InDel molecular marker related to short fruit character of bitter gourd fruit and application of InDel molecular marker
By developing InDel molecular markers related to the short fruit trait of bitter gourd, and using electrophoresis technology to identify bitter gourd fruit type at the seedling stage, the problem of lagging breeding process was solved, and rapid screening and efficient breeding were achieved.
Patent Information
- Application Number
- CN202511168965.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-20
- Publication Date
- 2025-11-07
AI Technical Summary
Existing technologies make it difficult to efficiently and accurately locate the genetic loci for the length of bitter gourd fruits, resulting in a delay in the breeding process. Furthermore, traditional breeding methods rely on morphological measurements after the fruit matures, which prolongs the breeding cycle.
We developed InDel molecular markers related to the short fruit trait of bitter melon, and used electrophoresis to detect InDel at the seedling stage. We then used specific primers L070 and L901 to identify the fruit type of bitter melon, achieving rapid screening.
Rapid screening of short-fruited bitter gourd during the seedling stage saves breeding costs, improves breeding efficiency, and shortens the breeding cycle.
Smart Images

Figure CN120905429A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of plant molecular genetics, and relates to mining of specific InDel molecular markers, in particular to an InDel molecular marker related to the short fruit trait of Momordica charantia and application thereof in fruit type identification of seedling Momordica charantia BACKGROUND
[0002] Short fruit Momordica charantia (fruit length < 30 cm) has shown significant advantages in modern agriculture due to its unique agronomic traits and commodity properties. Morphologically, its typical characteristics include spindle-shaped or short-conical fruit shape, thick and dense tuberculate protrusions, thick flesh, and mild bitterness, which are more suitable for diversified consumption scenarios such as fresh salad and tea processing. In terms of production adaptability, short fruit varieties have low node position of female flowers (8-12 nodes), early maturity (about 90 days from planting to harvesting), strong tolerance to heat and humidity, etc. For example, Hainan "Qiong No. 3" can still maintain a high yield of 3,500-4,000 kg / 667 m 2 under the environment of daily mean temperature > 30℃ and humidity > 80%, which is 18-26% higher than that of traditional varieties, effectively alleviating the supply pressure in the summer and autumn "vegetable off-season" in tropical regions. In addition, its compact plant type is suitable for high-density vertical cultivation and facility agriculture. For example, "Apple Momordica charantia" in Xiangyang area increases yield by 25% through greenhouse dense planting, shortens the harvesting period, and significantly improves the land multiple cropping index. In terms of value extension of the industrial chain, short fruit Momordica charantia has excellent performance in deep processing due to its high dry matter content and dense flesh. For example, "Hualian No. 7" in Hualian Agricultural Improvement Field has a 12% higher flavonoid retention rate when processed into Momordica charantia tea than long fruit varieties. Its low surface area to volume ratio facilitates postharvest preservation (1-MCP treatment can reduce the rot rate by 20%), supporting the development of low-sugar drinks and geographical indication brands (such as Nanning Wutang Momordica charantia).
[0003] Although short fruit Momordica charantia has significant advantages, its genetic selection and breeding face multiple challenges. Fruit length is a typical quantitative trait (QTL) that is regulated by multiple genes and is easily affected by the environment. In 2018, Peng Jiazhu used InDel markers to construct a genetic map of Momordica charantia, and successfully located QTLs for male flower node position, but failed to resolve the fruit length locus. The main reason is that the map density is insufficient (average marker spacing is 7.80 cM), leading to the missed detection of micro-effect QTLs. Existing studies have shown that QTLs controlling fruit length require high-density markers with a spacing of < 1 cM for accurate positioning. The incomplete reference genome of Momordica charantia (such as the Dali-11_v1.0 version assembly still has gaps) further limits the positioning accuracy. Conventional hybrid breeding requires multiple generations of self-pollination for purification (cycle of 3-5 years), and the phenotype selection relies on morphological measurement of fruit maturity (fruit length, fruit shoulder width, etc.), which leads to a lag in the breeding process. For example, Momordica charantia color breeding requires the appearance of commercial maturity (about 20 days after flowering), which significantly prolongs the breeding cycle.
[0004] In summary, developing the short fruit type balsam pear specific InDel molecular marker is the key path to solve the low efficiency of traditional breeding and break the bottleneck of complex trait genetic analysis, which will provide core technical support for balsam pear molecular design breeding. SUMMARY
[0005] In view of the deficiencies of the prior art, the purpose of the present application is to provide a balsam pear fruit short fruit trait related InDel molecular marker and its application. The molecular marker of the present application can be used for InDel detection on the electrophoresis technology platform, which is simple and convenient, and can realize rapid screening of balsam pear fruit short fruit at the seedling stage, saving the breeding cost of seed selection.
