Transgenic soybean event LP207-1 and its detection method
By designing specific nucleic acid sequences and primer probes, the problem of accurate identification of the transgenic soybean event LP207-1 was solved, and efficient resistance of soybeans to lepidopteran insects and glyphosate herbicides was achieved, thereby improving breeding efficiency and detection accuracy.
Patent Information
- Application Number
- CN202510829662.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-20
- Publication Date
- 2025-09-16
- Estimated Expiration
- 2045-06-20
AI Technical Summary
Existing technologies make it difficult to accurately identify the presence of transgenic soybean event LP207-1, and traditional detection methods are unable to distinguish between different transformation events, affecting the stability and breeding efficiency of soybean insect resistance and herbicide tolerance traits.
Specific nucleic acid sequences (SEQ ID NOs: 1-7 and their complementary sequences) were provided for designing primers and probes to identify the transgenic soybean event LP207-1 by PCR and DNA hybridization, ensuring the specificity and accuracy of the amplified products.
The rapid and accurate identification of the presence of the transgenic soybean event LP207-1 was achieved, ensuring the soybean's high resistance to lepidopteran insects and tolerance to glyphosate herbicides, improving breeding efficiency and detection reliability.
Smart Images

Figure CN120350165B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of molecular biology, and in particular relates to a transgenic soybean event LP207-1 and a nucleic acid sequence and method for detecting the transgenic soybean LP207-1. Background Art
[0002] Soybean( Glycine max (Linn.) Merr.) is an important food crop and oil crop in many parts of the world. Biotechnology has been applied to soybean to improve its agronomic traits and quality. Insect resistance is an important agronomic trait in soybean production, especially resistance to Lepidoptera insects (such as soybean borer, fall armyworm, beet armyworm, Spodoptera litura, cotton bollworm, etc.). Soybean resistance to Lepidoptera insects can be obtained by expressing Lepidoptera insect resistance genes in soybean plants through genetic modification. Another important agronomic trait is herbicide tolerance, especially tolerance to glyphosate herbicides. Soybean tolerance to glyphosate and glufosinate herbicides can be obtained by genetic modification of glyphosate herbicide tolerance genes (such as epsps ) and glufosinate herbicide tolerance genes (e.g. pat ) were expressed in soybean plants.
[0003] In addition to functional genes ( epsps Genes and patThe selection and sequencing of regulatory elements (e.g., the gene itself) are crucial for achieving a successful transformation event, and their technical effectiveness can be unpredictable. Furthermore, it is known that the expression of exogenous genes in plants is influenced by the location of their insertion into the soybean chromosome, potentially due to chromatin structure (e.g., heterochromatin) or the proximity of transcriptional regulatory elements (e.g., enhancers) to the integration site. Therefore, it is often necessary to screen a large number of events to identify those suitable for commercialization (i.e., those in which the introduced target gene is optimally expressed). For example, it has been observed in plants and other organisms that the expression level of the introduced gene can vary significantly between events; there can also be differences in the spatial or temporal patterns of expression, such as differences in the relative expression of the transgene between different plant tissues. Such differences manifest themselves in actual expression patterns that may be inconsistent with the expression pattern expected from the transcriptional regulatory elements in the introduced gene construct. Consequently, it is often necessary to generate hundreds or even thousands of different events and screen these events to identify a single event that exhibits the desired transgene expression level and pattern for commercialization. Such transformation events confer excellent resistance to lepidopteran pests (such as soybean borer, fall armyworm, beet armyworm, Spodoptera litura, and cotton bollworm) and glyphosate herbicide without compromising soybean yield. Conventional breeding methods can be used to backcross the transgenic trait into other genetic backgrounds through hybridization. The progeny produced by such hybridization retain the transgenic expression characteristics and trait performance of the original transformant. This strategy ensures reliable gene expression and stable resistance to lepidopteran pests (such as soybean borer, fall armyworm, beet armyworm, Spodoptera litura, and cotton bollworm) and glyphosate herbicide in a wide range of varieties, protecting them from major lepidopteran pests while providing broad-spectrum weed control and adapting them well to local growing conditions.
[0004] It would be beneficial to be able to detect the presence of a specific event to determine whether the progeny of a sexual cross contain the gene of interest. Furthermore, methods for detecting specific events would also facilitate compliance with regulations, such as the need for formal approval and labeling of foods derived from recombinant crops before they can be marketed. Detection of the presence of a transgene is possible using any well-known polynucleotide detection method, such as polymerase chain reaction (PCR) or DNA hybridization using polynucleotide probes. These detection methods typically focus on common genetic elements, such as promoters, terminators, and marker genes. Therefore, unless the sequence of the chromosomal DNA adjacent to the inserted transgenic DNA ("flanking DNA") is known, such methods cannot be used to distinguish between different events, particularly those generated using the same DNA construct. Therefore, currently, identification of specific transgenic events is often performed by PCR using a pair of primers spanning the junction of the inserted T-DNA and the flanking DNA: specifically, a first primer containing the flanking sequence and a second primer containing the inserted sequence.
[0005] In modern agricultural production, soybean is an important economic crop, and weed control and insect pest resistance have always been key issues during its cultivation. The current technological development of genetically modified herbicide-resistant soybeans has made significant progress, mainly through gene editing and genetic modification technology to give soybeans tolerance or insect resistance to specific herbicides, thereby achieving the dual goals of efficient weed management and crop protection. However, this field still faces the challenges of low conversion rate of some herbicide-resistant genes in soybeans, unstable offspring traits, and increased weed resistance leading to a decrease in the effectiveness of traditional herbicides. This has prompted the direction of scientific research to shift to the development of new composite traits (such as tolerance to more herbicides at the same time) and environmentally friendly products. At present, most of the genetically modified insect-resistant insects used in my country are single-gene insect-resistant, and the Cry1Ab and Cry1Fa genes are not combined in series to express insect-resistant characteristics and simultaneously express them with herbicide-resistant genes. pat and epsps Therefore, a transgenic crop with composite insect resistance and herbicide tolerance and its cultivation method are needed in production. Summary of the Invention
[0006] The purpose of the present invention is to provide a transgenic soybean event LP207-1 and a detection method thereof, which can accurately and quickly identify whether a biological sample contains a specific transgenic soybean event LP207-1 DNA molecule.
