KASP molecular marker primer combination for detecting bitter gourd wilt resistance, detection method and application

Abstract

The invention provides a KASP molecular marker primer combination for detecting bitter gourd wilt resistance, a detection method and application, and belongs to the technical field of molecular markers. According to the invention, a KASP-1559 molecular marker primer combination is designed aiming at the 22791559 SNP site on the third chromosome of the bitter gourd, and the KASP-1559 molecular marker primer combination is as shown in SEQ ID NO.1-3; a KASP-5409 molecular marker primer combination is designed aiming at the 22885409 SNP site on the third chromosome of the bitter gourd, and the KASP-5409 molecular marker primer combination is shown as SEQ ID NO.4-6. The molecular marker primer combination disclosed by the invention can be used for rapidly identifying the resistance of the bitter gourd to the fusarium wilt, has the advantages of accuracy, rapidness, low cost, short identification period, simplicity and convenience in operation and the like, can assist in breeding of new varieties of the bitter gourd, and has a wide application prospect.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular markers, and in particular to a KASP molecular marker primer combination for detecting the resistance to bitter gourd fusarium wilt, a detection method and applications thereof. Background Art

[0002] Bitter gourd fusarium wilt is a soil-borne disease caused by Fusarium oxysporum f.sp.momordicae, which can infect the vascular system of plants, resulting in blocked ducts and hindered nutrient absorption, and finally the whole plant wilts and dies. Its pathogen can survive in the soil for a long time and has strong pathogenicity, seriously affecting the yield of bitter gourd, and the yield reduction can reach more than 30%. For a long time, breeding and planting disease-resistant varieties have played an important role in controlling bitter gourd fusarium wilt. Developing molecular markers for detecting the resistance to bitter gourd fusarium wilt has important application value in screening germplasm resources resistant to fusarium wilt and rapidly identifying fusarium wilt-resistant plants during the breeding process.

[0003] KASP (Kompetitive Allele-Specific PCR) achieves genotyping by specifically recognizing gene loci with fluorescent probes, and can be used to detect SNP loci and InDel loci. Compared with molecular markers such as SSR, RFLP, and InDel, KASP markers have the characteristics of rapid detection, low cost, and easy large-scale application. KASP markers do not require genotyping based on the size of DNA fragments, and can get rid of the relatively cumbersome steps and low throughput of traditional gel electrophoresis detection methods, and are suitable for high-throughput molecular detection platforms. Therefore, identifying functional SNP loci related to the resistance to bitter gourd fusarium wilt and developing KASP molecular markers for the resistance to bitter gourd fusarium wilt suitable for high-throughput molecular detection platforms have important application value for improving the breeding efficiency and breeding level of bitter gourd in China. Summary of the Invention

[0004] In view of this, the present invention provides a primer combination, a detection method and applications of KASP molecular markers related to the resistance to bitter gourd fusarium wilt, which can be used to identify or assist in identifying the resistance to bitter gourd fusarium wilt, provide excellent gene resources and selection tools for the molecular breeding of fusarium wilt-resistant bitter gourd, and improve the breeding efficiency.

[0005] In order to achieve the above-mentioned invention purposes, the present invention provides the following technical solutions:

[0006] The present invention provides a molecular marker primer combination for detecting the resistance to bitter gourd fusarium wilt, including two specific upstream primers and a downstream primer. The sequence of the first upstream primer KASP-1559F is shown as SEQ ID NO.1, the sequence of the second upstream primer KASP-1559H is shown as SEQ ID NO.2, and the sequence of the downstream primer KASP-1559R is shown as SEQ ID NO.3 (KASP-1559 molecular marker primer combination).

[0007] The present invention also provides a molecular marker primer combination for detecting the resistance to bitter gourd fusarium wilt, including two specific upstream primers and a downstream primer. The sequence of the first upstream primer KASP-5409F is shown as SEQ ID NO.4, the sequence of the second upstream primer KASP-5409H is shown as SEQ ID NO.5, and the sequence of the downstream primer KASP-5409R is shown as SEQ ID NO.6 (KASP-5409 molecular marker primer combination).

[0008] Preferably, the 5' end of the first upstream primer is linked with a FAM fluorescent group tag sequence, and the 5' end of the second upstream primer is linked with a HEX fluorescent group tag sequence.

[0009] The present invention also provides a kit for detecting KASP molecular markers related to the resistance to bitter gourd fusarium wilt, including the above-mentioned molecular marker primer combination.