[0006] The present application is realized by the following technical solutions:
[0007] A balsam pear fruit short fruit trait related InDel molecular marker, the molecular marker is located at the 22136954 site of the 6th chromosome of balsam pear, and is marked as molecular marker L070;
[0008] And / or, the molecular marker is located at the 22076609 site of the 6th chromosome of balsam pear, and is marked as molecular marker L901.
[0009] Further, the nucleotide sequence of the molecular marker L070 is shown in SEQ ID NO. 1, and 23 bases are inserted after the 235th base T from the 5' end of the sequence shown in SEQ ID NO. 1, and the inserted base sequence is TATTTAAGATTTTAACCGATGCT (SEQ InDel-L070).
[0010] Further, the nucleotide sequence of the molecular marker L901 is shown in SEQ ID NO. 2, and 17 bases are inserted after the 479th base A from the 5' end of the sequence shown in SEQ ID NO. 2, and the inserted base sequence is AACATTGAACTTT TAGA (SEQ InDel-L901).
[0011] Further, the present application protects the application of the above-mentioned balsam pear fruit short fruit trait related InDel molecular marker in identifying balsam pear as long fruit type or short fruit type at the seedling stage.
[0012] Further, the present application also protects the specific primer containing the above-mentioned InDel molecular marker L070, and the specific primer is L070-F / DR, and the nucleotide sequence is shown in SEQ ID NO. 3 and SEQ ID NO. 4.
[0013] Further, the application also protects specific primers comprising the above-mentioned InDel molecular marker L901, the specific primers are L901-F / R, the nucleotide sequences of which are shown as SEQ ID NO. 5 and SEQ ID NO. 6.
[0014] Further, the application protects the application of the above-mentioned specific primers in identifying Momordica charantia as long fruit type or short fruit type at seedling stage, and the specific application comprises the following steps:
[0015] Using primer L070-F / DR to scan F2 generation single plants with Momordica charantia genomic DNA as a template, when the amplified band is 250bp, the plant is a short fruit type plant; when the amplified band is 227bp, the plant is a long fruit type plant;
[0016] and / or, using primer L901-F / R to scan F2 generation single plants with Momordica charantia genomic DNA as a template. When the amplified band is 188bp, the plant is a short fruit type plant, and when the amplified band is 171bp, the plant is a long fruit type plant.
[0017] Further, the application also protects a kit comprising the above-mentioned specific primers.
[0018] Further, the application also protects the application of the kit in identifying Momordica charantia as long fruit type or short fruit type at seedling stage.
[0019] Further, the application also protects a method for identifying Momordica charantia as long fruit type or short fruit type at seedling stage, which comprises the following steps:
[0020] PCR amplification is performed on the genomic DNA of the tested Momordica charantia sample by using primer L070-DF / DR, and the PCR amplification product is sequenced, when SEQ InDel-L070 insertion is detected after the 22136954th base at the 5' end of chr06, the sample is a short fruit type plant, and when there is no SEQ InDel-L070 insertion, the sample is a long fruit type plant;
[0021] and / or, PCR amplification is performed on the genomic DNA of the tested Momordica charantia sample by using primer L901-DF / DR, and the PCR amplification product is sequenced, when SEQ InDel-L901 insertion is detected after the 22076609th base C at the 5' end of chr06, the sample is a short fruit type plant, and when there is no SEQ InDel-L901 insertion, the sample is a long fruit type plant;
[0022] The L070-DF sequence is shown as SEQ ID NO. 7; the L070-DR sequence is shown as SEQ ID NO. 4; the L901-DF sequence is shown as SEQ ID NO. 8; the L901-DR sequence is shown as SEQ ID NO. 9; the sequence of SEQ InDel-L070 is TATTTAAGATTTTAACCGATGCT; and the sequence of SEQ InDel-L901 is AACATTGAACTTTTAGA.