[0007] To achieve the above objectives, the present invention provides a nucleic acid sequence for detecting transgenic soybean event LP207-1, comprising one or more sequences selected from SEQ ID NOs: 1-7 (i.e., SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7) or their complementary sequences. In some embodiments, the nucleic acid sequence is derived from a plant, seed, or cell comprising transgenic soybean event LP207-1. Representative samples of seeds comprising the event were deposited with the China Center for Type Culture Collection (CCTCC, Wuhan University, 299 Bayi Road, Wuchang District, Wuhan, Hubei Province, China, 430072) on May 23, 2025, with a deposit number of CCTCC NO: P202516 and a taxonomic designation of soybean seed LP207-1 Glycine max L. LP207-1. In some embodiments, the nucleic acid sequence is an amplicon diagnostic for the presence of soybean event LP207-1.
[0008] In some embodiments of the present invention, the present invention provides a nucleic acid sequence comprising at least 11 consecutive nucleotides of the sequence SEQ ID NO:3 or its complementary sequence and / or at least 11 consecutive nucleotides of the sequence SEQ ID NO:4 or its complementary sequence. In some embodiments, the nucleic acid sequence comprises the sequence SEQ ID NO:1 or its complementary sequence and / or SEQ ID NO:2 or its complementary sequence. In some embodiments, the nucleic acid sequence comprises the sequence SEQ ID NO:3 or its complementary sequence and / or SEQ ID NO:4 or its complementary sequence. In some embodiments, the nucleic acid sequence comprises the sequence SEQ ID NO:5 or its complementary sequence.
[0009] The sequence SEQ ID NO: 1 or its complementary sequence is a 20-nucleotide sequence located near the insertion junction at the 5' end of the inserted sequence in the transgenic soybean event LP207-1. The sequence SEQ ID NO: 1 or its complementary sequence spans the flanking genomic DNA sequence of the soybean insertion site and the DNA sequence at the 5' end of the inserted sequence. The presence of the transgenic soybean event LP207-1 can be identified by including the sequence SEQ ID NO: 1 or its complementary sequence. The sequence SEQ ID NO: 2 or its complementary sequence is a 20-nucleotide sequence located near the insertion junction at the 3' end of the inserted sequence in the transgenic soybean event LP207-1. The sequence SEQ ID NO: 2 or its complementary sequence spans the DNA sequence at the 3' end of the inserted sequence and the flanking genomic DNA sequence of the soybean insertion site. The presence of the transgenic soybean event LP207-1 can be identified by including the sequence SEQ ID NO: 2 or its complementary sequence.
[0010] The nucleic acid sequence provided herein can be at least 11 or more contiguous polynucleotides of any portion of the transgenic insertion sequence of the sequence SEQ ID NO: 3 or its complementary sequence (first nucleic acid sequence), or at least 11 or more contiguous polynucleotides of any portion of the 5' flanking soybean genomic DNA region of the sequence SEQ ID NO: 3 or its complementary sequence (second nucleic acid sequence). The nucleic acid sequence can further be homologous to or complementary to a portion of the sequence SEQ ID NO: 3 comprising the entire sequence SEQ ID NO: 1. When the first nucleic acid sequence and the second nucleic acid sequence are used together, these nucleic acid sequences comprise a DNA primer pair in a DNA amplification method for producing an amplification product. When the amplification product produced in the DNA amplification method using the DNA primer pair is an amplification product comprising the sequence SEQ ID NO: 1, the presence of transgenic soybean event LP207-1 or its progeny can be diagnosed. It is well known to those skilled in the art that the first and second nucleic acid sequences need not consist solely of DNA and can also comprise RNA, a mixture of DNA and RNA, or a combination of DNA, RNA, or other nucleotides or their analogs that do not serve as templates for one or more polymerases. In addition, the probe or primer of the present invention should be at least about 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 consecutive nucleotides in length, which can be selected from the nucleotides set forth in the sequences of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5. When selected from the nucleotides set forth in the sequences of SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5, the probe and primer can be about 17 to 50 or more consecutive nucleotides in length. The sequence SEQ ID NO: 3 or its complementary sequence is a 1080-nucleotide sequence located near the insertion junction at the 5' end of the insertion sequence in the transgenic soybean event LP207-1. The sequence SEQ ID NO: 3 or its complementary sequence consists of 514 nucleotides of soybean flanking genomic DNA sequence (nucleotides 1-514 of SEQ ID NO: 3), 380 nucleotides of pLP207 construct DNA sequence (nucleotides 515-894 of SEQ ID NO: 3), and 186 nucleotides of the 3' end DNA sequence of the pAtUbil0 promoter (nucleotides 895-1080 of SEQ ID NO: 3). The presence of SEQ ID NO: 3 or its complementary sequence can be used to identify the presence of transgenic soybean event LP207-1.