[0010] The present invention also provides a method for identifying the resistance to bitter gourd fusarium wilt, including the following steps:

[0011] S1. Extract the genomic DNA of the bitter gourd sample to be tested;

[0012] S2. Using the genomic DNA of the bitter gourd sample to be tested as a template, perform PCR amplification with the above-mentioned molecular marker primer combination to obtain a PCR product;

[0013] S3. Perform gene typing on the PCR product:

[0014] If the KASP-1559 molecular marker primer combination is used for amplification, genotypes G:G and G:C are determined as disease-resistant types; genotype C:C is determined as disease-susceptible type;

[0015] If the KASP-5409 molecular marker primer combination is used for amplification, genotypes C:C and T:C are determined as disease-resistant types; genotype T:T is determined as disease-susceptible type.

[0016] Preferably, the reaction system for PCR amplification is as follows: 5 μL of 2× MasterMix for ASPCR, 2 μL of genomic DNA of Momordica charantia to be tested, 0.1 μL of the first upstream primer, 0.1 μL of the second upstream primer, 0.3 μL of the downstream primer, and 2.5 μL of ddH2O.

[0017] Preferably, the reaction procedure for PCR amplification is as follows: 95°C for 10 min; 95°C for 20 s, 61°C for 40 s, 10 cycles with a decrease of 0.6°C per cycle; 95°C for 20 s, 55°C for 40 s, 25 cycles; 30°C for 30 s.

[0018] The present invention also provides the application of the molecular marker primer combination in at least one of the following:

[0019] (1) Application in identifying or assisting in identifying the resistance of Momordica charantia to Fusarium wilt;

[0020] (2) Application in preparing a kit for identifying the resistance of Momordica charantia to Fusarium wilt;

[0021] (3) Application in molecular marker-assisted breeding of Momordica charantia.

[0022] The present invention also provides the application of the kit in at least one of the following:

[0023] (1) Application in identifying or assisting in identifying the resistance of Momordica charantia to Fusarium wilt;

[0024] (2) Application in molecular marker-assisted breeding of Momordica charantia.

[0025] By adopting the above technical solutions, the present invention has the following beneficial effects: The present invention designs the KASP-1559 molecular marker primer combination for the SNP locus at position 22791559 on chromosome 3 of Momordica charantia, as shown in SEQ ID NO.1-3; designs the KASP-5409 molecular marker primer combination for the SNP locus at position 22885409 on chromosome 3 of Momordica charantia, as shown in SEQ ID NO.4-6. The molecular marker primer combination of the present invention can quickly identify the resistance of Momordica charantia to Fusarium wilt, and has the advantages of accuracy, rapidity, low cost, short identification cycle, simple operation, etc., and can assist in the breeding of new varieties of Momordica charantia, with broad application prospects. Description of the Drawings

[0026] Figure 1 It is a detection result diagram of the KASP-1559 molecular marker for the allelic genotypes related to the resistance of the F2 enlarged population to Fusarium wilt.

[0027] Figure 2 It is a detection result diagram of the KASP-5409 molecular marker for the allelic genotypes related to the resistance of the F2 enlarged population to Fusarium wilt. Detailed implementation mode

[0028] The technical solutions provided by the present invention will be described in detail below in conjunction with embodiments, but they cannot be understood as limiting the protection scope of the present invention.

[0029] Example 1. Primer design

[0030] The experimental materials used in the molecular marker development work are the highly inbred susceptible material Mc131 of bitter gourd and the highly inbred resistant material Mc176 of bitter gourd (Mc131 is a local variety from Vietnam, and Mc176 is a local variety from Nepal, both introduced in 2017). Using Mc131 as the female parent and Mc176 as the male parent to hybridize to obtain the F1 generation, and the F1 generation self-crosses to obtain the F2 generation. After the resistance identification of bitter gourd fusarium wilt, highly resistant and highly susceptible single plants are selected from the F2 generation segregating population to form a resistant pool and a susceptible pool.

