Preparation method and application of probe for diagnosing multiple myeloma

Through the grading method and UNA-incorporated probe preparation method, the problem of long detection cycle and high cost of multiple myeloma is solved, and the sample usage and detection cost are reduced, which improves detection accuracy and efficiency.

CN120350118APending Publication Date: 2025-07-22WUHAN HEALTHCHART BIOLOGICAL TECH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410079003.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-01-19
Publication Date
2025-07-22

AI Technical Summary

Technical Problem

The existing multiple myeloma detection methods have problems such as long detection cycle, low efficiency, complex operation and high cost. In particular, FISH technology requires multiple sets of probes, resulting in large sample demand and heavy patient burden.

Method used

The probe was prepared by franchise method. First, if there is a break in the IGH gene, it will be tested further when positive, and if negative, it will be stopped. During the probe preparation process, a small amount of open ring nucleotides (UNA) were incorporated to improve the specificity and stability of the probe, and the probe was amplified and labeled by PCR to reduce primer design work.

Benefits of technology

The sample usage and detection cost for patients with negative IGH rearrangement probes are reduced, background noise is reduced, detection accuracy and efficiency is improved, and result analysis is simplified.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0004672418950000011
    Figure HDA0004672418950000011
  • Figure HDA0004672418950000012
    Figure HDA0004672418950000012
  • Figure HDA0004672418950000021
    Figure HDA0004672418950000021
Patent Text Reader

Abstract

The invention relates to the field of molecular biology, in particular to a preparation method and application of a probe for diagnosing multiple myeloma, firstly, IGH gene breakage detection is carried out through a grading method, IGH and other gene fusion detection is further carried out on positive patients, IGH gene fusion detection can not be carried out on negative patients any more, and the detection result is more accurate. Therefore, the sample usage amount and the detection cost of part of patients can be reduced; secondly, a small amount of open-loop nucleotide (UNA) is doped in the preparation process of the probe, so that the specificity of the probe is improved, the background noise is reduced, and the result analysis is simplified.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the field of molecular biology, and particularly to a preparation method and application of a probe for diagnosing multiple myeloma. Background Art

[0002] Multiple myeloma (MM) is a malignant disease characterized by abnormal proliferation of clonal plasma cells. It is the second most common malignant tumor in the hematological system, accounting for about 10% of hematological malignancies. It mostly occurs in the elderly over 60 years old, with a relatively high incidence. In recent years, with the continuous development of population aging, its incidence has shown an increasing trend year by year. The onset is often insidious, and the early symptoms of patients are diverse and non-specific, which is prone to clinical misdiagnosis and missed diagnosis, and clinical treatment is difficult. At present, it is still incurable, and clinical treatment mainly relies on chemotherapy, which can prolong the survival time of patients, but the incidence of drug resistance is relatively high or it is easy to relapse after the disease remission.

[0003] Common symptoms of MM include manifestations of myeloma-related organ function damage, namely the "CRAB" symptoms (increased blood calcium, renal function damage, anemia, bone disease, specific indicators can be seen in the diagnostic criteria), and related manifestations of target organ damage such as amyloidosis. The malignant proliferation of plasma cells in the bone marrow leads to hematopoietic insufficiency and osteolytic bone disease. The proliferated plasma cells secrete monoclonal immunoglobulin excessively, causing multi-system damage such as related kidneys and hearts. Due to multi-system involvement and limited treatment methods, the prognosis of early MM is poor, and the median survival period is only 3 - 5 years. In the past 10 years, with the research progress of new treatment drugs and the development of autologous hematopoietic stem cells, the prognosis of MM has been significantly improved, and the current median survival period can reach 6 years, but it is still one of the incurable tumors.

[0004] The pathogenesis of MM is not yet clear, but with the progress of genetic testing technology, it has been found that almost all myelomas have some cytogenetic abnormalities. The main molecular genetic abnormalities are: chromosome ploidy abnormalities, deletion of 17p13, amplification of 1q, deletion of 1p, deletion of 13q and monosomy of chromosome 13, and translocations related to the immunoglobulin heavy chain gene (IGH).

[0005] MM is a group of diseases with significant heterogeneity in biological behaviors and clinical manifestations. Accurate prognostic assessment and risk stratification are crucial for the precise treatment of MM. The prognostic factors available for evaluation in MM patients include host factors, biological characteristics of MM, treatment response, etc. A single factor is often not sufficient to accurately assess the prognosis. Cytogenetic characteristics are one of the key factors determining the prognosis of MM. The mSMART stratification system proposes treatment based on risk stratification and is widely used. Among them, high-risk factors include: t(4;14), t(14;16), t(14;20), del(17p), p53 mutation, 1q amplification, etc., and standard-risk factors include: trisomy, t(11;14), t(6;14). The 2023.V1 NCCN guidelines for multiple myeloma state that bone marrow examination in the initial diagnosis should include metaphase cytogenetic analysis and FISH testing of plasma cells obtained by bone marrow aspiration. FISH probe testing includes: del(13), del(17p13), t(4;14), t(11;14), t(14;16), t(14;20), 1q21 gain / 1q amplification, 1p deletion.

[0006] The existing MM detection methods mainly rely on cytogenetic detection techniques, including chromosome karyotype analysis and fluorescence in situ hybridization (FISH). Chromosome karyotype analysis is a process of pairing, numbering, grouping, and morphological analysis of the chromosomes of the cells to be tested according to the inherent morphological and structural characteristics of the chromosomes of that organism and certain regulations. Human chromosomes are stained homogeneously with Giemsa dye. After different treatments such as denaturation or enzymatic digestion, the chromosomes can be re-stained to show a series of alternating light and dark band patterns, which are called chromosome banding patterns. Banding techniques are used to stain different regions of chromosomes through special staining methods, making the chromosomes show alternating light and dark band patterns under a light microscope. Each chromosome has specific banding patterns, and even the long and short arms of each chromosome are specific. According to the different banding patterns of chromosomes, the individuality of chromosomes can be identified more precisely and reliably. If there are changes in the specific banding patterns of chromosomes, it indicates that the structure of the chromosome has changed. However, this technique has disadvantages such as low success rate of plasma cell culture, long detection cycle limited by cell culture time (usually 2-3 weeks), low detection efficiency, and complex operation steps. Fluorescence in situ hybridization (FISH) is a technique in which a nucleotide of a nucleic acid probe is labeled with a fluorescent dye. The target gene to be detected is homologous and complementary to the nucleic acid probe used. After denaturation, annealing, and renaturation, a hybrid of the target gene and the nucleic acid probe can be formed, and the target gene can be qualitatively, quantitatively, or relatively localized analyzed under a microscope through a fluorescence detection system. Using a set of probes targeting common abnormalities in MM for fluorescence in situ hybridization detection can improve the detection rate of cytogenetic abnormalities in some MM patients. Limitations of the FISH technique: There are many types of abnormalities in MM patients. Currently, conventional FISH techniques require a large number of cell samples because they need to detect 10 sets of probes (p53 / CEP17, RB1 / 13q34, D13S319 / 13q34, 1p32 / 1q21, IGH rearrangement probe, CCND1 / IGH, CCND3 / IGH, FGFR3 / IGH, MAF / IGH, MAFB / IGH), resulting in high costs for patients. The detection samples are from the patient's bone marrow samples, and a large amount of bone marrow needs to be extracted. Summary of the Invention

[0007] To solve at least one of the above technical problems, a method for preparing a probe for diagnosing multiple myeloma and its application are developed.