[0011] The nucleic acid sequence can be at least 11 or more contiguous polynucleotides of any portion of the transgenic insert sequence of SEQ ID NO:4 or its complement (third nucleic acid sequence), or at least 11 or more contiguous polynucleotides of any portion of the 3'-flanking soybean genomic DNA region of SEQ ID NO:4 or its complement (fourth nucleic acid sequence). The nucleic acid sequence can further be homologous to or complementary to a portion of SEQ ID NO:4 that includes the entire SEQ ID NO:2 sequence. When the third and fourth nucleic acid sequences are used together, these nucleic acid sequences can be used in a DNA amplification method that produces an amplification product including a DNA primer pair. When the amplification product produced in the DNA amplification method using the DNA primer pair is an amplification product including the sequence of SEQ ID NO:2, the presence of transgenic soybean event LP207-1 or its progeny can be diagnosed. The sequence SEQ ID NO: 4 or its complementary sequence is a 1060-nucleotide sequence located near the insertion junction at the 3' end of the insertion sequence in the transgenic soybean event LP207-1. The sequence SEQ ID NO: 4 or its complementary sequence consists of a 402-nucleotide tPsE9 terminator partial sequence (nucleotides 1-402 of SEQ ID NO: 4), a 210-nucleotide pLP207 construct DNA sequence (nucleotides 403-612 of SEQ ID NO: 4), and a 448-nucleotide soybean integration site flanking genomic DNA sequence (nucleotides 613-1060 of SEQ ID NO: 4). The presence of SEQ ID NO: 4 or its complementary sequence can be used to identify the presence of the transgenic soybean event LP207-1.
[0012] The sequence SEQ ID NO: 5 or its complementary sequence is a 14,370-nucleotide sequence characterizing the transgenic soybean event LP207-1, and its specific genome and genetic elements are shown in Table 1. The presence of the sequence SEQ ID NO: 5 or its complementary sequence can be used to identify the presence of the transgenic soybean event LP207-1.
[0013] Table 1. Genome and genetic elements contained in SEQ ID NO: 5
[0014]
[0015] The nucleic acid sequence or its complementary sequence can be used in a DNA amplification method to produce an amplification product, and the presence of the transgenic soybean event LP207-1 or its progeny in a biological sample can be diagnosed by detecting the amplification product; the nucleic acid sequence or its complementary sequence can be used in a nucleotide detection method to detect the presence of the transgenic soybean event LP207-1 or its progeny in a biological sample.
[0016] The present invention provides a DNA primer pair comprising a first primer and a second primer, wherein the first primer and the second primer each comprise a fragment of the sequence SEQ ID NO: 5 or a complementary sequence thereof, and when the first primer and the second primer are used together with DNA containing soybean event LP207-1 for an amplification reaction, an amplification product of soybean event LP207-1 is generated in a detection sample.
[0017] In some embodiments, the first primer is selected from the sequence SEQ ID NO: 1 or its complementary sequence, SEQ ID NO: 8 or SEQ ID NO: 10; the second primer is selected from the sequence SEQ ID NO: 2 or its complementary sequence, SEQ ID NO: 11 or SEQ ID NO: 14.
[0018] In some embodiments of the present invention, the amplification product includes at least 11 consecutive nucleotides in the sequence of SEQ ID NO: 3 or its complementary sequence, or at least 11 consecutive nucleotides in the sequence of SEQ ID NO: 4 or its complementary sequence.
[0019] Furthermore, the amplification product includes the 1st to 10th or 11th to 20th consecutive nucleotides in the sequence SEQ ID NO: 1 or its complementary sequence, or the 1st to 10th or 11th to 20th consecutive nucleotides in the sequence SEQ ID NO: 2 or its complementary sequence.
[0020] Furthermore, the amplified product includes the sequence SEQ ID NO: 1 or its complementary sequence, SEQ ID NO: 2 or its complementary sequence, SEQ ID NO: 6 or its complementary sequence, or SEQ ID NO: 7 or its complementary sequence.
[0021] In the above technical solution, the primers include at least one of the nucleic acid sequences. Specifically, the primers include a first primer and a second primer, wherein the first primer is selected from the sequence of SEQ ID NO: 1 or its complementary sequence, SEQ ID NO: 8 or SEQ ID NO: 12, and the second primer is selected from the sequence of SEQ ID NO: 9 or SEQ ID NO: 13; or, the first primer is selected from the sequence of SEQ ID NO: 2 or its complementary sequence, SEQ ID NO: 10 or SEQ ID NO: 15, and the second primer is selected from the sequence of SEQ ID NO: 11 or SEQ ID NO: 14.
[0022] The present invention also provides a DNA probe comprising one or more of the sequences SEQ ID NOs: 1-7 or their complementary sequences, wherein the DNA probe hybridizes with a DNA molecule comprising a nucleic acid sequence selected from the sequence SEQ ID NOs: 1-7 or their complementary sequences under stringent hybridization conditions, and does not hybridize with a DNA molecule not comprising a nucleic acid sequence selected from the sequence SEQ ID NOs: 1-7 or their complementary sequences under stringent hybridization conditions.
[0023] In some embodiments, the DNA probe comprises a sequence selected from the group consisting of SEQ ID NO: 1 or its complement, SEQ ID NO: 2 or its complement, SEQ ID NO: 6 or its complement, and SEQ ID NO: 7 or its complement.
[0024] In some embodiments, the DNA probe is labeled with a fluorescent group.
[0025] In some embodiments, the probe comprises at least 11 consecutive nucleotides in the sequence SEQ ID NO:3 or its complementary sequence, or at least 11 consecutive nucleotides in the sequence SEQ ID NO:4 or its complementary sequence; further, the probe comprises the 1st to 10th or 11th to 20th consecutive nucleotides in the sequence SEQ ID NO:1 or its complementary sequence, or the 1st to 10th or 11th to 20th consecutive nucleotides in the sequence SEQ ID NO:2 or its complementary sequence.