[0023] Compared with the prior art, the present application has the following beneficial effects:
[0024] The present application selects long fruit type balsam pear inbred line "23C57" and short fruit type balsam pear inbred line "23C58" as parent materials, constructs a genetic population containing four generations (P1, P2, F1 and F2), detects the genetic locus controlling the fruit type of balsam pear by BSA positioning combined with linkage positioning method, and develops a molecular marker closely linked thereto. The InDel molecular marker site mined by the present application is different from the annotation gene of the homologous short fruit gene reported in the past in Cucurbitaceae species. The research results of the present application can provide a theoretical basis and molecular marker resources for balsam pear fruit type molecular breeding. BRIEF DESCRIPTION OF DRAWINGS
[0025] Figure 1 It is a polymorphism detection result diagram of the InDel marker;
[0026] Among them, A is the polymorphism detection of L070 locus between parents and F1 generation; B is the polymorphism detection of L901 locus between parents and F1 generation;
[0027] Figure 2 It is a sequencing detection diagram of InDel locus in parents and F2 generation, that is, if diagram;
[0028] Among them, A is the sequence detection of L901 locus in parents and F2; B is the sequence detection of L070 locus in parents and F2;
[0029] Figure 3 It is a result diagram of scanning part of F2 single plants using InDel marker;
[0030] Among them, A is scanning 17 single plants in F2 using L070 marker; B is scanning 39 single plants in F2 using L901 marker;
[0031] Figure 4 It is a fruit picture of F2 single plant with a single band in Example 3 of the present application. DETAILED DESCRIPTION
[0032] The present application will be described in detail below in combination with specific examples.
[0033] Test materials:
[0034] In specific embodiments of the present application, long fruit type Momordica charantia inbred line '23C57' and short fruit type Momordica charantia inbred line '23C58' are used as parent materials, four genetic populations containing three generations (P1 (23C57), P2 (23C58), F1, F2) are constructed, a genetic locus controlling fruit type of Momordica charantia is detected by BSA positioning combined with linkage positioning method, and a molecular marker tightly linked thereto is developed.
[0035] Example 1: Screening of InDel loci
[0036] 1. Single plant DNA extraction
[0037] The stem tips of Momordica charantia branches are stored in a -70°C refrigerator after being frozen in liquid nitrogen, and then single plant DNA extraction is performed. The DNA is extracted by a modified CTAB method, and the specific steps of DNA extraction are as follows:
[0038] (1) Preheat the previously prepared 2% CTAB extraction solution in a 65°C water bath, preheat the sample in a mortar while preheating, add liquid nitrogen to grind to powder, and transfer the powder to a pre-cooled 2 mL centrifuge tube;
[0039] (2) Add 700 μL of CTAB extraction solution to the centrifuge tube, shake well, and place in a 65°C water bath for 40 min, shake several times every 10 min;
[0040] (3) Add 700 μL of 24:1 (volume ratio of chloroform:isoamyl alcohol), mix well, and place in a 4°C refrigerator for 10 min, then centrifuge at 10000 r / min for 10 min;
[0041] (4) Take 500 μL of supernatant into a new centrifuge tube, add 500 μL of 2% CTAB extraction solution, mix well, and place in a 65°C water bath for 30 min, shake several times every 10 min;
[0042] (5) Add 500 μL of 25:24:1 (volume ratio of water-saturated phenol:chloroform:isoamyl alcohol), mix well, and place in a 4°C refrigerator for 10 min, then centrifuge at 10000 r / min for 10 min;
[0043] (6) Take 400 μL of supernatant, add an equal volume (400 μL) of 24:1 (volume ratio of chloroform:isoamyl alcohol), mix well, and place in a 4°C refrigerator for 10 min, then centrifuge at 10000 r / min for 10 min;
[0044] (7) Take 300 μL supernatant, add equal volume (300 μL) of pre-cooled isopropyl alcohol, mix gently, stand at -20°C for 20 min, then centrifuge at 10000 r / min for 10 min;
[0045] (8) Discard the supernatant, add 1 mL of 70% ethanol to the centrifuge tube to wash the DNA, generally wash 2-3 times, centrifuge to discard the ethanol, and use the gun head to suck out the residual ethanol in the centrifuge tube to make it dry faster to transparent;
[0046] (9) Add 50 μL of 0.1% RNAse water to the dried DNA, and water bath at 37°C for 30 min to make the DNA fully dissolved;
[0047] (10) DNA quality detection: configure 1% agarose gel for electrophoresis, and use Nanodrop 2000 to detect the integrity, concentration and purity of the DNA. When OD260 / OD280<1.8, it indicates that the protein content is high; when OD260 / OD280>2.0, it indicates that the RNA content is high; when OD260 / OD280=1.8-2.0, it indicates that the DNA is pure.