[0008] In a first aspect of the present application, a method for preparing a probe for diagnosing multiple myeloma is provided, including the following steps: (1) Download the BAC clone gene sequences corresponding to the following probes from the UCSC Genome Browser. The probes include one or more of the following combinations, and the gene sequences include P53 / CEP17, RB1 / D13S319 / 13q34, 1p32 / 1q21, IGH split probe, CCND1 / IGH, CCND3 / IGH, FRFG3 / IGH, MAF / IGH, and MAFB / IGH; (2) Use the perl plug-in program chunks.pl to split the BAC clone gene sequences corresponding to each locus obtained in step (1) into 1-kb blocks and remove duplicate sequences; batch import the split blocks into the OligoArray software for probe design and probe screening, then export the screened probes to an EXCEL table, and add a 17-bp tag sequence to the 5' end and an 18-bp tag sequence to the 3' end of each probe to obtain a series of probe sequences with tag sequences; (3) Use a DNA synthesizer to chemically synthesize the gene probe sequences with tag sequences obtained in step (2), mix the chemically synthesized probes at the same locus, and prepare probe libraries for each locus respectively; (4) Chemically synthesize a universal primer with a green fluorescent group at the 5' end, a universal primer with a red fluorescent group at the 5' end, and a universal primer with a cyan fluorescent group at the 5' end, and use the universal primers of different colors to perform amplification labeling reactions on the probes at different loci. Approximately 5% to approximately 10% of UNA triphosphate of the total amount of nucleotide raw materials is optionally added in the amplification labeling reaction; (5) Purify and dilute the amplification labeling products of the probe libraries obtained in step (4) to obtain a fluorescently labeled probe library.

[0009] In a preferred embodiment of the present application, the UNA triphosphate is selected from UNA-A triphosphate, UNA-U triphosphate, UNA-G triphosphate, and UNA-C triphosphate.

[0010] In a preferred embodiment of the present application, the molar mass ratio of UNA-A triphosphate, UNA-U triphosphate, UNA-G triphosphate, and UNA-C triphosphate is 1:1:1:1.

[0011] By adopting the above technical solution, the screening of probes in the probe preparation method mainly depends on a program, and the more stable PCR method is used for amplifying and labeling the probes. The probe labeling rate is higher and more uniform. Only fluorescent labeling is performed at the 5' end of the probe, so it does not affect the hybridization pairing reaction of the probe. During the amplification and labeling reaction, about 5% to about 10% of UNA triphosphate is added to the substrate in the total amount of nucleotide raw materials, so that the obtained probe sequence incorporates ring-opened nucleotides. Ring-opened nucleotides can change the conformation of the original sequence. The incorporation of a small amount of ring-opened nucleotides enhances the specificity while maintaining the affinity of the probe for the target, reduces the background noise, and at the same time enhances the stability of the probe.

[0012] In a preferred embodiment of the present application, the BAC gene of P53 in the above P53 / CEP17 probe is selected from RP11-1081A10 and RP11-107F4, and the CEP17 probe sequence is as shown in SEQ No 1, SEQ No 1: TGAACATTCCTATTGATAGAGCAGTTTGGAAACACTCTTGTTGTGGAATGTGCAAGTGG AGATTTGGAGCGCTTTGAGGCCTATGGTAGTAAAGGGAATAGCTTCATAGAAAAACTAG ACAGAAGCATTCTCAGAAAATACTTTGTGATGATTGAGTTTAACTCACAGAGCTGAACA TTCCTTTGGATGGAGCAGGTTTGAGACACTCTTTTTGTACAATCTACAAGTGGATATTTG GACCTCTCTGAGGATTTCGTTGGAAACGGGATAACTGCACCTAACTAAACGGAAGCATT CTCAGAAACTTCTTGGTGATGTTTGCATTCAAATCCCAGAGTTGAACCTTCCTTTGATAG TTCAGGTTTGAAACACTCTTTTTGTAGGATCTGCAAGTGGATATTTGGACCACTCTGTGG CCTTCGTTCGAAACGGGTATATCTTCGCATAAAATCTAGACAGAAGCCTTCTCAGAAACT TCTCTGTGATGATTGCATTCAACTCACAGAGTTGAACCCTCCTATGGATAGAGCAGTGTT GAAACTCTCTTTTTGTGGAATCTGCAAGTGGATATGTGGACCTCTCCGAAGATGTCTTTG GAAACGGGAATATCTTCACATAAAAACTAAACAGAAGCATTCTCAGAAACTTCTCTGTG ATGTTTGTGTTCAACTCCCAGAGTTTCACATTGCTTTTCATAGAGTAGTTCTGAAACATG CTTTTCGTAGTGTCTACAAGTGGACATTTGGAGCGCTTTCAGGCCTGTGGTGGAAAACGAATTATGGTCACATAAAAACTGGAG; In the RB1 / D13S319 / 13q34 probe, the BAC gene of RB1 is selected from RP11-153K13, the BAC gene of D13S319 is selected from RP11-893E5, and the BAC gene of 13q34 is selected from RP11-139P6 and RP11-708D5; The BAC gene of the 1p32 probe is selected from RP11-691B6; The BAC genes of the 1q21 probe are selected from RP11-780O9 and RP11-93K11; The IGH split probe is divided into a pericentromeric region and a telomeric proximal region. The BAC genes of the pericentromeric region are selected from RP11-878E14 and RP11-346I20, and the BAC genes of the telomeric proximal region are selected from RP11-112H5, RP11-101G24 and RP11-1145H5; In the CCND1 / IGH probe, the BAC gene of CCND1 is selected from RP11-378E8, RP11-643C9 and RP11-156B3, and the BAC gene of IGH is selected from RP11-346I20, RP11-815P21, RP11-1065N8 and RP11-5F6; In the CCND3 / IGH probe, the BAC gene of CCND3 is selected from RP11-25I3, RP11-97H9 and RP11-978D8, and the BAC gene of IGH is selected from RP11-346I20, RP11-815P21, RP11-1065N8 and RP11-5F6; In the FRFG3 / IGH probe, the BAC gene of FRFG3 is selected from RP11-875G10 and RP11-709N10, and the BAC gene of IGH is selected from RP11-346I20, RP11-815P21, RP11-1065N8 and RP11-5F6; In the MAF / IGH probe, the BAC gene of MAF is selected from RP11-231B20, RP11-1062G14, RP11-485J23 and RP11-947E16, and the BAC gene of IGH is selected from RP11-346I20, RP11-815P21, RP11-1065N8 and RP11-5F6; In the MAFB / IGH probe, the BAC gene of MAFB is selected from RP11-91F2, RP11-588F9, RP11-705H7 and RP11-458K19, and the BAC gene of IGH is selected from RP11-346I20, RP11-815P21, RP11-1065N8 and RP11-5F6.