[0026] The present invention also provides a marker nucleic acid molecule comprising one or more of the sequences SEQ ID NOs: 1-7 or their complementary sequences, wherein the marker nucleic acid molecule hybridizes with a DNA molecule comprising a nucleic acid sequence selected from the sequence SEQ ID NOs: 1-7 or their complementary sequences under stringent hybridization conditions, and does not hybridize with a DNA molecule not comprising a nucleic acid sequence selected from the sequence SEQ ID NOs: 1-7 or their complementary sequences under stringent hybridization conditions.
[0027] In some embodiments, the marker nucleic acid molecule comprises a sequence selected from the group consisting of SEQ ID NO: 1 or its complement, SEQ ID NO: 2 or its complement, SEQ ID NO: 6 or its complement, and SEQ ID NO: 7 or its complement.
[0028] In one embodiment, the marker nucleic acid molecule comprises at least 11 consecutive nucleotides of the sequence SEQ ID NO: 3 or its complementary sequence, or at least 11 consecutive nucleotides of the sequence SEQ ID NO: 4 or its complementary sequence;
[0029] In some embodiments, the marker nucleic acid molecule comprises consecutive nucleotides 1-10 or 11-20 in SEQ ID NO: 1 or its complementary sequence, or consecutive nucleotides 1-10 or 11-20 in SEQ ID NO: 2 or its complementary sequence.
[0030] Furthermore, the present invention provides a method for detecting the presence of DNA of transgenic soybean event LP207-1 in a sample, comprising:
[0031] (1) contacting the sample to be tested with the DNA primer pair in a nucleic acid amplification reaction;
[0032] (2) Performing nucleic acid amplification reaction;
[0033] (3) Detecting the presence of amplification products;
[0034] The amplified product includes a nucleic acid sequence selected from SEQ ID NO: 1-7 or a complementary sequence thereof, indicating that the test sample contains the DNA of the transgenic soybean event LP207-1.
[0035] The present invention also provides a method for detecting the presence of DNA of transgenic soybean event LP207-1 in a sample, comprising:
[0036] (1) contacting the sample to be tested with the DNA probe and / or the marker nucleic acid molecule;
[0037] (2) hybridizing the sample to be detected with the probe and / or the marker nucleic acid molecule under stringent hybridization conditions;
[0038] (3) Detecting the hybridization between the sample to be detected and the probe and / or the marker nucleic acid molecule.
[0039] The stringent conditions may be hybridization in a 6×SSC (sodium citrate) and 0.5% SDS (sodium dodecyl sulfate) solution at 65° C., followed by washing the membrane once each with 2×SSC, 0.1% SDS and 1×SSC, 0.1% SDS.
[0040] The hybridization between the sample to be tested and the marker nucleic acid molecule is detected, and then marker-assisted breeding analysis is performed to determine whether insect resistance and / or herbicide tolerance is genetically linked to the marker nucleic acid molecule.
[0041] The present invention also provides a DNA detection kit comprising: a DNA primer pair that produces an amplicon diagnostic for transgenic soybean event LP207-1, and a probe specific for the sequences of SEQ ID NOs: 1-7, or a marker nucleic acid molecule specific for the sequences of SEQ ID NOs: 1-7. Specifically, the detection kit comprises the probe, primer pair, or marker nucleic acid molecule described herein.
[0042] In some embodiments, the present invention provides a DNA detection kit comprising at least one DNA molecule, wherein the DNA molecule comprises at least 11 consecutive nucleotides of a homologous sequence of SEQ ID NO: 3 or its complementary sequence, or at least 11 consecutive nucleotides of a homologous sequence of SEQ ID NO: 4 or its complementary sequence, which can be used as a DNA primer or probe specific for transgenic soybean event LP207-1 or its progeny.
[0043] Furthermore, the DNA molecule includes the 1st to 10th or 11th to 20th consecutive nucleotides in the sequence SEQ ID NO: 1 or its complementary sequence, or the 1st to 10th or 11th to 20th consecutive nucleotides in the sequence SEQ ID NO: 2 or its complementary sequence.
[0044] Furthermore, the DNA molecule comprises a homologous sequence of SEQ ID NO: 1 or its complementary sequence, a homologous sequence of SEQ ID NO: 2 or its complementary sequence, a homologous sequence of SEQ ID NO: 6 or its complementary sequence, or a homologous sequence of SEQ ID NO: 7 or its complementary sequence. To achieve the above object, the present invention also provides a plant cell comprising a nucleic acid sequence encoding insect-resistant Cry1Ab and Cry1Fa proteins, a nucleic acid sequence encoding a glyphosate herbicide-tolerant EPSPS protein, a nucleic acid sequence encoding a glufosinate herbicide-tolerant PAT protein, and a nucleic acid sequence of a specific region, wherein the nucleic acid sequence of the specific region comprises a sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, or SEQ ID NO: 7.