[0031] 1. Preparation of bitter gourd fusarium wilt bacterial liquid

[0032] Transfer the special type "4501" of Fusarium oxysporum f. sp. momordicae to a potato dextrose agar medium plate, and place the plate in an incubator at a constant temperature of 28°C for 7 - 12 days. After the Fusarium oxysporum fills the plate, use a sterile punch to take a 1 cm diameter fungal cake, transfer the fungal cake to a sterilized potato dextrose broth liquid medium, and place the liquid medium in a shaker at 26°C and 120 r·min -1 and shake culture for 7 days. After the shake culture ends, filter the mycelium with a double-layer sterilized medical gauze. Take 10 μL of the Fusarium oxysporum mother liquor, record the spore number under the microscope using a hemocytometer and calculate the mother liquor concentration, and dilute the mother liquor with sterile water to prepare a spore suspension with a concentration of 1×10 6 cfu·mL -1 concentration. This spore suspension is used for later inoculation of bitter gourd seedlings.

[0033] 2. Inoculation and resistance grading of bitter gourd fusarium wilt

[0034] The inoculation of Fusarium wilt pathogen and the disease condition identification were carried out using the precise identification and evaluation system for bitter gourd Fusarium wilt established by our research group (Ling Yi et al., Physiological research on bitter gourd resistance to Fusarium wilt and construction of an identification and evaluation system. 2024). After soaking the bitter gourd seeds of the fourth generation in warm water at 55°C for 8 h, they were wrapped with sterile moist double-layer gauze on the upper and lower layers and placed in an incubator at 28°C for germination. After the seeds germinated, they were sown in small flower pots with a size of 7 cm × 7 cm × 8 cm filled with sterilized substrate soil. One germinated bitter gourd seed was sown in each flower pot. When the bitter gourd seedlings grew to the stage of two leaves and one heart, the root irrigation inoculation method was used to inoculate Fusarium oxysporum. A disposable syringe was used to inject the bacterial solution into the soil at the base of the bitter gourd stem, and the inoculation amount of the bacterial solution for each bitter gourd seedling was 20 mL. The fourth-generation bitter gourd after inoculation was cultured in a plant culture room with a stable environment (temperature 28 ± 1°C, day-night light duration 16 h / 8 h, relative humidity 80-85%).

[0035] Twenty-five days after inoculation, the number of diseased plants and the disease condition of bitter gourd in each generation population were investigated, and the disease index was calculated. The disease index formula is DI = Σ (number of diseased plants × representative value of this level) / (total number of plants × representative value of the highest level) × 100. According to the disease index, the disease-resistant phenotypes of the generation population were given as follows: highly resistant (HR): DI < 10; resistant (R): 10 ≤ DI < 30; moderately resistant (MR): 30 ≤ DI < 50; susceptible (S): 50 ≤ DI < 70; highly susceptible (HS): DI ≥ 70. The disease grading standard is shown in Table 1.

[0036] Table 1 Disease grading table for bitter gourd Fusarium wilt

[0037] Disease grading Symptoms Grade 0 No symptoms Grade 1 Cotyledon wilting or slight wilting of some cotyledons and true leaves Grade 2 Wilting of 1 true leaf or severe wilting of cotyledons (≤60%) Grade 3 Wilting of cotyledons and some true leaves (>60%) Grade 4 Whole plant wilting (>60%), heart leaf alive Grade 5 Whole plant dead

[0038] 3. Sample collection and DNA extraction

[0039] After the resistance identification work was completed, highly resistant and highly susceptible single plants to Fusarium wilt were selected from the F2 generation segregation population to form a resistant pool and a susceptible pool as experimental material samples. The leaves of the experimental material samples were collected, placed in 2 mL centrifuge tubes, quickly frozen with liquid nitrogen, and stored in a -80°C refrigerator. Before the experiment, the cotyledons were ground into powder using a leaf grinder, and DNA was extracted using the CTAB method. The specific procedure is as follows:

[0040] (1) Set the oven at 65°C in advance and soak the small steel beads in ethanol.

[0041] (2) Preheat the CTAB extraction solution in the oven at 65°C.

[0042] (3) Add small steel beads to the centrifuge tube containing the cotyledon samples, and use the grinder to grind them. The time and frequency are set to 45 Hz for 30 s.

[0043] (4) Check whether the centrifuge tube is broken. Add 750 μL of CTAB extraction solution and mix vigorously. Heat in an oven at 65 °C for 1 h, and invert and mix every 15 min during this period.

[0044] (5) Cool the centrifuge tube to room temperature. Add 750 μL of a chloroform:isoamyl alcohol mixture with a volume ratio of 24:1 in a fume hood, mix slowly for 3 min, then let it stand for 5 min, and centrifuge at 12000 r for 10 min.