[0048] (11) Take part of the stock solution and dilute to 50 ng / μL as a template, and store at -4°C for standby, and store the remaining stock solution in a refrigerator at -20°C.
[0049] 2, DNA pool construction based on fruit length
[0050] Select two parents with long fruit type and short fruit type, and two extreme trait populations with neutral traits in F2 generation for pool construction, and store in a refrigerator at -70°C.
[0051] 3, Genomic DNA pool sequencing and InDel site analysis
[0052] After the two pool genomic DNA passed the detection, the DNA sequence of the pool was fragmented by ultrasonic to form random fragments. The fragmented DNA was subjected to end repair, 3' end A addition, and ligation of sequencing adapters in turn. Then, the genomic fragments with a length of about 400 bp were enriched by magnetic bead adsorption, and the sequencing library was formed by PCR amplification. The constructed library was first subjected to library quality detection. The library that passed the quality detection was subjected to sequencing by using the Illumina HiSeq™ platform, and the total sequencing read length was 300 bp. After the sequencing data (Raw Data) was obtained by using the Illumina Hiseq™ platform, the low-quality data was filtered to obtain high-quality data (Clean Data). The Clean Data was aligned to the reference genomic sequence by using the BWA software to obtain the sequence position attribution. Then, the GATK software was used to detect the InDel sites between the pools. Based on the data characteristics of the mutation pool, the InDel-index value was calculated to screen the InDel sites, and the InDel sites with an InDel-index value greater than 0.4 and a sequencing depth greater than 15 were selected. Sequencing analysis identified one InDel at each of the 22136954 site and the 22076609 site on the 6th chromosome of Momordica charantia, which were named L070 and L901, respectively.
[0053] Example 2: InDel site verification
[0054] (1) Polymorphism detection
[0055] The nucleotide sequences of the upstream and downstream of L070 and L901 were downloaded, which were shown in SEQ ID NO. 1 and SEQ ID NO. 2, respectively.
[0056] SEQ ID NO. 1
[0057] CAACGAGGTGCAGGAGTTTCTTATTACCTTTTTATGAGTCTAACTCTCACATTTATTTCAGGTTACTTTACTAAATGAAGATAGAATTATATTAAGCAGCAAACACATTAGTTTATCTAAAGATTTGATGATGGGTAATATACTTGAGCTGCCAAAATACTTGGTTGAGGTTGGTGAGGCATGTGAAAGTGTTAAAGGTCTGGTCCGATGCTTATTTAAGATTTTAACCGATGCTCGTATGGTGGATATCTAACATTTTCTCTGGCTTTGCTATGGATCCTTTGGTCCTATGGTACCAGTAGAGCTCAGCAACAGAAATTATGATTCAAGAAAAGACGCAAGCTTTTACATTCCTGGCAAATATGAACAAGGATTGGGCAGAGAGAC
[0058] SEQ ID NO. 2
[0059] GGTTCATCTCCCCCATAGTTCAATAATCATTATAGTTATAGTTAGAGTTTAATAGTTAGAGGGTTTTCTTTTTAATAGTAATATGCGTCTTATTGTCTTATTTACTTATAACAATAGAAAAACATTTTTATCATATTTGTTCTAATTTCACATTGGATAGAAAGAAAAAAGGTTTTAATTTAACTCTAAACTTATGCTTATTTCCAAACAAAATTTGAATTATTATTTAAGGGTTAATAAAACTGAATAAAAGAACATAATTTCCTTTATACAAAAGTAACTAAAATATAATATTTAAAGTTCAAAATCTAAAACAAAAAATTGAGGGGCTTTTGAAATCTATACCGGTATATAGTAGTAAGTTTGTCAGGCAAAATTTTAAAGATTTGAATAAAATTGAAAGTAATATTTCTAAGCTTAGTTTAAAAGACTTTATTTGAGTTGAGTGAGGATTCAAGGGTGTGTGATTGCAATGAACAGACATTGGAGTCACATAATTGAAAACTCAACTAGGGAGTTTGTTTAATAACAGTGAAACAAAATCCAAAATGTTTCGAAGAGACCTCCACCACCCCATATTACAATGAGGAAGAAGCAAAGCATCATTCGCAAAAGAAAAAAAAAAAAGTTCCAACGATTCTATCTAAAGAATTACAGTAAGTTTTCCATGGCCTAGCACCACTCTATACTTCCTCATTCCTCATCCCTGCACTGCAGCTGCTGCTTCCGAAAAAGATCAATAAAAATTACAAAGATTCTGTTTAAAGCTCATCGTGAGAATCGTCATCTTCTCCCGACTCGCCACCACCAGGAGCGCCACCGGAGCGTTGGTAAACAGCGGTGATGATGGGGTTGCAGACAGCCTCAAGCTCCTTGAGCTTCTCCTCATAGTCTTCCTTCTCAGCACTCTGGTTGT
[0060] Molecular marker primers L070-F / DR and L901-F / R containing InDel sites were designed using Primer Premier 5.0.