[0045] The sequences provided by the present invention include the sequences listed in Table 2 below:
[0046] Table 2. Related sequences of the present invention
[0047] Sequence number (SEQ ID NO) Sequence Description 1 RB end junction sequence (including part of the T-DNA RB end sequence and genomic sequence, 20bp) 2 LB end junction sequence (including part of the T-DNA LB end sequence and genomic sequence, 20bp) 3 The 5' end of the inserted sequence is the nucleotide sequence located near the insertion site, which is the RB end for T-DNA (containing about 500bp of genomic sequence and about 500bp of T-DNA) 4 The 3' end of the inserted sequence is the nucleotide sequence located near the insertion site, which is the LB end for T-DNA (containing about 500bp of genomic sequence and about 400bp of T-DNA). 5 Full-length T-DNA sequence (including genomic sequence extending approximately 500 bp from the LB end and approximately 600 bp from the RB end) 6 Sequence located within SEQ ID NO: 3, LP207 T-DNA sequence 7 Sequence located within SEQ ID NO: 4, LP207 T-DNA sequence 8 The first primer for amplifying SEQ ID NO: 3, primer 11 9 Amplify the second primer of SEQ ID NO:3, primer 12 10 The first primer for amplifying SEQ ID NO: 4, primer 13 11 A second primer for amplifying SEQ ID NO: 4, primer 14 12 5' flanking genomic primer, primer 15 13 Primer 16 on T-DNA that pairs with sequence 12 14 3' flanking genomic primer, primer 17 15 Primer 18 on T-DNA that pairs with sequence 14 16 Taqman detection of Cry1Fa primer 1 17 Taqman detection of Cry1Fa primer 2 18 Taqman detection of Cry1Fa probe 1 19 Taqman assay Pat primer 3 20 Taqman assay Pat primer 4 21 Taqman assay Pat probe 2 22 Taqman detection of Cry1Ab primer 5 23 Taqman detection of Cry1Ab primer 6 24 Taqman detection of Cry1Ab probe 3 25 Taqman assay for EPSPS primer 7 26 Taqman assay for EPSPS primer 8 27 Taqman assay for EPSPS probe 4 28 The first primer 9 of soybean endogenous gene GM-EF1α 29 The second primer 10 of soybean endogenous gene GM-EF1α 30 Probe 5 for Cry1Fa in Southern hybridization detection 31 Pat probe 6 in Southern hybridization detection 32 Probe 7 for Cry1Ab in Southern hybridization detection 33 Probe 8 for EPSPS in Southern hybridization detection 34 Primer 19 located on the T-DNA, in the same direction as SEQ ID NO: 13 35 Primer 20 located on the T-DNA, in the opposite direction to SEQ ID NO: 13 36 Primer 21 located on T-DNA, in the opposite direction to SEQ ID NO: 13 37 Primer 22 located on the T-DNA, in the same direction as SEQ ID NO: 15 38 Primer 23 located on T-DNA, in the opposite direction to SEQ ID NO: 15 39 Primer 24 located on the T-DNA, in the opposite direction to SEQ ID NO: 15
[0048] The present invention also provides a method for protecting soybean plants from insect infestation, comprising providing at least one transgenic soybean plant cell in the diet of a target insect, wherein the transgenic soybean plant genome sequentially comprises the sequences SEQ ID NO:1, the nucleic acid sequence at positions 525-13912 of SEQ ID NO:5, and SEQ ID NO:2; or the transgenic soybean plant genome comprises the sequence SEQ ID NO:5; and the target insect that feeds on the transgenic soybean plant cell is inhibited from further feeding on the soybean plant.
[0049] The present invention also provides a method for protecting soybean plants from damage caused by herbicides, comprising planting at least one transgenic soybean plant, wherein the transgenic soybean plant genome sequentially comprises the sequences of SEQ ID NO: 1, the nucleic acid sequence at positions 525-13912 of SEQ ID NO: 5, and SEQ ID NO: 2; or wherein the transgenic soybean plant genome comprises the sequence of SEQ ID NO: 5. In some embodiments, the method comprises applying an effective amount of glyphosate and / or glufosinate herbicide to a field in which the at least one transgenic soybean plant is planted, wherein the transgenic soybean plant is transgenic soybean event LP207-1.
[0050] The present invention also provides a method for controlling weeds in a field where soybean plants are planted, comprising applying an effective dose of a glyphosate herbicide and / or a glufosinate herbicide to a field where at least one transgenic soybean plant is planted, wherein the genome of the transgenic soybean plant sequentially comprises the sequences SEQ ID NO: 1, the nucleic acid sequence at positions 525 to 13912 of SEQ ID NO: 5, and SEQ ID NO: 2; or the genome of the transgenic soybean plant comprises SEQ ID NO: 5.
[0051] The present invention also provides a method for cultivating an insect-resistant soybean plant, comprising: planting at least one soybean seed, wherein the genome of the soybean seed sequentially comprises the sequences of SEQ ID NO:1, the nucleic acid sequence at positions 525 to 13912 of SEQ ID NO:5, and SEQ ID NO:2; or the genome of the soybean seed comprises the sequence of SEQ ID NO:5;
[0052] allowing the soybean seeds to grow into soybean plants;
[0053] The soybean plants are infested with target insects and the plants are harvested having reduced plant injury compared to other plants not bearing the soybean seeds.
[0054] In some embodiments, the present invention provides a method of growing a soybean plant that is resistant to insects and tolerates glyphosate and glufosinate herbicides, comprising:
[0055] Planting at least one soybean seed, wherein the genome of the soybean seed sequentially comprises the sequences of SEQ ID NO: 1, the nucleic acid sequence at positions 525 to 13912 of SEQ ID NO: 5, and SEQ ID NO: 2; or the genome of the soybean seed comprises the sequence of SEQ ID NO: 5;
[0056] allowing the soybean seeds to grow into soybean plants;
[0057] The soybean plants are infested with target insects and / or sprayed with effective amounts of glyphosate and glufosinate herbicides, and the plants are harvested with reduced plant injury compared to other plants other than the soybean seeds, the plants with reduced plant injury also being resistant to insect feeding injury.
[0058] In some embodiments, the present invention also provides a method for producing an insect-resistant soybean plant, comprising introducing a transgenic soybean event LP207-1 into the genome of the soybean plant, and selecting soybean plants that exhibit reduced plant damage to insect feeding. In some embodiments, the method comprises: sexually crossing a first parent soybean plant of the insect-resistant transgenic soybean event LP207-1 with a second parent soybean plant that lacks insect resistance, thereby producing a plurality of progeny plants; infesting the progeny plants with a target insect; and selecting the progeny plants that exhibit reduced plant damage compared to other plants that do not have the transgenic soybean event LP207-1.