[0013] With the above technical solutions, the corresponding relationship between the above BAC clones and the probes is clear, the length is appropriate, and gene sequencing has determined their clear gene sequences. Using the above BAC clones, probes can be designed by a program, and the probes can be amplified by PCR. The above probes include the following probe combinations: del(17p13) / P53 / CEP17, del(13q14) / RB1 / D13S319 / 13q34, del(1p32), amp(1q21), IGH splitting probe, t(11;14) / CCND1-IGH, t(6;14) / CCND3-IGH, t(4;14) / FRFG3-IGH, t(16;14) / MAF-IGH and t(20;14) / MAFB-IGH. The types of probes are rich, and various gene mutation types of multiple myeloma can be detected, which can improve the detection rate and accuracy.

[0014] In the preferred embodiment of the present application, the 17bp tag sequence in step (2) is TGTAAAACGACGGCCAG, and the 18bp tag sequence is GGTCATAGCTGTTTCCTG.

[0015] Adding tag sequences at both ends of the probe can facilitate PCR amplification using universal primers, greatly reducing the design and screening work of primers, enabling the above-mentioned probe amplification by PCR. The above tag sequences are carefully designed and screened by the applicant and have been verified to be able to be used for the amplification of probe sequences corresponding to multiple target genes.

[0016] In a preferred embodiment of the present application, the probe screening conditions in step (2) are as follows: the probe length is 50 - 150 bp, the TM value is 85 - 99 °C, the GC ratio is 40 - 80%, it does not contain TTTT / GGGG / AAAA / CCCC, and the minimum interval between probes is 5 bp.

[0017] The above parameters for probe screening can be adjusted according to specific experimental purposes and requirements. Among them, the probe length of 50 - 150 bp is to ensure that the probe length is within a suitable range, neither too short to reduce specificity nor too long to increase synthesis costs. The TM value of 85 - 99 °C is to ensure that the melting temperature (Tm) of the probe is within a suitable range to guarantee the specificity and stability of the probe in the experiment. The GC ratio of 40 - 80% is to ensure that the GC content of the probe is within a suitable range to guarantee the stability and specificity of the probe. The absence of TTTT / GGGG / AAAA / CCCC is to avoid the occurrence of repetitive sequences in the probe, thereby reducing the possibility of non-specific binding.

[0018] In a preferred embodiment of the present application, the universal primer sequences in step (4) are TGTAAAACGACGGCCAGT and CAGGAAACAGCTATGACC.

[0019] Using the above universal primers, each probe sequence can be specifically recognized and efficiently amplified to obtain a probe library suitable for FISH detection.

[0020] In a preferred embodiment of the present application, the polymerase used in the amplification labeling reaction is Therminator DNA polymerase.

[0021] Therminator DNA polymerase is a DNA polymerase widely used in molecular biology experiments, which has the characteristics of high fidelity, high stability and high efficiency. Therefore, it is widely used in experiments such as DNA replication, PCR amplification, and gene cloning. Therminator DNA polymerase can simultaneously recognize natural deoxynucleoside triphosphate substrates and UNA triphosphate substrates and perform high-fidelity PCR amplification. By using the above polymerase and adding a certain amount of 5% - 10% UNA triphosphate substrate to the reaction substrate, a probe sequence incorporating a small amount of open-ring nucleotides can be obtained.

[0022] In a preferred embodiment of the present application, in the p53 / CEP17 probe, the p53 probe is labeled with a red fluorescent group, and the CEP17 probe is labeled with a green fluorescent group.

[0023] p53 is a gene sequence on chromosome 17. The above-mentioned probe can be used to detect the gene deletion of del(17q13) in multiple myeloma. The CEP17 probe is used to detect the centromeric region of chromosome 17. The above-mentioned centromeric region probe can be used to detect chromosomal abnormalities of chromosome 17. At the same time, the CEP17 probe can also be used as an internal reference for the p53 probe to verify the effectiveness of the probe composition.

[0024] In a preferred embodiment of the present application, among the RB1 / D13S319 / 13q34 triple-color probes, the D13S319 probe is labeled with a red fluorescent group, the RB1 probe is labeled with a green fluorescent group, and the 13q34 probe is labeled with a cyan fluorescent group.

[0025] RB1, D13S319, and 13q34 are all related genes on chromosome 13. Taking the above three probes as a combination can improve the detection rate of gene deletion related to chromosome 13, and they can be used as internal references for each other to verify the effectiveness of the probe composition.

[0026] In a preferred embodiment of the present application, the 1p32 probe is labeled with a red fluorescent group, and the 1q21 probe is labeled with a green fluorescent group.

[0027] The 1p32 probe is used to detect the deletion of related genes on the short arm of chromosome 1, and the 1q21 probe is used to detect the amplification of related genes on the long arm of chromosome 1. As a combination, they can be used as internal references for each other.

[0028] In the IGH rearrangement probe, the pericentromeric region of IGH is labeled with a red fluorescent group, and the telomeric proximal region of IGH is labeled with a green fluorescent group.

[0029] IGH gene breakage in multiple myeloma is a common molecular genetic abnormality. Approximately 50%-60% of patients with multiple myeloma have this abnormality. This abnormality is usually closely related to the prognosis of the disease and is considered one of the independent prognostic factors for multiple myeloma. Therefore, setting the IGH rearrangement probe in the probe composition has clinical significance for the diagnosis of multiple myeloma.

[0030] The present application adopts a hierarchical detection method. First, the IGH rearrangement probe is used to detect whether there is a break in the IGH gene. When the detection result of this probe shows a positive result, then the fusion probe composed of the following IGH probe and other genes is used for further detection. If the detection result shows a negative result, no further detection is performed. Therefore, for patients with a negative IGH rearrangement probe, samples and detection costs can be saved, and the detection time can be reduced.

[0031] In a preferred embodiment of the present application, in the CCND1 / IGH probe, the CCND1 probe is labeled with a red fluorescent group, and the IGH probe is labeled with a green fluorescent group; In a preferred embodiment of the present application, in the CCND3 / IGH probe, the CCND3 probe is labeled with a red fluorescent group, and the IGH probe is labeled with a green fluorescent group; In a preferred embodiment of the present application, in the FGFR3 / IGH probe, the FGFR3 probe is labeled with a red fluorescent group, and the IGH probe is labeled with a green fluorescent group; In a preferred embodiment of the present application, in the MAF / IGH probe, the MAF probe is labeled with a red fluorescent group, and the IGH probe is labeled with a green fluorescent group; In a preferred embodiment of the present application, in the MAFB / IGH probe, the MAFB probe is labeled with a red fluorescent group, and the IGH probe is labeled with a green fluorescent group.