[0061] L070-F: TTGGTTGAGGTTGGTGAG (SEQ ID NO. 3)
[0062] L070-DR: GTCTCTCTGCCCAATCCTTG (SEQ ID NO. 4)
[0063] L901-F: TTGAGTTGAGTGAGGATTCA (SEQ ID NO. 5)
[0064] L901-R: AATGATGCTTTGCTTCTTCC (SEQ ID NO. 6)
[0065] The InDel markers were detected by PCR amplification using the above primers. The reaction system is shown in Table 1, and the PCR reaction program is shown in Table 2. The InDel markers developed by the parent P1, P2 and F1 were used for polymorphism detection, and the results are shown in Table 3. It was found that the markers L070 and L901 had stable polymorphism between the parents. Figure 1
[0066] Table 1 PCR reaction system
[0067]
[0068] Table 2 PCR reaction program
[0069]
[0070]
[0071] (2) Authenticity detection
[0072] The long fruit type parent P1 and the short fruit type parent P2 of Momordica charantia were used as materials, and the PCR amplification primers L070-DF / DR and L901-DF / DR containing InDel sites and having a product length of more than 250 bp were designed by Primer Premier 5.0.
[0073] L070-DF: CAACGAGGTGCAGGAGTTTC (SEQ ID NO. 7)
[0074] L070-DR: GTCTCTCTGCCCAATCCTTG (SEQ ID NO. 4)
[0075] L901-DF: GGTTCATCTCCCCCATAGTTC (SEQ ID NO. 8)
[0076] L901-DR:ACAACCAGAGTGCTGAGAAGG(SEQ ID NO.9)
[0077] PCR amplification was performed using the primer pairs described above. The PCR reaction system is shown in Table 3, and the PCR reaction procedure is shown in Table 4. The authenticity of InDel was verified using PCR sequencing (results are shown in Table 4). Figure 2 ).
[0078] Table 3 PCR reaction system
[0079]
[0080] Table 4 PCR reaction procedures
[0081]
[0082] like Figure 2 As shown in A, L901 is an insertion of 17 bases after the 22,076,609th base from the 5' end of chromosome 6 (chr06), with the inserted base sequence being AACATTGAACTTTTAGA (SEQ InDel-L901) (SEQ ID NO.10). When the InDel-L901 insertion is detected after the 22,076,609th base C from the 5' end of chr06, the F2 generation sample F2-2 is the same as P2, both being short-fruited plants. When the InDel-L901 insertion is not present, the F2 generation sample F2-1 is the same as P1, both being long-fruited plants.
[0083] like Figure 2 As shown in B, L070 is an insertion of 23 bases after the 22,136,954th base from the 5' end of chr06, with the inserted base sequence being TATTTTAAGATTTTAACCGATGCT (SEQ InDel-L070) (SEQ ID NO.11). When the InDel-L070 insertion is detected after the 22,136,954th base from the 5' end of chr06, the F2 generation sample F2-2 is the same as P2, both being short-fruited plants. When the InDel-L070 insertion is not detected, the F2 generation sample F2-1 is the same as P1, both being long-fruited plants.
[0084] The above results are consistent with the plant phenotype, indicating that the molecular markers discovered in this invention are molecular markers linked to the short fruit trait of bitter gourd, and can be used to identify whether bitter gourd is of the long or short fruit type.
[0085] Example 3: Application of InDel molecular markers
[0086] Take 16 F2 generation seedling stage single plants, extract genomic DNA, use primer L070-F / DR to scan 17 F2 generation single plants with genomic DNA as template, when the amplified band is 250bp, the plant is short fruit type plant; when the amplified band is 227bp, the plant is long fruit type plant. As shown in Figure 3 A, 1, 6, 15 and 16 are short fruit type plants in 16 F2 generation populations, 9, 10, 12-14 are long fruit type plants, and the others are hybrid plants (as shown in Figure 4 A).