[0059] In some embodiments, the present invention also provides a method for producing soybean plants tolerant to glyphosate and glufosinate herbicides, comprising introducing transgenic soybean event LP207-1 into the genome of the soybean plant and selecting soybean plants tolerant to glyphosate and glufosinate. In some embodiments, the method comprises: sexually crossing a first parent soybean plant of transgenic soybean event LP207-1 tolerant to glyphosate and glufosinate herbicides with a second parent soybean plant lacking glyphosate and glufosinate tolerance, thereby producing a plurality of progeny plants; treating the progeny plants with glyphosate and glufosinate; and selecting the progeny plants tolerant to glyphosate and glufosinate.
[0060] In some embodiments, the present invention also provides a method for producing a soybean plant that is resistant to insects and tolerates application of glyphosate and glufosinate herbicides, comprising: introducing transgenic soybean event LP207-1 into the genome of the soybean plant, selecting soybean plants that are tolerant to glyphosate, glufosinate, and insect-resistant. In some embodiments, the method comprises sexually crossing a first parent soybean plant of transgenic soybean event LP207-1 that is tolerant to glyphosate, glufosinate, and insect-resistant with a second parent soybean plant that lacks glyphosate and glufosinate tolerance and / or insect resistance, thereby producing a plurality of progeny plants; treating the progeny plants with glyphosate and glufosinate; and selecting the progeny plants that are tolerant to glyphosate and glufosinate, wherein the progeny plants that are tolerant to glyphosate and glufosinate are also resistant to insect feeding damage.
[0061] The present invention also provides a processed product derived from transgenic soybean event LP207-1, such as soybean meal, soybean oil, soy protein, soy products, or dregs. In some embodiments, the processed product may be soybean meal, soybean oil, soy protein, soy products, dregs, feed, or an industrial product or commodity. If sufficient expression is detected in the processed product, the processed product is expected to contain a nucleic acid sequence diagnostic for the presence of transgenic soybean event LP207-1 material in the composition. Specifically, the processed product includes, but is not limited to, soybean meal, soybean oil, soy protein, soy products, dregs, and any other food intended for animal consumption as a food source, or for use in the food industry as a component of soybean oil or stearic acid.
[0062] The probe or primer pair-based detection method and / or kit of the present invention can be used to detect a transgenic soybean event LP207-1 nucleic acid sequence such as that shown in SEQ ID NO: 1 or SEQ ID NO: 2 in a biological sample, wherein the probe sequence or primer sequence is selected from the sequences shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5 to diagnose the presence of transgenic soybean event LP207-1.
[0063] In summary, the transgenic soybean event LP207-1 of the present invention possesses both insect resistance and herbicide tolerance, offering the following advantages: 1) protection from economic losses caused by lepidopteran pests (such as cotton bollworm, fall armyworm, soybean borer, leaf moth, and beet armyworm, major pests in soybean-growing areas); 2) the ability to apply agricultural herbicides containing glyphosate and glufosinate to soybean crops for broad-spectrum weed control; and 3) no reduction in soybean yield. Specifically, the event LP207-1 of the present invention exhibits high levels of resistance to target pests, achieving up to 100% pest mortality and protecting plants from damage to a minimum of 0%. It also exhibits high tolerance to glyphosate and glufosinate herbicides, safely tolerating four times the amount of glyphosate and glufosinate, protecting plants from damage to a minimum of 0%. Furthermore, plants containing this event exhibit excellent agronomic traits, with yield percentages showing no significant difference from controls. Furthermore, the genes encoding insect resistance and glyphosate tolerance traits are linked to the same DNA segment and present at a single locus in the genome of transgenic soybean event LP207-1. This improves breeding efficiency and enables the use of molecular markers to track transgenic inserts in breeding populations and their progeny. Furthermore, the primer or probe sequences provided in the detection method of the present invention can produce amplification products identified as transgenic soybean event LP207-1 or its progeny, enabling rapid, accurate, and stable identification of plant material derived from transgenic soybean event LP207-1.
[0064] the term
[0065] The following definitions and methods can better define the present invention and guide those skilled in the art to implement the present invention. Unless otherwise specified, the terms are understood according to conventional usage by those skilled in the art.
[0066] The soybean ( Glycine max ), and includes all plant species that can be crossed with soybean, including wild soybean species.
[0067] The term “comprising” means “including but not limited to.” The term “processed product” refers to a product obtained by processing raw materials such as plants and seeds, such as a composition.
[0068] The term "plant" includes whole plants, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant callus, plant clumps, and intact plant cells in plants or plant parts, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, stems, roots, root tips, anthers, etc. It is understood that parts of transgenic plants within the scope of the present invention include, but are not limited to, plant cells, protoplasts, tissues, callus, embryos, as well as flowers, stems, fruits, leaves and roots, which are derived from transgenic plants previously transformed with a DNA molecule of the present invention and thus consist at least in part of transgenic cells, or their progeny.
[0069] The term "gene" refers to a nucleic acid fragment that expresses a specific protein, including regulatory sequences preceding the coding sequence (5' non-coding sequences) and following the coding sequence (3' non-coding sequences). A "native gene" refers to a gene found in nature that has its own regulatory sequences. A "chimeric gene" refers to any gene that is not a natural gene and contains regulatory and coding sequences that are not found in nature. An "endogenous gene" refers to a natural gene that is located in its natural location in the genome of an organism. An "exogenous gene" is a foreign gene that is now present in the genome of an organism and did not originally exist, and also refers to a gene that is introduced into a recipient cell through a transgenic step. Exogenous genes can include natural genes inserted into non-natural organisms or chimeric genes. A "transgene" is a gene that has been introduced into the genome through a transformation procedure. The site in the plant genome where the recombinant DNA has been inserted can be called an "insertion site" or "target site."
