Rapid identification kit and identification method for culex tritaeniorhynchus based on RAA technology

Abstract

The invention relates to a rapid identification kit and an identification method for culex tritaeniorhynchus based on an RAA technology. The sequence of the rapid identification kit is as follows: tritaeniorhynchus F3: CATTAGGACTACGATGAGGAATAATTTTATTTATTG; and the third band beak-R3 is ATGTGACAGTTACACCCAGAAGCT AATAAAAT, and the third band beak-R3 is a third band beak-R3. The mitochondrial DNA cytochrome oxidase III gene is applied to the identification of culex tritaeniorhynchus based on a recombinase-mediated strand displacement nucleic acid amplification technology, and is used together with a traditional morphological identification method, so that the identification error can be effectively reduced, and the identification efficiency and accuracy can be improved.

Description

Technical Field

[0001] The present invention relates to the field of biological detection, and particularly relates to a rapid identification kit and method for Culex tritaeniorhynchus based on the RAA technology. Background Art

[0002] The main means for identifying mosquito populations at ports is morphological identification, relying on port inspection and quarantine personnel with experience in morphological identification and the ability to identify mosquitoes. Identification is carried out according to the medical mosquito classification retrieval table. However, morphological identification faces many problems: there are few professional mosquito identification talents, and the personnel training cycle is long; factors such as the experience level, professional level, integrity and developmental stage of the mosquitoes of the identification personnel can lead to a long identification cycle and low efficiency; it is difficult to identify some complex populations such as sibling species and homomorphic species; for mosquito eggs, larvae and pupae, in order to obtain their reliable identification characteristics, artificial cultivation of mosquitoes is often required before identification; if the number of mosquitoes submitted for inspection at the port is large, it is a very big test for the port mosquito identification work; and so on. Therefore, in addition to improving the identification ability of quarantine personnel and developing an identification assistance system, there is still a need to develop safe, rapid, accurate and sensitive identification methods to achieve rapid identification of mosquitoes.

[0003] Traditional mosquito identification is mainly based on morphological identification. However, the morphological characteristics of vector organisms may be damaged during collection or storage, and all developmental stages cannot be identified simultaneously. Therefore, only experienced morphological identification experts can accurately identify. In recent years, with the development of molecular biology technology, molecular means such as conventional PCR, restriction fragment length polymorphism (RFLP), random amplified polymorphic DNA (RAPD), single-strand conformation polymorphism (SSCP), and DNA barcoding technology have been applied to mosquito population identification. However, these identification methods all have deficiencies: conventional detection of specific PCR product sequences relies on relatively expensive molecular probes or product sequencing; RFLP identification of mosquito species is not only time-consuming but also requires a large number of samples; RAPD identification of mosquito species is rapid, but the results are unstable and sometimes not repeatable; SSCP can only be used as a method for detecting mosquito gene mutations. To determine the position and type of mutations, further sequencing is required, and the electrophoresis conditions are relatively strict; the subsequent sequencing work of DNA barcoding technology is time-consuming and costly. In view of the deficiencies of the above methods, in order to achieve safe, rapid, accurate and sensitive molecular identification of mosquito populations, new molecular identification means need to be explored. Summary of the Invention

[0004] The present invention provides a rapid identification kit and method for Culex tritaeniorhynchus based on the RAA technology.

[0005] The present invention is realized by the following technical solutions: The present invention applies the recombinase-aid amplification (RAA) technology based on the mitochondrial DNA cytochrome oxidase III gene (cytochrome oxidase Ⅰ, COIII) to mosquito identification. First, a set of specific amplification primers for rapid identification of Culex tritaeniorhynchus based on the RAA technology is obtained, and the sequences are as follows: Culex tritaeniorhynchus-F3: CATTAGGACTACGATGAGGAATAATTTTATTTATTG Culex tritaeniorhynchus-R3: ATGTGACAGTTACACCAGAAGCTAATAAAAT.

[0006] The present invention also provides a kit for rapid identification of Culex tritaeniorhynchus based on the RAA technology, including the above primer sequences.

[0007] Compared with the existing detection methods, the beneficial effects of the present invention are as follows: Applying the recombinase-aid amplification (RAA) technology based on the mitochondrial DNA cytochrome oxidase III gene (cytochrome oxidase Ⅰ, COIII) to mosquito identification and using it in combination with the traditional morphological identification method can effectively reduce the identification error and improve the identification efficiency and accuracy. Description of the Drawings

[0008] Figure 1 Specificity results of the RAA detection method for Culex tritaeniorhynchus Figure 2 Sensitivity results of the RAA detection method for Culex tritaeniorhynchus Detailed Embodiments

[0009] The following uses examples to further describe the present invention. Example 1

[0010] This example provides a set of specific amplification primers for rapid identification of Culex tritaeniorhynchus based on the RAA technology, and the sequences are as follows: Culex tritaeniorhynchus-F3: CATTAGGACTACGATGAGGAATAATTTTATTTATTG Culex tritaeniorhynchus-R3: ATGTGACAGTTACACCAGAAGCTAATAAAAT.

[0011] Example 2 Specificity and Sensitivity Detection Nucleic Acid Extraction Extract the mitochondrial genomic nucleic acids of one hind leg of each of the mosquito species, such as *Aedes albopictus*, *Culex tritaeniorhynchus*, *Anopheles sinensis*, and *Armigeres subalbatus*, using the TaKaRa MiniBEST Viral RNA / DNA Extraction Kit Ver.5.0 (Catalog No.: 9766).

[0012] RAA detection steps Amplify the DNA nucleic acids of each mosquito species using the RAA nucleic acid amplification reagent (basic type) of Hangzhou Zhongce Biotechnology Co., Ltd.

[0013] Specificity of the RAA detection method for *Culex tritaeniorhynchus*. The results are as Figure 1 shown. The F3-R3 primer of *Culex tritaeniorhynchus* has good specificity compared to the corresponding control.

[0014] Sensitivity of the RAA detection method for *Culex tritaeniorhynchus*. The results are as Figure 2 shown. The F3-R3 primer of *Culex tritaeniorhynchus*. The mitochondrial genomic nucleic acids extracted from one hind leg of *Culex tritaeniorhynchus* were serially diluted 10-fold. It can be seen from Figure 2 this that its sensitivity can reach 10 -5 dilution.

[0015] Of course, the above description is not a limitation of the present invention, and the present invention is not limited to the above examples. Any changes, modifications, additions, or substitutions made by those of ordinary skill in the art within the scope of the essence of the present invention shall fall within the protection scope of the present invention.

Claims

1. A specific amplification primer for rapid identification of Culex tritaeniorhynchus based on the RAA technology, characterized in that, The sequences are as follows: Three-banded beak-F3: CATTAGGACTACGATGAGGAATAATTTTATTTATTG Three-banded beak-R3: ATGTGACAGTTACACCAGAAGCTAATAAAAT.

2. A rapid identification kit for Culex tritaeniorhynchus based on the RAA technology, characterized in that, It includes the primer sequences described in Claim 1.

Images