[0087] Take 14 F2 generation seedling stage single plants, extract genomic DNA, use primer L901-F / R to scan 14 F2 generation single plants with genomic DNA as template, when the amplified band is 188bp, the plant is short fruit type plant, when the amplified band is 171bp, the plant is long fruit type plant. As shown in Figure 3 B, 1-5 are short fruit type plants in 14 F2 generation populations; 6-9, 11, 12 and 14 are long fruit type plants, and the others are hybrid plants (as shown in Figure 4 B).
[0088] The above description of the embodiments is only for illustrating the technical concept and characteristics of the present application, and the purpose is to enable those skilled in the art to understand the content of the present application and implement it. Those skilled in the art can easily make various modifications to these embodiments, and apply the general principles described herein to other embodiments without creative labor, therefore, the above embodiments cannot limit the protection scope of the present application. Any improvement and modification made by those skilled in the art according to the disclosure of the present application without departing from the scope of the present application shall be covered within the protection scope of the present application.
Claims
1. An InDel molecular marker related to the short fruit trait of Momordica charantia fruits, characterized by, The molecular marker is located at the site of 22136954 of the 6th chromosome of Momordica charantia, and is recorded as molecular marker L070; And / or, the molecular marker is located at the site of 22076609 of the 6th chromosome of Momordica charantia, and is recorded as molecular marker L901.
2. The InDel molecular marker related to the short fruit trait of Momordica charantia according to claim 1, characterized in that: The nucleotide sequence of the molecular marker L070 is shown as SEQ ID NO. 1, and 23 bases are inserted after the 235th base T from the 5' end of the sequence shown in SEQ ID NO. 1, and the inserted base sequence is TATTTAAGATTTTAACCGATGCT (SEQ InDel-L070).
3. The InDel molecular marker related to the short fruit trait of Momordica charantia according to claim 1, characterized in that: The nucleotide sequence of the molecular marker L901 is shown as SEQ ID NO. 2, and 17 bases are inserted after the 479th base A from the 5' end of the sequence shown in SEQ ID NO. 2, and the inserted base sequence is AACATTGAACTTTTAGA (SEQ InDel-L901).
4. The InDel molecular marker related to the fruit shortness trait of Momordica charantia according to any one of claims 1 to 3 is applied to identifying Momordica charantia as long fruit type or short fruit type at seedling stage.
5. Specific primers comprising the InDel molecular marker site of claim 1, characterized in that, The specific primer is L070-F / DR, and the nucleotide sequences thereof are shown as SEQ ID NO. 3 and SEQ ID NO.
4.
6. Specific primers comprising the InDel molecular marker site of claim 1, characterized in that, The specific primer is L901-F / R, and the nucleotide sequences thereof are shown as SEQ ID NO. 5 and SEQ ID NO.
6.
7. Use of the specific primers of claim 5 or 6 for identifying the long fruit type or the short fruit type of Momordica charantia L. in seedling stage, characterized in that, The kit comprises the specific primer of claim 5 or 6.
9. The kit of claim 5 is applied to identifying Momordica charantia as long fruit type or short fruit type at seedling stage. The kit comprises the specific primer of claim 5 or 6.
8. A kit characterized in that, The kit comprises the specific primer of claim 5 or 6. The kit comprises the specific primer of claim 5 or 6.
10. A method for identifying bitter gourd as long fruit type or short fruit type at seedling stage, characterized by, 9. The kit of claim 5 is applied to identifying Momordica charantia as long fruit type or short fruit type at seedling stage. The kit comprises the specific primer of claim 5 or 6. The kit comprises the specific primer of claim 5 or 6. And / or, the genomic DNA of the sample to be tested is amplified by PCR using primers L901-DF / DR, and the PCR amplification product is sequenced, when the insertion of SEQ InDel-L901 is detected after the base C at position 22076609 at the 5' end of chr06, the sample is a short fruit type plant, and when there is no insertion of SEQ InDel-L901, the sample is a long fruit type plant; The sequence of L070-DF is shown as SEQ ID NO. 7; the sequence of L070-DR is shown as SEQ ID NO. 4; the sequence of L901-DF is shown as SEQ ID NO. 8; the sequence of L901-DR is shown as SEQ ID NO. 9; the sequence of SEQ InDel-L070 is TATTTAAGATTTTAACCGATGCT; and the sequence of SEQ InDel-L901 is AACATTGAACTTTTAGA.