[0070] In some embodiments, the present invention provides the nucleotide sequence of the present invention. " flanking DNA " can comprise the genome that is naturally present in the organism of for example plant or the foreign source (heterologous) DNA that is introduced by transformation process, for example the fragment relevant to transformation event.Therefore, flanking DNA can comprise the combination of natural and foreign DNA.In the present invention, " flanking region " or " flanking sequence " or " genome border zone " or " genome border sequence " refer to at least 3,5,10,11,15,20,50,100,200,300,400,1000,1500,2000,2500 or 5000 base pairs or longer sequence, and it is positioned at the direct upstream or downstream of initial external source insertion DNA molecule and is adjacent to initial external source insertion DNA molecule.When this flanking region was positioned at downstream, it also can be called " left boundary flank " or " 3 ' flank " or " 3 ' genome border zone " or " genome 3 ' border sequence " etc. When the flanking region is located upstream, it may also be referred to as the "right border flank" or the "5' flank" or the "5' genomic border region" or the "genomic 5' border sequence" or the like.
[0071] Transformation procedures that cause random integration of exogenous DNA will result in transformants containing different flanking regions, which are specifically contained in each transformant. When recombinant DNA is introduced into plants by traditional hybridization, its flanking regions are generally unchanged. Transformants will also contain unique junctions between segments of heterologous insert DNA and genomic DNA, or between two segments of genomic DNA, or between two segments of heterologous DNA. "Junction" is the point where two specific DNA fragments connect. For example, a junction is present at the position where the insert DNA connects to the flanking DNA. Junctions are also present in transformed organisms where two DNA fragments are linked together in a manner modified from that found in natural organisms. "Junction DNA" refers to the DNA that comprises a junction.
[0072] The present invention provides a transgenic soybean event named LP207-1 and its progeny, wherein the transgenic soybean event LP207-1 is a soybean plant LP207-1, which includes plants and seeds of the transgenic soybean event LP207-1 and plant cells or regenerable parts thereof, and the plant parts of the transgenic soybean event LP207-1 include but are not limited to cells, pollen, ovules, flowers, buds, roots, stems, inflorescences, leaves and products from the soybean plant LP207-1, such as soybean meal, soybean flour, soybean oil, soybean pulp, soybean silk, soybean starch and biomass remaining in the soybean crop field.
[0073] The transgenic soybean event LP207-1 of the present invention comprises a DNA construct that, when expressed in plant cells, confers resistance to insects and tolerance to glyphosate and glufosinate herbicides.
[0074] In some embodiments of the present invention, the DNA construct comprises four tandem expression cassettes, the first expression cassette comprising a suitable promoter and a suitable polyadenylation signal sequence for expression in plants, the promoter being operably linked to the nucleic acid sequence of the insect-resistant Cry1Fa protein (Cry1Fa) of Bacillus thuringiensis, and the Cry1Fa protein having resistance to lepidopteran insects; the second expression cassette comprising a suitable promoter and a suitable polyadenylation signal sequence for expression in plants, the promoter being operably linked to a gene encoding phosphinothricin acetyltransferase (PAT), and the PAT protein having tolerance to glufosinate herbicide; the third expression cassette comprising a suitable promoter and a suitable polyadenylation signal sequence for expression in plants, the promoter being operably linked to the nucleic acid sequence of the Cry1Ab protein, and the nucleic acid sequence of the Cry1Ab protein mainly having resistance to lepidopteran insects. The fourth expression cassette comprises a suitable promoter for expression in plants and a suitable polyadenylation signal sequence, wherein the promoter is operably linked to a gene encoding 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), and the nucleic acid sequence of the EPSPS protein is tolerant to glyphosate herbicide. Further, the promoter can be a suitable promoter isolated from a plant, including a constitutive, inducible and / or tissue-specific promoter, and the suitable promoter includes but is not limited to a cauliflower mosaic virus (CaMV) 35S promoter, a figwort mosaic virus (FMV) 35S promoter, an ubiquitin promoter, an actin promoter, an Agrobacterium tumefaciens promoter, a cytochrome c 647 ... Agrobacterium tumefaciens ) nopaline synthase (NOS) promoter, octopine synthase (OCS) promoter, Cestrum yellow leaf curl virus promoter, potato tuber storage protein (Patatin) promoter, ribulose-1,5-bisphosphate carboxylase / oxygenase (RuBisCO) promoter, glutathione S-transferase (GST) promoter, E9 promoter, GOS promoter, alcA / alcR promoter, Agrobacterium rhizogenes ( Agrobacterium rhizogenes )RolD promoter and Arabidopsis ( Arabidopsis thaliana ) Suc2 promoter. The polyadenylation signal sequence may be a suitable polyadenylation signal sequence that functions in plants, including but not limited to, polyadenylation signal sequences derived from Agrobacterium tumefaciens ( Agrobacterium tumefaciens) polyadenylation signal sequence from the nopaline synthase (NOS) gene, the 35S terminator from the cauliflower mosaic virus (CaMV), the polyadenylation signal sequence from the proteinase inhibitor II (PIN II) gene, and the polyadenylation signal sequence from the α-tubulin gene.
[0075] In addition, the expression cassette may also include other genetic elements, including but not limited to enhancers and signal peptide / transit peptide nucleic acid coding sequences. The enhancers may enhance the expression level of the gene, including but not limited to tobacco etch virus (TEV) translation activator, CaMV35S enhancer, and FMV35S enhancer. The signal peptide / transit peptide may guide the transport of the Cry1Ab protein and / or EPSPS protein to a specific organelle or compartment outside or within the cell, for example, by targeting the chloroplast using a chloroplast transit peptide sequence, or by targeting the endoplasmic reticulum using a 'KDEL' retention sequence.