[0032] On the basis of a positive result of the IGH rearrangement probe, further detection of the fusion of IGH with other genes can be used to determine which specific gene or genes the IGH gene has fused with, and is used to guide the determination of clinical treatment plans and the evaluation of prognosis.

[0033] In the second aspect of the present application, a probe composition prepared by any of the above preparation methods is provided.

[0034] In a preferred embodiment of the present application, the concentration of the above probe is: 20 - 50 ng / μL for each probe composition.

[0035] In a preferred embodiment of the present application, the concentration of the above probe is: 20 ng / μL for each probe composition.

[0036] In a preferred embodiment of the present application, the concentration of the above probe is: 30 ng / μL for each probe composition.

[0037] In a preferred embodiment of the present application, the concentration of the above probe is: 40 ng / μL for each probe composition.

[0038] In a preferred embodiment of the present application, the concentration of the above probe is: 50 ng / μL for each probe composition.

[0039] In a preferred embodiment of the present application, the amplification labeling reaction system is: (1) Reaction buffer (2) Deoxynucleoside triphosphate substrates and 5% - 10% UNA triphosphate substrates; (3) Prepared probe library template; (4) Synthesized fluorescently labeled universal primers; (5) DNA polymerase.

[0040] In a preferred embodiment of the present application, the conditions for the amplification labeling reaction are as follows: 95°C for 5 min; 94°C for 30 s, 58°C for 30 s, 72°C for 30 s, for a total of 35 cycles; 72°C for 10 min.

[0041] In the third aspect of the present application, there is provided a kit, which comprises (1) A mixture of a probe composition and a hybridization buffer, wherein the probe composition is prepared by the preparation method defined in any of the above technical solutions; (2) DAPI counterstain.

[0042] In the fourth aspect of the present application, there is provided the use of the above kit in the preparation of a diagnostic product for multiple myeloma.

[0043] In the fifth aspect of the present application, there is provided the use of the above kit in the diagnosis of multiple myeloma, and the use comprises the following steps: (1) Sample treatment: Place the bone marrow cell smear sample into a container containing 2×SSC, heat it in a microwave oven at high power for 3 min until the liquid boils, and then continue to heat it at medium-low power for 10 min. Immediately after the treatment, place the slide in gradient alcohol pre-cooled to -20°C for dehydration and air drying. Divide the sample into 4 parts numbered 1-4 for standby; (2) Preparation of the probe hybridization mixture: Mix the fluorescently labeled probe compositions p53 / CEP17, RB1 / D13S319 / 13q34, 1p32 / 1q21, and IGH rearrangement probe for detection and the hybridization buffer in a volume ratio of 1:9; (3) Co-denaturation of the probe and sample: Hybridize and mix sample No. 1 with 10 μL of the p53 / CEP17 probe hybridization mixture in step (2), sample No. 2 with 10 μL of the RB1 / D13S319 / 13q34 probe hybridization mixture in step (2), sample No. 3 with 10 μL of the 1p32 / 1q21 probe hybridization mixture in step (2), and sample No. 4 with 10 μL of the IGH rearrangement probe hybridization mixture in step (2). Cover the slide with a 22×22 mm coverslip, seal the slide with rubber glue, and place the slide in a hybridization instrument at 90°C for denaturation for 1 min and at 37°C for hybridization for 30-60 min; (4) Washing after hybridization: After hybridization is completed, remove the coverslip, and place the slide in a pre-warmed washing solution at 60°C to wash away the unbound probes; (5) Counterstaining and microscopic examination: Drop 10 μL of an anti-quenching mounting medium on the air-dried slide for sealing, and then observe the hybridization result under a fluorescence microscope; (6)IGH rearrangement probe result analysis and IGH fusion gene detection: Observe the detection samples of the IGH rearrangement probe under a fluorescence microscope and analyze the results. If the result is negative, terminate the diagnosis. If the result is positive, use the CCND1 / IGH, CCND3 / IGH, FGFR3 / IGH, MAF / IGH, and MAFB / IGH probes and repeat the operations in steps (1) - (5) to perform IGH fusion gene detection on the same positive samples.

[0044] Definitions and explanations Unless otherwise specified, the following terms and phrases used herein are intended to have the following meanings. A particular term or phrase should not be considered indeterminate or unclear without a specific definition, but should be understood as the meaning understood by those of ordinary skill in the art. When a trade name appears in this text, it is intended to refer to the corresponding commodity or its active ingredient.

[0045] In the present invention, unless otherwise specified, the terms "comprising, including, and containing" or equivalents are open-ended expressions, meaning that in addition to the listed elements, components, or steps, other unspecified elements, components, or steps may also be covered.

[0046] Unless otherwise specified, the "many" in the term "a plurality of" in the present invention refers to an integer greater than or equal to 2, including but not limited to 2, 3, 4, 5, 6, 7, 8, 9, and 10, up to the maximum number of items in the options.

[0047] Unless otherwise specified, the "optional" and / or "optionally" in the terms of this application means that it can be selected or not selected. When not selected, it means that this step, this limitation, or this component does not exist. When selected, it means to perform the relevant operations or limitations according to the subsequent description.

[0048] Unless otherwise specified, the term "UNA" in this application represents a novel acyclic RNA derivative, similar to DNA or RNA, and the general structural formula of UNA is where B represents the natural bases adenine, thymine, guanine, and cytosine.

[0049] Unless otherwise specified, the general structural formula of UNA triphosphate is

[0050] Unless otherwise specified, the structural formula of "UNA-A triphosphate" in this application is

[0051] Unless otherwise specified, the structural formula of "UNA-T triphosphate" in this application is

[0052] Unless otherwise specified, the structural formula of "UNA-G triphosphate" in this application is

[0053] Unless otherwise specified, the term "UNA-C triphosphate" in this application has the structural formula

[0054] In summary, the present invention includes at least one of the following beneficial effects: 1. This application uses a hierarchical method for the diagnosis of multiple myeloma, which can reduce the sample volume for a part of patients with negative IGH rearrangement probes. At the same time, it can also reduce the detection cost and shorten the detection time.

[0055] 2. A small amount of open-loop nucleotides (UNA) are contained in the probes of this application. On the basis of a slight increase in fluorescence after probe binding, it can further improve the specificity and stability of the probes and reduce background noise.

[0056] 3. The probe composition of this application is rich in probe types, can simultaneously detect multiple different mutant types of multiple myeloma, and can improve the detection rate and result accuracy.

