A SNP molecular marker associated with skin color trait in Ma Huang chicken carcasses and its application
By screening SNP molecular markers of the SCARB2 gene, designing specific amplification primers, and using PCR amplification and sequencing technology to identify SNP genotypes in live chickens, the problem of high manpower and cost in selecting skin color in chicken carcasses has been solved, enabling early selection and efficient breeding.
Patent Information
- Application Number
- CN202510738541.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-04
- Publication Date
- 2026-01-30
- Estimated Expiration
- 2045-06-04
AI Technical Summary
In existing technologies, skin color selection in chicken carcasses relies on post-slaughter testing, which consumes a lot of manpower and costs, and the process is cumbersome, making it difficult to achieve efficient skin color trait selection.
By screening for SNP molecular markers of the SCARB2 gene associated with chicken skin color, specific amplification primers were designed, and PCR amplification and sequencing technologies were used to identify the SNP locus genotype in live chickens, thus achieving early selection.
This enables early selection of skin color traits in chicken carcasses, saves production costs, improves breeding efficiency, and promotes the smooth progress of chicken skin color trait selection.
Smart Images

Figure CN120350138B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic breeding technology, and in particular to a SNP molecular marker related to the skin color trait of Ma Huang chicken carcasses and its application. Background Technology
[0002] With the rise of the chilled chicken market, chicken skin color has become a key indicator of meat quality and freshness. A uniform, bright skin color increases the appeal of chicken, and chickens with a yellowish skin tone are more popular with consumers. The yellow phenotype of chicken skin mainly originates from the deposition of carotenoids in the body. Carotenoids are a class of 40-carbon lipophilic pigments, and their accumulation in the chicken's body causes the skin to appear yellow. Currently, the selection of chicken carcass skin color mainly relies on post-slaughter skin color testing. However, this traditional method is not only labor-intensive and costly, but also cumbersome, greatly hindering the efficient implementation of selection work. Molecular marker methods hold promise for overcoming this challenge. By screening for molecular markers related to chicken skin color, precise selection of skin color traits can be achieved during the live stage of chickens. This can significantly reduce workload and costs, and effectively promote the smooth progress of chicken skin color trait selection.
[0003] Scavenger receptors (SRs) are a family of complex and diverse cell surface receptors. Studies have shown that SR family members play important roles in the cellular uptake and transport of carotenoids, especially members of the B subfamily (such as SCARB1 and CD36), which have been widely confirmed to be involved in this process. For example, SCARB1 can significantly promote cellular uptake of carotenoids and may be a key regulator of carotenoid-based pigmentation in avian feathers; while CD36 also mediates carotenoid transport in various tissues. Furthermore, studies have found that SCARB2 also possesses carotenoid binding and transport capabilities, and its affinity for macular lutein carotenoids is comparable to that of SCARB1 and CD36. SCARB2 is highly expressed in retinal pigment epithelial cells, and its loss of function leads to a significant reduction in intracellular lutein accumulation, suggesting that it may synergistically regulate the metabolic distribution of carotenoids with other members of the SR family.
[0004] However, no studies have yet reported a direct association between the SCARB2 gene and skin yellowness or other skin color traits. Single nucleotide polymorphism (SNP) molecular markers, as a molecular breeding method for livestock and poultry, can establish a marker-assisted selection system by analyzing the association mechanism between SNPs of the SCARB2 gene and skin color of chicken carcasses, providing new pathways and methods for breeding chicken skin color traits. Summary of the Invention
[0005] The purpose of this invention is to provide a SNP molecular marker related to skin color traits in Ma Huang chickens and its application, thereby addressing the problems existing in the prior art. The molecular marker provided by this invention enables early selection of skin color traits in chicken carcasses, saving production costs and accelerating genetic progress.
[0006] To achieve the above objectives, the present invention provides the following solution:
[0007] This invention provides the application of SNP sites related to skin color traits in Ma Huang chicken carcasses in the identification of skin color traits in Ma Huang chicken carcasses. The SNP site is located at position 251 of the nucleotide sequence shown in SEQ ID NO.3. The site has a T>G mutation. The genotypes of the SNP site include TT, GG and TG genotypes.
[0008] The carcass skin color characteristics refer to the yellowness values of the skin on the chest, back, and legs;
[0009] Individuals with the TT genotype had significantly higher yellowness values in the skin of their chest, back, and legs compared to individuals with the TG genotype.