[0045] (6) Use a pipette to aspirate approximately 550 μL of the supernatant into a new centrifuge tube. Add another 750 μL of chloroform and isoamyl alcohol with a volume ratio of 24:1, let it stand for 5 min, and centrifuge at 12000 r for 10 min.

[0046] (7) Use a pipette to aspirate 450 μL of the supernatant into a 1.5 mL centrifuge tube, and add twice the volume of pre-cooled isopropanol. Gently invert and mix.

[0047] (8) Place the centrifuge tube in a -20 °C refrigerator for 1 h, then centrifuge at 10000 r for 3 min, and discard the supernatant.

[0048] (9) Add 600 μL of 70% ethanol for washing, let it stand for 10 - 20 min, and centrifuge at 10000 r for 2 min.

[0049] (10) Repeat step (9).

[0050] (11) Open the centrifuge tube lid and place it in a fume hood overnight to volatilize.

[0051] (12) Add 50 μL of ddH2O to dissolve the DNA.

[0052] (13) Use a ultra-micro spectrophotometer to detect the DNA concentration and quality, and then store the DNA in a -20 °C refrigerator.

[0053] 4. SNP Locus Selection

[0054] Based on the candidate interval of bitter gourd fusarium wilt resistance gene (chr3: 22000001-23840000) determined by BSA-seq, the SNP locus most significantly associated with bitter gourd fusarium wilt resistance within this interval was selected for further analysis. The SNP locus at position 22791559 on chromosome 3 of the bitter gourd genome was selected for design. There is a base mutation of C / G at this SNP locus, and the corresponding genotypes include G:G, G:C, and C:C. Among them, the G:G and G:C genotypes show disease-resistant genotypes, and the C:C genotype shows a disease-susceptible genotype. In addition, the SNP locus at position 22885409 on chromosome 3 of the bitter gourd genome was also selected for design. There is a base mutation of T / C at this SNP locus, and the corresponding genotypes include T:T, T:C, and C:C. Among them, the C:C and T:C genotypes show disease-resistant genotypes, and the T:T genotype shows a disease-susceptible genotype.

[0055] 4. Develop KASP markers for the SNP locus and design primer sets for detecting this marker

[0056] Develop KASP markers for molecular marker-assisted selection breeding.

[0057] The KASP primers for the SNP locus at position 22791559 on chromosome 3 of the bitter gourd genome consist of two upstream primers, KASP-1559F and KASP-1559H, and one downstream primer, KASP-1559R.

[0058] KASP-1559F: 5’- GAAGGTGACCAAGTTCATGCT ATGTTTATAGTTAT GGGATGTTGGTTCTTC-3’ (SEQ ID NO.1);

[0059] KASP-1559H: 5’- GAAGGTCGGAGTCAACGGATT TGTTTATAGTTAT GGGATGTTGGTTCTTG-3’ (SEQ ID NO.2);

[0060] KASP-1559R: 5’-CTCCATCTTTCTCACTCTCTGCAAGA-3’ (SEQ ID NO.3).

[0061] KASP-1559F is a primer with a FAM fluorescent label sequence (underlined bases) at the 5’ end. It amplifies the fragment of the SNP locus with C together with the downstream primer KASP-1559R, and the fluorescence signal of the FAM group can be read by a microplate reader or a fluorescence quantitative instrument;

[0062] KASP-1559H is a primer with a HEX fluorescent tag sequence (underlined bases) at the 5'-end, and KASP-1559R amplifies the fragment with G at this SNP locus. The fluorescent signal of the HEX group can be read by a microplate reader or a real-time fluorescence quantitative PCR instrument.

[0063] The amplification sequences of this molecular marker primer set are shown in SEQ ID NO.7 and SEQ ID NO.8:

[0064]

[0065] The KASP primers at the SNP locus at position 22,885,409 on chromosome 3 of the bitter gourd genome consist of two upstream primers KASP-5409F, KASP-5409H and one downstream primer KASP-5409R.

[0066] KASP-5409F: GAAGGTGACCAAGTTCATGCT ACCACCGATCTTTTTA GCCTCTT (SEQ IDNO.4);

[0067] KASP-5409H: GAAGGTCGGAGTCAACGGATT ACCACCGATCTTTT TAGCCTCTC (SEQ IDNO.5);

[0068] KASP-5409R: TGATCCTGATGCCACAGACTGC (SEQ ID NO.6).