[0057] 4. The preparation method of this application adds tag sequences to both ends of each probe, greatly reducing the screening and design work of primers, enabling the probe preparation process to be amplified by the PCR method. BRIEF DESCRIPTION OF THE DRAWINGS

[0058] Figure 1 : Color comparison of the UNA-containing P53 / CEP17 probe and the UNA-free P53 / CEP17 probe in this application Figure 2 : Color comparison of the UNA-containing IGH rearrangement probe and the UNA-free IGH rearrangement probe in this application Figure 3 : Color development of the UNA-containing IGH rearrangement probe in this application for cells with IGH gene breakage DETAILED DESCRIPTION OF THE EMBODIMENTS

[0059] The present invention will be described in detail below through examples, but this does not mean any adverse limitation to the present invention. The present invention has been described in detail herein, and its specific implementation manners have also been disclosed. It will be obvious to those skilled in the art that various changes and improvements can be made to the specific implementation manners of the present invention without departing from the spirit and scope of the present invention.

[0060] Preparation Example 1 Preparation of P53 Probe Preparation method of P53 probe: (1) Download the BAC clone gene sequences RP11-1081A10 and RP11-107F4 corresponding to the locus P53 from the UCSC Genome Browser.

[0061] (2) The RP11-1081A10 and RP11-107F4 sequences obtained in step (1) were respectively segmented into 1-kb-sized blocks using the perl plug-in program chunks.pl and duplicate sequences were removed; the segmented blocks were batch-imported into the OligoArray software for probe design and probe screening, and then the screened probes were exported to an EXCEL spreadsheet. Then, a 17-bp tag sequence was added to the 5' end and an 18-bp tag sequence was added to the 3' end of each probe to obtain a series of probe sequences with tag sequences; the probe design and probe screening methods were that the probe length was 50-150 bp, the TM value was 85-99 °C, the GC ratio was 40-80%, it did not contain TTTT / GGGG / AAAA / CCCC, and the minimum interval between probes was 5 bp.

[0062] (3) The gene probe sequences with tag sequences obtained in step (2) were chemically synthesized using a DNA synthesizer, and the probes chemically synthesized at the same locus were mixed to prepare a P53 probe library. (4) A universal primer with a red fluorescent group at the 5' end was synthesized and used to perform an amplification labeling reaction on the P53 probe library synthesized in step (3), and 5% of UNA triphosphate of the total molar amount of nucleotide raw materials was added in the amplification labeling reaction; the universal primer sequences were TGTAAAACGACGGCCAGT and CAGGAAACAGCTATGACC.

[0063] (5) The amplified labeling product of the probe library obtained in step (4) was purified and diluted to obtain a fluorescently labeled P53 probe library.

[0064] Preparation of Probes for Preparation Examples 2-14 CEP17, RB1, D13S319, 13q34, 1p32, 1q21, IGH Split Probe, CCND1, CCND3, FRFG3, MAF, MAFB and IGH Probes Use the corresponding BAC clone gene sequences and the corresponding fluorescent groups to prepare the corresponding probes.

[0065] The sequence of the CEP17 probe is as shown in SEQ No 1; The BAC gene of the RB1 probe is selected from RP11-153K13; The BAC gene of the D13S319 probe is selected from RP11-893E5; The BAC genes of the 13q34 probe are selected from RP11-139P6 and RP11-708D5; The BAC gene of the 1p32 probe is selected from RP11-691B6; The BAC genes of the 1q21 probe are selected from RP11-780O9 and RP11-93K11; The BAC genes in the pericentromeric region of the IGH probe are selected from RP11-878E14 and RP11-346I20; The BAC genes in the telomeric proximal region of the IGH probe are selected from RP11-112H5, RP11-101G24 and RP11-1145H5; The BAC genes of the CCND1 probe are selected from RP11-378E8, RP11-643C9 and RP11-156B3; The BAC genes of the CCND3 probe are selected from RP11-25I3, RP11-97H9 and RP11-978D8; The BAC genes of the FRFG3 probe are selected from RP11-875G10 and RP11-709N10; The BAC genes of the MAF probe are selected from RP11-231B20, RP11-1062G14, RP11-485J23 and RP11-947E16; The BAC genes of the MAFB probe are selected from RP11-91F2, RP11-588F9, RP11-705H7 and RP11-458K19; The BAC genes of the IGH probe are selected from RP11-346I20, RP11-815P21, RP11-1065N8 and RP11-5F6.

[0066] In the p53 / CEP17 probe, the CEP17 probe is labeled with a green fluorescent group; The D13S319 probe is labeled with a red fluorescent group, the RB1 probe is labeled with a green fluorescent group, and the 13q34 probe is labeled with a cyan fluorescent group; The 1p32 probe is labeled with a red fluorescent group, and the 1q21 probe is labeled with a green fluorescent group; In the IGH rearrangement probe, the pericentromeric region of IGH is labeled with a red fluorescent group, and the telomeric proximal region of IGH is labeled with a green fluorescent group; The CCND1 probe is labeled with a red fluorescent group; The CCND3 probe is labeled with a red fluorescent group; The FGFR3 probe is labeled with a red fluorescent group; The MAF probe is labeled with a red fluorescent group; The MAFB probe is labeled with a red fluorescent group; The IGH probe is labeled with a green fluorescent group.

[0067] Preparation of the P53 / CEP17 Probe in Example 1 Preparation method of P53 / CEP17 probe: Mix the P53 probe and CEP17 probe obtained in the preparation example at the same concentration. The concentration of both probes is 30 ng / μL.

[0068] Example 2 Preparation of RB1 / D13S319 / 13q34 Probe Preparation method of RB1 / D13S319 / 13q34 probe: Mix the RB1 probe, D13S319 probe and 13q34 probe obtained in the preparation example at the same concentration. The concentration of the probes is 30 ng / μL.

[0069] Example 3 Preparation of 1p32 / 1q21 Probe Preparation method of 1p32 / 1q21 probe: Mix the 1p32 probe and 1q21 obtained in the preparation example at the same concentration. The concentration of the probes is 50 ng / μL.

[0070] Example 4 Preparation of IGH Split Probe Preparation method of IGH split probe: Mix the IGH pericentromeric probe and IGH telomeric proximal probe obtained in the preparation example at the same concentration. The concentration of the probes is 40 ng / μL.

[0071] Example 5 Preparation of CCND1 / IGH Probe Preparation method of CCND1 / IGH probe: Mix the CCND1 probe and IGH probe obtained in the preparation example at the same concentration. The concentration of the probes is 40 ng / μL.

[0072] Example 6 Preparation of CCND3 / IGH Probe Preparation method of CCND3 / IGH probe: Mix the CCND3 probe and IGH probe obtained in the preparation example at the same concentration. The concentration of the probes is 40 ng / μL.

[0073] Example 7 Preparation of FRFG3 / IGH Probe Preparation method of FRFG3 / IGH probe: Mix the FRFG3 probe and IGH probe obtained in the preparation example at the same concentration. The concentration of the probes is 40 ng / μL.