[0010] The present invention also provides the application of primer pairs for amplifying gene fragments containing SNP sites associated with skin color traits in Ma Huang chicken carcasses in the identification of skin color traits in Ma Huang chicken carcasses, wherein the primer pairs consist of an upstream primer as shown in SEQ ID NO.1 and a downstream primer as shown in SEQ ID NO.2;
[0011] The SNP site is located at position 251 of the nucleotide sequence shown in SEQ ID NO.3. The site contains a T>G mutation. The genotypes of the SNP site include TT, GG and TG genotypes.
[0012] The carcass skin color characteristics refer to the yellowness values of the skin on the chest, back, and legs;
[0013] Individuals with the TT genotype had significantly higher yellowness values in the skin of their chest, back, and legs compared to individuals with the TG genotype.
[0014] This invention also provides a method for identifying the skin color trait of Ma Huang chicken carcasses, comprising the following steps:
[0015] Using the chicken genomic DNA to be tested as a template, PCR amplification was performed using primer pairs to obtain the amplification products;
[0016] The amplified products are sequenced to detect the genotype of the corresponding SNP loci, and the carcass skin color trait of the chicken to be tested is determined based on the detected genotype.
[0017] The carcass skin color characteristics refer to the yellowness values of the skin on the chest, back, and legs;
[0018] The primer pair is used to amplify the gene fragment containing the SNP site associated with the skin color trait of Ma Huang chicken carcasses, and consists of an upstream primer as shown in SEQ ID NO.1 and a downstream primer as shown in SEQ ID NO.2; the SNP site is located at position 251 of the nucleotide sequence shown in SEQ ID NO.3, and the site contains a T>G mutation, with genotypes including TT, GG, and TG;
[0019] Among them, individuals with the TT genotype had significantly higher yellowness values in the skin of their chest, back, and legs than individuals with the TG genotype.
[0020] Optionally, the PCR amplification reaction system is as follows: PCRMix 7.5 μL, upstream and downstream primers 0.3 μL each, DNA template 1.5 μL, and ultrapure water 5.4 μL.
[0021] Optionally, the PCR amplification reaction program is as follows: 95℃ pre-denaturation for 3 min; 94℃ denaturation for 25 s, 59℃ annealing for 25 s, 72℃ extension for 1 min, 34 cycles; 72℃ final extension for 5 min; storage at 4℃.
[0022] The present invention also provides the application of primer pairs for amplifying gene fragments containing SNP sites associated with the skin color trait of Ma Huang chicken carcasses in the selection of Ma Huang chicken carcass skin color traits, wherein the primer pairs consist of an upstream primer as shown in SEQ ID NO.1 and a downstream primer as shown in SEQ ID NO.2;
[0023] The SNP site is located at position 251 of the nucleotide sequence shown in SEQ ID NO.3. This site contains a C>T mutation, and the genotypes include CC, TT, and CT.
[0024] The carcass skin color characteristics refer to the yellowness values of the skin on the chest, back, and legs;
[0025] Individuals with the TT genotype had significantly higher yellowness values in the skin of their chest, back, and legs compared to individuals with the TG genotype.
[0026] The present invention also provides the application of an SNP site related to the skin color trait of Ma Huang chicken carcasses in the selection of Ma Huang chicken carcass skin color trait, wherein the SNP site is located at position 251 of the nucleotide sequence shown in SEQ ID NO.3, and the site has a T>G mutation, and the genotypes include TT, GG and TG genotypes;
[0027] The carcass skin color characteristics refer to the yellowness values of the skin on the chest, back, and legs;
[0028] Individuals with the TT genotype had significantly higher yellowness values in the skin of their chest, back, and legs compared to individuals with the TG genotype.
[0029] The present invention discloses the following technical effects:
[0030] This invention identifies a SNP locus at position 49442841 in the intron region of the SCARB2 gene on chicken chromosome 4. This locus contains a T>G mutation, with genotypes including TT, TG, and GG. Association analysis between this locus and chicken carcass skin color traits revealed a significant correlation between this locus and the yellowness values of the skin on the chest, back, and legs. Individuals with the TT genotype showed significantly higher yellowness values on the chest, back, and legs than individuals with the TG genotype. This indicates that this SNP locus can accurately identify chicken carcass skin color traits and can serve as an important genetic marker for early screening of carcass skin color traits during chicken breeding.
