled with a red fluorescent group, the CEPY probe is labeled with a red fluorescent group, the CEPX probe is labeled with a green fluorescent group, and the CEP18 probe is labeled with a cyan fluorescent group.

8. A probe composition prepared by the preparation method according to any one of claims 1-7.

9. A kit, the kit comprising: (1) A mixture of the probe composition according to claim 8 and a hybridization buffer; (2) A DAPI counterstain.

10. Use of the probe composition according to claim 8 or the kit according to claim 9 in the preparation of a prenatal diagnosis product.

Images