[0074] Example 8 Preparation of MAF / IGH Probe Preparation method of MAF / IGH probe: Mix the MAF probe and IGH probe obtained in the preparation example at the same concentration. The concentration of the probes is 40 ng / μL.

[0075] Example 9 Preparation of MAFB / IGH Probe Preparation method of MAFB / IGH probe: Mix the MAFB probe and IGH probe prepared in the preparation example at the same concentration, and the probe concentration is 40 ng / μL for both.

[0076] Preparation of P53 / CEP17 probe without UNA in Comparative Example 1 Part 1: Preparation method of P53 probe without UNA: (1) Download the BAC clone gene sequences RP11-1081A10 and RP11-107F4 corresponding to the locus P53 from UCSC Genome Browser.

[0077] (2) Use the perl plug-in program chunks.pl to split the RP11-1081A10 and RP11-107F4 sequences obtained in step (1) into 1-kb-sized blocks and remove duplicate sequences; batch import the split blocks into OligoArray software for probe design and screening, then export the screened probes to an EXCEL spreadsheet, and add a 17-bp tag sequence to the 5' end and an 18-bp tag sequence to the 3' end of each probe to obtain a series of probe sequences with tag sequences; the probe design and screening methods are that the probe length is 50-150 bp, the TM value is 85-99 °C, the GC ratio is 40-80%, it does not contain TTTT / GGGG / AAAA / CCCC, and the minimum interval between probes is 5 bp.

[0078] (3) Use a DNA synthesizer to chemically synthesize the gene probe sequences with tag sequences obtained in step (2) respectively, and mix the chemically synthesized probes at the same locus to prepare a P53 probe library respectively; (4) Synthesize a universal primer with a red fluorescent group at the 5' end and use this universal primer to perform an amplification labeling reaction on the EGR1 probe library synthesized in step (3), wherein the substrate of the amplification labeling reaction is a natural deoxynucleoside triphosphate substrate, and the universal primer sequences are TGTAAAACGACGGCCAGT and CAGGAAACAGCTATGACC.

[0079] (5) Purify and dilute the amplification labeling product of the probe library obtained in step (4) to obtain a fluorescence-labeled P53 probe library without UNA.

[0080] Part 2: Preparation method of CEP17 probe without UNA: Replace the BAC clone sequence in step (1) of Comparative Example 1 with the CEP17 centromeric region sequence, and replace the red fluorescent group synthesized in step (4) with a green fluorescent group. The other processes are the same as in Comparative Example 1 to prepare a CEP17 probe without UNA.

[0081] Mix the P53 probe prepared in Part 1 and the CEP17 probe prepared in Part 2 at equal concentrations. The concentration of both probes is 30 ng / μL.

[0082] Preparation of IGH rearrangement probe without UNA in Comparative Example 2 Preparation method of IGH rearrangement probe without UNA: Replace the BAC clone sequence in step (1) of Comparative Example 1 with RP11-878E14 and RP11-346I20, and keep other processes the same as in Comparative Example 1 to prepare an IGH pericentromeric probe without UNA; Replace the BAC clone sequence in step (1) of Comparative Example 1 with RP11-112H5, RP11-101G24 and RP11-1145H5, and label it with a green fluorescent group. Keep other processes the same as in Comparative Example 1 to prepare an IGH telomere proximal region probe without UNA.

[0083] Test Example 1 Color comparison between the P53 / CEP17 probe containing UNA and the P53 / CEP17 probe without UNA in this application I. Test method: (1) Sample treatment: Put the normal bone marrow cell smear sample into a container containing 2×SSC, heat it in a microwave oven at high power for 3 min until the liquid boils, and then continue to heat it at medium-low power for 10 min. After the treatment is completed, immediately place the slide in gradient alcohol pre-cooled at -20°C for dehydration and air drying. Divide the sample into two parts, No. 1 and No. 2, for standby; (2) Preparation of probe hybridization mixture: Mix the fluorescently labeled P53 / CEP17 probe composition prepared in Example 1 and the hybridization buffer in a volume ratio of 1:9; (3) Preparation of control probe hybridization mixture: Mix the fluorescently labeled P53 / CEP17 probe composition without UNA prepared in Comparative Example 1 and the hybridization buffer in a volume ratio of 1:9 respectively; (4) Probe-sample co-denaturation: Hybridize and mix the No. 1 sample with 10 μL of the P53 / CEP17 probe hybridization mixture in step (2), and hybridize and mix the No. 2 sample with 10 μL of the fluorescently labeled P53 / CEP17 probe hybridization mixture without UNA in step (3). Cover the samples with 22×22 mm coverslips respectively, seal the slides with rubber cement. After sealing, place the slides in a hybridization instrument for denaturation at 90°C for 1 min and hybridization at 37°C for 30 - 60 min; (4) Washing after hybridization: After the hybridization is completed, remove the coverslip, and place the slide in a washing solution preheated at 60°C to wash away the unbound probes; (5) Counterstaining and microscopy: Drop 10 μL of anti-quenching mounting medium on the air-dried slide for sealing, and then observe the hybridization results under a fluorescence microscope respectively.

[0084] II. Experimental results are as shown in the appendix Figure 1 as follows Figure 1 (a) shows the color development result of P53 / CEP17 of the present application on normal cells, Figure 1 (b) shows the color development result of the P53 / CEP17 probe composition of Comparative Example 1 on normal cells.

[0085] III. Experimental conclusion The P53 / CEP17 probe compositions of the present application and the probe composition of Comparative Example 1 both screen the BAC clone gene sequences on chromosome 17. Therefore, for normal cells, their color development results show two red and two green signals, indicating that both the P53 / CEP17 probe composition of the present application and the probe composition of Comparative Example 1 are effective and accurate. However, by comparing Figure 1 (a) and Figure 1 (b), it can be clearly found that Figure 1 the signal background noise of (a) is significantly lower than Figure 1 the background noise of (b). The reduction of the background noise benefits from the improvement of the specificity of the probe composition. The reduction of the background noise can greatly reduce the analysis difficulty of the diagnostic results. At the same time, the improvement of the specificity of the probe composition can also reduce the sample usage. The CEP17 probe is labeled with a green fluorescent group at the centromeric region of chromosome 17. During the use of the probe, on the one hand, it can be used to detect whether there is an abnormality in the whole chromosome 17, and on the other hand, it can also be used as an internal reference for the P53 probe to a certain extent to exclude the influence of the probe itself on the results during the detection process.