[0031] This invention designs and synthesizes a pair of specific amplification primers based on the SNP site to amplify gene fragments containing this site. The genotype of the SNP site is determined by the amplification results. Early selection of chicken carcass skin color traits based on genotype can save production costs and accelerate genetic progress. This method enables molecular marker-assisted selection to be better applied to chicken breeding and has significant economic application value. Attached Figure Description
[0032] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0033] Figure 1 The image shows the gel electrophoresis results of the amplification products, where M is the marker and 1-4 are the amplification products of 4 samples randomly selected from 410 samples.
[0034] Figure 2 Genotyping diagram of SNP loci in the SCARB2 gene. Detailed Implementation
[0035] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0036] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0037] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0038] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0039] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0040] Example
[0041] 1. Animal samples
[0042] The test chickens used in the experiment were 410 purebred Ma Huang chickens aged 77 days (provided by Guangzhou Jiangfeng Industrial Co., Ltd.), fed with corn-soybean meal feed that met international formulation standards. Blood was collected at slaughter and stored in 1.5 mL sterile centrifuge tubes containing 2% EDTA anticoagulant at -80°C for use as blood DNA extraction samples.
[0043] After slaughter and hair removal, the chicken skin surface was dried before testing. The yellowness value of the skin on the breast, back, shoulder and leg was measured using a colorimeter. Each part was measured three times and the average value was taken.
[0044] 2. Primer design
[0045] Based on the reported chicken SCARB2 gene sequence (Gene ID: 422638), with the reference genome being GRCg7b, primers were designed using NCBI Primer-BLAST, and these primers were synthesized by the Guangzhou branch of Beijing Qingke Biotechnology Co., Ltd.
[0046] The sequences of the upstream primer (F-SCARB2) and the downstream primer (R-SCARB2) are shown below (primer sequences 5'→3'):
[0047] F-SCARB2: 5'-TAGGCTGAAATCCCGTGTCG-3', SEQ ID NO.1;
[0048] R-SCARB2: 5'-GCGGCGCTTTGGATTAGTTG-3', SEQ ID NO. 2.
[0049] The above primers were used to perform PCR amplification on the test samples (amplification length 931 bp).
[0050] 3. Extract DNA from the chicken blood to be tested
[0051] Genomic DNA from all individuals was extracted according to the instructions of the NRBC BloodDNA Kit (OMEGA, D3571020000E30X009). The extracted DNA was tested for concentration and purity and then stored at -20°C for subsequent PCR amplification.
[0052] 4. SNP detection and genotyping
[0053] The primers designed and synthesized in "2. Primer Design" were used to perform PCR amplification of blood DNA, and the specificity of the primers was tested. The results are as follows: Figure 1 As shown, the same single bright band was obtained in all the samples tested, proving that the designed primers can specifically amplify the chicken SCARB2 gene.
[0054] Using genomic DNA from the blood of 410 Ma Huang chickens as a template, the chicken SCARB2 gene was amplified by PCR in the following reaction system using the primers described above: PCR Mix 7.5 μL, forward and reverse primers 0.3 μL each, DNA template 1.5 μL, and ultrapure water 5.4 μL.
[0055] Reaction procedure: 95℃ pre-denaturation for 3 min; 94℃ denaturation for 25 s, 59℃ annealing for 25 s, 72℃ extension for 1 min, 34 cycles; 72℃ final extension for 5 min; store at 4℃.
[0056] The PCR products were sent to Qingke Biotechnology Co., Ltd. for Sanger sequencing. The sequencing results showed that there was a mutation site g.49442841T>G in intron 4 of the chicken SCARB2 gene, and the nucleotide sequence of the amplified product is shown in SEQ ID NO.3.