[0069] KASP-5409F is a primer with a FAM fluorescent tag sequence (underlined bases) at the 5'-end, and it amplifies the fragment with T at this SNP locus with the downstream primer KASP-5409R. The fluorescent signal of the FAM group can be read by a microplate reader or a fluorescence quantitative instrument;

[0070] KASP-5409H is a primer with a HEX fluorescent tag sequence (underlined bases) at the 5'-end, and it amplifies the fragment with C at this SNP locus with KASP-5409R. The fluorescent signal of the HEX group can be read by a microplate reader or a real-time fluorescence quantitative PCR instrument.

[0071] The amplification sequences of this molecular marker primer set are shown in SEQ ID NO.9 and SEQ ID NO.10:

[0072]

[0073] Example 2. Establishment of a detection method for the resistance of bitter gourd to Fusarium wilt

[0074] An F2 enlarged population obtained by crossing Mc176 as the male parent and Mc131 as the female parent and then self-crossing was used for molecular marker verification.

[0075] Sow 585 plants in the F2 large population, pick cotyledon samples, extract the genomic DNA of the bitter gourd to be tested using the CTAB method, inoculate Fusarium oxysporum f. sp. momordicae at the two-leaf and one-heart stage, and conduct phenotypic identification 25 days after inoculation to obtain the phenotypic data of the F2 large population.

[0076] After extracting the DNA of the enlarged population, use a ultra-micro spectrophotometer to detect the DNA concentration, and dilute the sample DNA to 50 ng·μL with ddH2O -1 , and use the KASP-1559 primer pair and the KASP-5409 primer pair for amplification respectively. The total volume of the KASP reaction is 10 μL, and the reaction system is shown in Table 2.

[0077] Table 2 KASP reaction system

[0078]

[0079]

[0080] The PCR program for the KASP reaction is: 95°C for 10 min; 95°C for 20 s, 61°C for 40 s (10 cycles, with a decrease of 0.6°C per cycle); 95°C for 20 s, 55°C for 40 s, 25 cycles; 30°C for 30 s.

[0081] After the amplification is completed, perform fluorescence scanning and read the fluorescence values for genotyping. The excitation wavelength of FAM is 485 nm, and the emission wavelength is 520 nm. The excitation wavelength of HEX is 535 nm, and the emission wavelength is 556 nm. The excitation wavelength of the system reference fluorescence ROX is 575 nm, and the emission wavelength is 610 nm.

[0082] When using the KASP-1559 primer set for amplification, if only the fluorescence signal of the HEX group is shown, the genotype of the SNP locus of the bitter gourd to be tested is GG (that is, the SNP locus in the genome is a homozygous type of G); if only the fluorescence signal of the FAM group is shown, the genotype of the SNP locus of the bitter gourd to be tested is CC (that is, the SNP locus in the genome is a homozygous type of C); if both the fluorescence signal of the FAM group and the fluorescence signal of the HEX group are shown, the genotype of the SNP locus of the bitter gourd to be tested is G:C (that is, the SNP locus in the genome is a heterozygous type of G and C).

[0083] When amplified using the KASP-5409 primer set, if only the fluorescence signal of the HEX group is shown, the genotype of the SNP locus of the bitter gourd to be tested is CC (i.e., the homozygous type of C at this SNP locus in the genome); if only the fluorescence signal of the FAM group is shown, the genotype of the SNP locus of the bitter gourd to be tested is TT (i.e., the homozygous type of T at this SNP locus in the genome); if both the fluorescence signal of the FAM group and the HEX group are shown, the genotype of the SNP locus of the bitter gourd to be tested is T:C (i.e., the heterozygous type of T and C at this SNP locus in the genome).

[0084] In the large population, the 0-level individual plants with the same genotype as the disease-resistant parent Mc176 were classified as effective disease-resistant individual plants, and the genotype was assigned as A. The 5-level individual plants with the same genotype as the susceptible parent Mc131 were classified as effective susceptible individual plants, and the genotype was assigned as B. All heterozygotes with disease resistance levels were classified as effective individual plants, and the genotype was assigned as H. Those that could not be defined or had no signal were replaced with "-" (Table 3).