[0086] Test Example 2 Comparison of color development of the IGH rearrangement probe of the present application and the IGH rearrangement probe without UNA on normal cells I. Test method (1) Sample treatment: Respectively put the normal bone marrow cell smear samples into a container containing 2×SSC, heat them in a microwave oven at high fire for 3 min until the liquid boils, and then continue to heat them at medium and low fire for 10 min. After the treatment is completed, immediately place the glass slides in gradient alcohol pre-cooled at -20°C for dehydration and air drying, and reserve them for use; (2) Preparation of the probe hybridization mixture: Mix the IGH rearrangement probe composition prepared in Example 4 and the hybridization buffer in a volume ratio of 1:9; (3) Preparation of the control probe hybridization mixture: Mix the fluorescently labeled IGH rearrangement probe composition without UNA prepared in Comparative Example 2 and the hybridization buffer in a volume ratio of 1:9; (4) Co-denaturation of probe sample and normal cells: Take normal cell samples and 10 μL of the probe hybridization mixture from step (2) for hybridization mixing and the control probe hybridization mixture from step (3) for hybridization mixing respectively. Cover with a 22×22 mm coverslip, seal the slide with rubber cement. After sealing, place the slide in a hybridization instrument for denaturation at 90 °C for 1 min and hybridization at 37 °C for 30 - 60 min; (5) Washing after hybridization: After hybridization is completed, remove the coverslip, and place the slide in a pre-warmed washing solution at 60 °C to wash away the unbound probes; (6) Counterstaining and microscopic examination: Drop 10 μL of anti-quenching mounting medium on the air-dried slide for sealing, and then observe the hybridization results under a fluorescence microscope respectively.

[0087] II. Experimental results are as Figure 2 shown Figure 2 (a) shows the color development result of the IGH rearrangement probe of the present application for normal cells, Figure 2 (b) shows the color development result of the IGH rearrangement probe of Comparative Example 2 for normal cells.

[0088] III. Experimental conclusions The IGH rearrangement probe is used to detect whether there is a break in the IGH gene. The IGH gene break in multiple myeloma is a common molecular genetic abnormality, and approximately 50% - 60% of multiple myeloma patients have this abnormality. This abnormality is usually closely related to the prognosis of the disease and is considered one of the independent prognostic factors for multiple myeloma. Therefore, setting the IGH rearrangement probe in the probe composition has clinical significance for the diagnosis of multiple myeloma. Therefore, for normal cells, the color development result of the IGH rearrangement probe shows two yellow signals (the 1 red and 1 green signals completely overlap) or two red and two green signals but the red and green signals are closely adjacent and not separated, indicating that both the IGH rearrangement probe of the present application and the IGH rearrangement probe of Comparative Example 2 are effective and accurate. However, by comparing Figure 2 (a) and Figure 2 (b), it can be clearly found that Figure 2 (a) has significantly lower signal background noise than Figure 2 (b). The reduction of background noise benefits from the improvement of the specificity of the probe composition. The reduction of background noise can greatly reduce the analysis difficulty of the diagnostic results, and at the same time, the improvement of the specificity of the probe composition can also reduce the sample usage.

[0089] Test Example 3 Color development of the IGH rearrangement probe of the present application for IGH gene break cells I. Test method (1) Sample treatment: Place the IGH gene breakage cell smear sample into a container containing 2×SSC, heat it in a microwave oven at high power for 3 min until the liquid boils, and then continue to heat it at medium-low power for 10 min. Immediately after the treatment, place the glass slide in gradient alcohol pre-cooled to -20°C for dehydration and air drying for later use; (2) Preparation of probe hybridization mixture: Mix the IGH rearrangement probe composition prepared in Example 4 and the hybridization buffer in a volume ratio of 1:9; (3) Co-denaturation of probe sample and IGH gene breakage cells: Take a normal cell sample and 10 μL of the probe hybridization mixture in step (2) respectively for hybridization mixing, cover it with a 22×22 mm coverslip, seal the slide with rubber glue, and place the slide in a hybridization instrument for denaturation at 90°C for 1 min and hybridization at 37°C for 30 - 60 min; (4) Washing after hybridization: After the hybridization is completed, remove the coverslip, and place the slide in a washing solution pre-heated to 60°C to wash away the unbound probes; (5) Counterstaining and microscopic examination: Drop 10 μL of anti-quenching mounting medium on the air-dried slide for sealing, and then observe the hybridization results under a fluorescence microscope respectively.

[0090] II. Experimental results are as follows Figure 3 III. Experimental conclusion Figure 3 It is the result of coloring the cells positive for IGH gene breakage with the IGH rearrangement probe of the present application. The results show that the IGH rearrangement probe of the application can accurately detect the separated red and green signals, from which it is inferred that there is an IGH gene breakage situation, and the background is clean and the result analysis is difficult. Therefore, the use of the probe combination of the present application for the diagnosis of multiple myeloma has accurate and reliable results, low background noise, reduces the difficulty of result analysis, and reduces the detection time.

[0091] The above are all preferred embodiments of the present application, and the protection scope of the present application is not limited accordingly. Therefore, all equivalent changes made according to the structure, shape, and principle of the present application should be covered within the protection scope of the present application.

Claims

1. A method for preparing a probe for diagnosing multiple myeloma, characterized in that, Comprising the following steps, (1) Download the BAC clone gene sequences corresponding to the following probes from the UCSC Genome Browser, where the probes include one or more of the following combinations, and the gene sequences include P53 / CEP17, RB1 / D13S319 / 13q34, 1p32 / 1q21, IGH rearrangement probe, CCND1 / IGH, CCND3 / IGH, FRFG3 / IGH, MAF / IGH, and MAFB / IGH; (2) Use the perl plug-in program chunks.pl to split the BAC clone gene sequences corresponding to each locus obtained in step (1) into 1-kb blocks and remove duplicate sequences; batch import the split blocks into the OligoArray software for probe design and probe screening, then export the screened probes to an EXCEL table, and add a 17-bp tag sequence to the 5' end and an 18-bp tag sequence to the 3' end of each probe to obtain a series of probe sequences with tag sequences; (3) Chemically synthesize the gene probe sequences with tag sequences obtained in step (2) using a DNA synthesizer, mix the chemically synthesized probes at the same locus, and prepare probe libraries for each locus respectively; (4) Synthesize a universal primer with a green fluorescent group at the 5' end, a universal primer with a red fluorescent group at the 5' end, and a universal primer with a cyan fluorescent group at the 5' end respectively, and perform amplification labeling reactions on the probes at different loci using different-colored universal primers, where approximately 5% to approximately 10% of the total molar amount of nucleotide raw materials is optionally added with UNA triphosphate in the amplification labeling reaction; (5) Purify and dilute the amplification labeling products of the probe libraries obtained in step (4) to obtain a fluorescently labeled probe library.