[0057] SEQ ID NO.3:
[0058] TAGGCTGAAATCCCGTGTCGCCTGGAGAAGGCAGCACCCTGTGTGGAGTGCATCCTGGCCCTTTTCCTCCACTCGCCCCGATCCCCTCGTGCCTCTGCACAGGCACAGGGAAATCTGGGACGTCTCTTTGCATCGTCCCGGTGCCGGTACCTGCCAAAGCTGCCATCCACCCTCCAGCACCTCCCCTGCACAGTGAGGGTTCCCTTAAGTAAATCTGCACTTAGAAGTAGGAGCCAAGAGCTTTTTCCTT K CCTCTCTGGAGTTTAAGAAATTCAGCTTCCCCACCGCAGAAGATCTGTGATGTGCCACGTTTAACTTTCCCGTGTTGCAACTTCTTTCTTTCAGAGCACTGAAGAAGAAAGGTCCCCGCTCATCAGGACATAGTAATAGATCTTCTTAAATACGTGAGCTTGGAGAATAAATCATTAGAGCTTACCTAATGTCAGCTACCACTACCCAGTGTTGTCCACTGTGGAGAAACAGTCGTGTCAAGTGTAACGTTCAAAGATGGAAGAGAATCTGCACTGTCGTCAGGGGAGGAGACTTTTCTTAGCAGCTAAGTTACAACTACAAAACTACATTTTAAAACTGCTCGAGATCCCGCTTTTTTCAGCCCTGCACTCTCTTGTACCTGCACTGACACTCAGAGACGATCATAACCACTTTACCGGTGAAAATAAAATGGCCTGATTCGTTACAGAAACGACGGGTAACATTTGCAAATGGCCTTAGGAGCGTGGGCTGCAAAGAACCCTTGTAGAGATGCAGCAGGTTCCTGCGTCACTCACACACCTGCCGGTTTCCCGTAGCCTCACTGTTGTGGTTTCTGTAAAGTACTGCGCTGCTTACTGCCGGTTTGCACTGACTGTTTGTTATTAAAGTCATCGGTCCTTCCACAGACCGGATCTGTACAACTAATCCAAAGCGCCGC (Note: The bold and underlined positions in the sequence are SNP sites. This site is located at the 251st position of the sequence shown in SEQ ID NO.3, with a T>G mutation).
[0059] Sequence peak analysis was performed on the sequencing results to identify potential SNP sites, and genotyping was performed by comparing the sequencing data of each sample. The results are as follows: Figure 2 As shown, this site contains a T>G mutation, with genotypes including CC, TG, and GG.
[0060] After sequencing the amplified genomic DNA products of 410 Ma Huang chickens, the genotypes of each sequencing result were analyzed. All 410 individuals were successfully genotyped. Statistical analysis was then performed on each genotype to obtain the genotype frequency and allele frequency at that locus. The statistical results of the gene and genotype frequencies at this SNP mutation site are shown in Table 1.
[0061] Table 1. Frequency of genes and genotypes with SCARB2 gene mutation sites g. 49442841T>G.
[0062]
[0063] 5. Association analysis between SCARB2 mutation site and skin color trait in chicken carcasses
[0064] Association analysis between SNP genotypes and carcass skin color phenotype was performed using SPSS (Version 22.0) software based on a mixed linear model. The mixed linear model used is as follows:
[0065] Y = μ + G + S + L + e
[0066] Y: Phenotypic value of skin yellowness trait, μ: Population mean, G: Genotype fixed effect, S: Sex fixed effect, L: Stratum fixed effect, e: Random residual. Correction for multiple comparisons was performed using the Bonferroni method.
[0067] The percentage of phenotypic variation explained (PVE) is calculated using the following formula:
[0068]
[0069] β: effect size, MAF: minor allele frequency, se: standard error, N: sample size.
[0070] The association analysis results are shown in Table 2. The SNP locus g.49442841T>G was significantly associated with the yellowness values of the skin on the chest, back, shoulder, and leg of chickens (P<0.05). The B value represents the yellow-blue tint of an object: positive values indicate yellow, negative values indicate blue, and higher B values indicate higher yellowness. Individuals with the TT genotype had significantly higher B values on the chest, back, and legs than individuals with the TG genotype. This SNP locus can serve as an auxiliary selection and molecular genetic breeding marker for improving the yellowness of chicken skin.
[0071] Table 2. Association analysis between the SCARB2 gene mutation site g.49442841T>G and chicken carcass skin color trait.
[0072]
[0073] Note: Different lowercase letters in the same row indicate significant differences (P<0.05), while the same letter in the same row indicates no significant differences. PVE represents the percentage of SNP resolution.