[0085] Table 3 Genotyping results of the F2 large population

[0086]

[0087]

[0088]

[0089]

[0090]

[0091]

[0092]

[0093]

[0094]

[0095]

[0096]

[0097] Table 4 Concordance rate of 2 KASP markers in the F2 large population

[0098] KASP marker Coincidence rate (%) Coincidence rate of Grade 0 and Grade 5 (%) KASP-1559 67.67 86.18 KASP-5409 66.96 85.82

[0099] The coincidence rate is the result calculated from all individual plants in the large population of F2(585). Since fusarium wilt is a quantitative trait and the disease resistance performance of fusarium wilt shows continuity, the molecular marker coincidence rate is analyzed and calculated by combining the extremely resistant (level 0 and level 5) fusarium wilt resistance performance with the genotype.

[0100] The results show that the coincidence rates of the two KASP molecular markers are both greater than 65%, and the locus with the highest coincidence rate is chr3-22791559; the coincidence rates of the two KASP molecular markers in individual plants with disease resistance levels of 0 and 5 are both greater than 80%. Among them, the coincidence rate of the KASP-1559 marker is 86.18%, and the coincidence rate of the KASP-5409 marker is 85.82%. This indicates that the KASP molecular marker primers of the present invention can quickly and accurately identify the resistance of bitter gourd to fusarium wilt.

[0101] As can be seen from the above embodiments, the present invention provides a KASP molecular marker primer combination, a detection method and an application for detecting the resistance of bitter gourd to fusarium wilt. The KASP molecular marker primers of the present invention can quickly and accurately identify the resistance of bitter gourd to fusarium wilt.

[0102] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. A molecular marker primer combination for detecting the resistance of bitter gourd to Fusarium wilt, characterized in that, It includes two specific upstream primers and a downstream primer. The sequence of the first upstream primer KASP-1559F is shown as SEQ ID NO.1, the sequence of the second upstream primer KASP-1559H is shown as SEQ ID NO.2, and the sequence of the downstream primer KASP-1559R is shown as SEQ ID NO.

3.

2. Molecular marker primer combination for detecting bitter gourd fusarium wilt resistance, characterized in that, It includes two specific upstream primers and a downstream primer. The sequence of the first upstream primer KASP-5409F is shown as SEQ ID NO.4, the sequence of the second upstream primer KASP-5409H is shown as SEQ ID NO.5, and the sequence of the downstream primer KASP-5409R is shown as SEQ ID NO.

6.

3. The molecular marker primer combination according to claim 1 or 2, characterized in that, The 5' end of the first upstream primer is linked with a FAM fluorophore tag sequence, and the 5' end of the second upstream primer is linked with a HEX fluorophore tag sequence.

4. A kit for detecting the resistance of balsam pear to Fusarium wilt, characterized in that, It includes the molecular marker primer combination described in any one of claims 1 to 3.

5. A method for identifying the resistance of bitter gourd to Fusarium wilt, characterized in that, It includes the following steps: S1. Extract the genomic DNA of the bitter gourd sample to be tested. S2. Using the genomic DNA of the bitter gourd sample to be tested as a template, perform PCR amplification with the molecular marker primer combination described in claim 1 or 2 to obtain a PCR product. S3. Perform genotyping on the PCR product: If the molecular marker primer combination described in claim 1 is used for amplification, genotypes G:G and G:C are determined as disease-resistant types; genotype C:C is determined as disease-susceptible type. If the molecular marker primer combination described in claim 2 is used for amplification, genotypes C:C and T:C are determined as disease-resistant types; genotype T:T is determined as disease-susceptible type.

6. The identification method according to claim 5, characterized in that, The reaction system for the PCR amplification is: 2×Master Mix for ASPCR 5 μL, genomic DNA of the bitter gourd to be tested 2 μL, the first upstream primer 0.1 μL, the second upstream primer 0.1 μL, the downstream primer 0.3 μL, ddH2O 2.5 μL.

7. The identification method according to claim 6, wherein The reaction program for the PCR amplification is: 95°C for 10 min; 95°C for 20 s, 61°C for 40 s, 10 cycles, with a decrease of 0.6°C per cycle; 95°C for 20 s, 55°C for 40 s, 25 cycles; 30°C for 30 s.

8. Application of the molecular marker primer combination described in claim 1 or 2 in at least one of the following: (1) Application in identifying or assisting in identifying the resistance to bitter gourd fusarium wilt; (2) Application in preparing a kit for identifying the resistance to bitter gourd fusarium wilt; (3) Application in molecular marker-assisted breeding of bitter gourd.

9. Application of the kit described in claim 3 in at least one of the following: (1) Application in identifying or assisting in identifying the resistance to bitter gourd fusarium wilt; (2) Application in molecular marker-assisted breeding of bitter gourd.

Images