2. The preparation method according to claim 1, wherein, the BAC gene of P53 in the P53 / CEP17 probe is selected from RP11-1081A10 and RP11-107F4, and the CEP17 probe sequence is as shown in SEQ No 1; the BAC gene of RB1 in the RB1 / D13S319 / 13q34 probe is selected from RP11-153K13, the BAC gene of D13S319 is selected from RP11-893E5, and the BAC gene of 13q34 is selected from RP11-139P6 and RP11-708D5; the BAC gene of 1p32 in the 1p32 / 1q21 probe is selected from RP11-691B6, and the BAC gene of 1q21 probe is selected from RP11-780O9 and RP11-93K11; the IGH splitting probe is divided into a pericentromeric region and a telomeric proximal region, the BAC gene of the pericentromeric region is selected from RP11-878E14 and RP11-346I20, and the BAC gene of the telomeric proximal region is selected from RP11-112H5, RP11-101G24, and RP11-1145H5; In the CCND1 / IGH probe, the BAC gene of CCND1 is selected from RP11-378E8, RP11-643C9, and RP11-156B3, and the BAC gene of IGH is selected from RP11-346I20, RP11-815P21, RP11-1065N8, and RP11-5F6; In the CCND3 / IGH probe, the BAC gene of CCND3 is selected from RP11-25I3, RP11-97H9, and RP11-978D8, and the BAC gene of IGH is selected from RP11-346I20, RP11-815P21, RP11-1065N8, and RP11-5F6; In the FRFG3 / IGH probe, the BAC gene of FRFG3 is selected from RP11-875G10 and RP11-709N10, and the BAC gene of IGH is selected from RP11-346I20, RP11-815P21, RP11-1065N8, and RP11-5F6; In the MAF / IGH probe, the BAC gene of FRFG3 is selected from RP11-231B20, RP11-1062G14, RP11-485J23, and RP11-947E16, and the BAC gene of IGH is selected from RP11-346I20, RP11-815P21, RP11-1065N8, and RP11-5F6; In the MAFB / IGH probe, the BAC gene of MAFB is selected from RP11-91F2, RP11-588F9, RP11-705H7, and RP11-458K19, and the BAC gene of IGH is selected from RP11-346I20, RP11-815P21, RP11-1065N8, and RP11-5F6.

3. The preparation method according to claim 1, characterized in that, Among them, the 17bp tag sequence in step (2) is TGTAAAACGACGGCCAG, and the 18bp tag sequence is GGTCATAGCTGTTTCCTG; the universal primer sequences in step (4) are TGTAAAACGACGGCCAGT and CAGGAAACAGCTATGACC.

4. The preparation method according to claim 1, characterized in that, Among them, the probe screening conditions in step (2) are that the probe length is 50-150 bp, the TM value is 85-99 °C, the GC ratio is 40-80%, it does not contain TTTT / GGGG / AAAA / CCCC, and the minimum interval between probes is 5 bp.

5. The preparation method according to claim 1, characterized in that, Among them, the polymerase used in the amplification labeling reaction is Therminator DNA polymerase.

6. The preparation method according to claim 1, wherein, Among them, the UNA triphosphates are selected from UNA-A triphosphate, UNA-T triphosphate, UNA-G triphosphate, and UNA-C triphosphate. Preferably, the molar mass ratio of UNA-A triphosphate, UNA-T triphosphate, UNA-G triphosphate, and UNA-C triphosphate is 1:1:1:

1.

7. The preparation method according to claim 1, characterized in that, The In the p53 / CEP17 probe, the p53 probe is labeled with a red fluorescent group, and the CEP17 probe is labeled with a green fluorescent group; or, In the RB1 / D13S319 / 13q34 triple-color probe, the D13S319 probe is labeled with a red fluorescent group, the RB1 probe is labeled with a green fluorescent group, and the 13q34 probe is labeled with a cyan fluorescent group; Or, In the 1p32 / 1q21 probe, the 1p32 probe is labeled with a red fluorescent group, and the 1q21 probe is labeled with a green fluorescent group; or, In the IGH rearrangement probe, the pericentromeric region of IGH is labeled with a red fluorescent group, and the telomeric proximal region of IGH is labeled with a green fluorescent group; or, In the CCND1 / IGH probe, the CCND1 probe is labeled with a red fluorescent group, and the IGH probe is labeled with a green fluorescent group; or, In the CCND3 / IGH probe, the CCND3 probe is labeled with a red fluorescent group, and the IGH probe is labeled with a green fluorescent group; or, In the FGFR3 / IGH probe, the FGFR3 probe is labeled with a red fluorescent group, and the IGH probe is labeled with a green fluorescent group; or, In the MAF / IGH probe, the MAF probe is labeled with a red fluorescent group, and the IGH probe is labeled with a green fluorescent group; or, In the MAFB / IGH probe, the MAFB probe is labeled with a red fluorescent group, and the IGH probe is labeled with a green fluorescent group.

8. A probe composition prepared by the preparation method according to any one of claims 1-7.

9. Use of the probe composition according to claim 8 in the preparation of a diagnostic product for multiple myeloma.

10. The application according to claim 9, characterized in that, The method of using the probe composition or kit includes the following steps: (1) Sample treatment: Place the bone marrow cell smear sample into a container containing 2×SSC, heat it in a microwave oven at high power for 3 min until the liquid boils, and then continue to heat it at medium-low power for 10 min. After the treatment is completed, immediately place the slide in gradient alcohol pre-cooled at -20°C for dehydration and air drying, and divide the sample into 4 parts numbered 1-4 for standby; (2) Preparation of the probe hybridization mixture: Mix the fluorescently labeled probe compositions p53 / CEP17, RB1 / D13S319 / 13q34, 1p32 / 1q21, IGH rearrangement probe detection, and hybridization buffer in a volume ratio of 1:9; (3) Co-denaturation of the probe and sample: Hybridize and mix the 1st sample with 10 μL of the p53 / CEP17 probe hybridization mixture in step (2), the 2nd sample with 10 μL of the RB1 / D13S319 / 13q34 probe hybridization mixture in step (2), the 3rd sample with 10 μL of the 1p32 / 1q21 probe hybridization mixture in step (2), and the 4th sample with 10 μL of the IGH rearrangement probe hybridization mixture in step (2). Cover with a 22×22 mm coverslip, seal the slide with rubber glue. After sealing, place the slide in a hybridization instrument at 90°C for denaturation for 1 min and hybridize at 37°C for 30-60 min; (4)Post-hybridization washing: After hybridization is completed, remove the coverslip, and place the slide in a pre-warmed washing solution at 60 °C to wash away the unbound probes. (5)Counterstaining and microscopy: Add 10 μL of anti-quenching mounting medium to the air-dried slide for mounting, and then observe the hybridization results under a fluorescence microscope. (6)Analysis of IGH rearrangement probe results and detection of IGH fusion genes: Observe the test samples of the IGH rearrangement probe under a fluorescence microscope and analyze the results. If the result is negative, terminate the diagnosis. If the result is positive, use CCND1 / IGH, CCND3 / IGH, FGFR3 / IGH, MAF / IGH, and MAFB / IGH probes to repeat the operations in steps (1)-(5) to detect IGH fusion genes in the same positive samples.