[0074] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. The application of a SNP site detection reagent related to the skin color trait of euhemer chicken carcass in identifying the skin color trait of euhemer chicken carcass, characterized in that, The SNP site is located at position 251 of the nucleotide sequence shown as SEQ ID NO. 3, and there is a T>G mutation at the site, and the genotype of the SNP site includes TT, GG and TG genotypes; The carcass skin color trait refers to the skin yellowness of the chest, back and leg; The skin yellowness of the chest, back and leg of the individual with TT genotype is significantly higher than that of the individual with TG genotype.
2. The primer pair for amplifying the gene fragment in which the SNP site related to the skin color trait of euhung chicken carcass is located is applied in identifying the skin color trait of euhung chicken carcass, characterized in that, The primer pair consists of the upstream primer shown as SEQ ID NO. 1 and the downstream primer shown as SEQ ID NO. 2; The SNP site is located at position 251 of the nucleotide sequence shown as SEQ ID NO. 3, and there is a T>G mutation at the site, and the genotype of the SNP site includes TT, GG and TG genotypes; The carcass skin color trait refers to the skin yellowness of the chest, back and leg; The skin yellowness of the chest, back and leg of the individual with TT genotype is significantly higher than that of the individual with TG genotype.
3. A method for identifying chicken carcass skin color traits in a P. eurycross, comprising the steps of, The following steps are included: Using the primer pair to perform PCR amplification on the template of the chicken genomic DNA to be tested to obtain an amplification product; Sequencing the amplification product to detect the genotype of the corresponding SNP site, and judging the carcass skin color trait of the chicken to be tested according to the detected genotype; The carcass skin color trait refers to the skin yellowness of the chest, back and leg; The primer pair for amplifying the gene fragment where the SNP site related to the carcass skin color trait of the ephedrine chicken consists of the upstream primer shown as SEQ ID NO. 1 and the downstream primer shown as SEQ ID NO. 2; the SNP site is located at position 251 of the nucleotide sequence shown as SEQ ID NO. 3, and there is a T>G mutation at the site, and the genotype includes TT, GG and TG genotypes; The skin yellowness of the chest, back and leg of the individual with TT genotype is significantly higher than that of the individual with TG genotype.
4. The method of claim 3, wherein, The reaction system of the PCR amplification is: PCR Mix 7.5 μL, 0.3 μL of each of the upstream and downstream primers, 1.5 μL of DNA template, and 5.4 μL of ultrapure water.
5. The method of claim 3, wherein, The reaction program of the PCR amplification is: 95℃ pre-denaturation for 3 min; 94℃ denaturation for 25 s, 59℃ annealing for 25 s, 72℃ extension for 1 min, 34 cycles; 72℃ final extension for 5 min; 4℃ storage.
6. The primer pair for amplifying the gene fragment where the SNP site related to the carcass skin color trait of the ephedrine chicken consists of the upstream primer shown as SEQ ID NO. 1 and the downstream primer shown as SEQ ID NO. 2; Use in the selection of color traits, characterized in that, The primer pair consists of the upstream primer shown as SEQ ID NO. 1 and the downstream primer shown as SEQ ID NO. 2; The SNP site is located at position 251 of the nucleotide sequence shown as SEQ ID NO. 3, and there is a C>T mutation at the site, and the genotype includes CC, TT and CT genotypes; The carcass skin color trait refers to the skin yellowness of the chest, back and leg; The skin yellowness of the chest, back and leg of the individual with TT genotype is significantly higher than that of the individual with TG genotype.
7. The application of a SNP site detection reagent related to the skin color trait of euhnu chicken carcass in the selection of the skin color trait of euhnu chicken carcass, characterized in that, The SNP site is located at position 251 of the nucleotide sequence shown as SEQ ID NO. 3, and there is a T>G mutation at the site, and the genotype includes TT, GG and TG genotypes; The carcass skin color trait refers to the yellowness value of the skin of the chest, back and leg; The yellowness value of the skin of the chest, back and leg of the TT genotype individual is significantly higher than that of the TG genotype individual.
Citation Information
Patent Citations
Chicken skin yellowness related LncEDCH1 gene molecular marker and application thereof
CN116814801A
CYP2C18 gene molecular marker related to chicken carcass skin color traits and application of CYP2C18 gene molecular marker
CN118006795A