[0076] The Cry1Ab and Cry1Fa genes can be obtained from Bacillus thuringiensis ( Bacillus thuringiensis , referred to as Bt), and the nucleic acid sequences of Cry1Ab and Cry1Fa genes can be changed by optimizing codons or in other ways to increase the stability and availability of transcripts in transformed cells.
[0077] In some embodiments of the present invention, the soybean cell, seed or plant comprising the transgenic soybean event LP207-1 comprises the sequences SEQ ID NO: 1, the nucleic acid sequence at positions 525-13912 of SEQ ID NO: 5 and SEQ ID NO: 2 in sequence in its genome, or comprises the sequence SEQ ID NO: 5.
[0078] The "Lepidoptera", scientifically known as Lepidoptera, includes two types of insects: moths and butterflies. It is the order with the most agricultural and forestry pests, such as the cotton bollworm, the fall armyworm, the armyworm, the beet armyworm and the soybean borer.
[0079] The 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) gene can be obtained from Agrobacterium tumefaciens ( Agrobacterium tumefaciens sp.) CP4 strain, and the polynucleotide encoding the EPSPS gene can be modified by optimizing codons or otherwise altering the polynucleotide encoding the EPSPS gene to increase the stability and availability of the transcript in the transformed cells. The 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) gene can also be used as a selectable marker gene.
[0080] The phosphinothricin acetyltransferase (PAT) gene can be isolated from Streptomyces viridochromogenes, and can be modified by optimizing codons or otherwise altering the polynucleotide encoding the EPSPS gene to increase the stability and availability of transcripts in transformed cells. The phosphinothricin acetyltransferase (PAT) gene can also be used as a selective marker gene.
[0081] The term "glyphosate" refers to N-phosphonomethylglycine and its salts, and treatment with a "glyphosate herbicide" refers to treatment with any herbicide formulation containing glyphosate. The term "glufosinate" refers to 4-[hydroxy(methyl)phosphonyl]-DL-homoalanine or 2-amino-4-[hydroxy(methyl)phosphonyl]butyrate, and treatment with a "glufosinate herbicide" refers to treatment with any herbicide formulation containing glufosinate. The selection of the rate of use of a particular glyphosate and glufosinate formulation to achieve an effective biological dose is within the skill of an ordinary agronomist. Treatment of a field containing plant material derived from transgenic soybean event LP207-1 with any herbicide formulation containing glyphosate and glufosinate will control weed growth in the field without affecting the growth or yield of the plant material derived from transgenic soybean event LP207-1.
[0082] The DNA construct is introduced into the plant using a transformation method including, but not limited to, Agrobacterium-mediated transformation, biolistic transformation, and pollen tube pathway transformation.
[0083] Agrobacterium-mediated transformation is a common method for plant transformation. The foreign DNA to be introduced into the plant is cloned between the left and right consensus border sequences of the vector, i.e., the T-DNA region. The vector is transformed into Agrobacterium cells, which are then used to infect plant tissue, and the T-DNA region of the vector containing the foreign DNA is inserted into the plant genome.
[0084] The gene gun transformation method is to bombard plant cells with vectors containing foreign DNA (particle-mediated biolistic transformation).
[0085] The pollen tube channel transformation method utilizes the natural pollen tube channel (also known as pollen tube guiding tissue) formed after plant pollination to carry exogenous DNA into the embryo sac through the nucellus channel.
[0086] Following transformation, transgenic plants must be regenerated from the transformed plant tissue and progeny harboring the foreign DNA selected using appropriate markers.
[0087] DNA construct is the combination that DNA molecule is connected to each other, and this combination provides one or more expression cassettes.DNA construct specifically can self-replicate in bacterial cell, and contains the plasmid of different restriction endonuclease sites, and contained restriction endonuclease sites are used to import the DNA molecule that functional gene element is provided, i.e. promoter, intron, leader sequence, coding sequence, 3 ' terminator region and other sequences.Expression cassette contained in the DNA construct comprises the necessary gene element that messenger RNA is transcribed, and described expression cassette can be designed to express in prokaryotic cell or eukaryotic cell.Expression cassette of the present invention is designed to express in plant cell the most specifically.
[0088] A transgenic "event" is obtained by transforming plant cells with a heterologous DNA construct, i.e., comprising at least one nucleic acid expression cassette containing a gene of interest, transgenically inserted into the plant genome to produce a plant population, regenerate the plant population, and select for specific plants characterized by the insertion at a specific genomic locus. The term "event" refers to the original transformant that contains the heterologous DNA and the progeny of the transformant. The term "event" also refers to the progeny obtained by sexually crossing a transformant with individuals of another variety containing the heterologous DNA, wherein the inserted DNA and flanking genomic DNA from the transformant parent are present at the same chromosomal location in the progeny of the hybrid, even after repeated backcrossing with the recurrent parent. The term "event" also refers to a DNA sequence from the original transformant that contains the inserted DNA and flanking genomic sequences immediately adjacent to the inserted DNA, which is expected to be transferred to progeny produced by sexually crossing a parental line containing the inserted DNA (e.g., the original transformant and progeny resulting from selfing thereof) with a parental line that does not contain the inserted DNA, and which progeny receive the inserted DNA containing the gene of interest.
[0089] As used herein, "recombinant" refers to a form of DNA and / or protein and / or organism not normally found in nature and therefore produced by human intervention. Such human intervention can produce recombinant DNA molecules and / or recombinant plants. A "recombinant DNA molecule" is one obtained by artificially combining two otherwise separate sequence segments, for example, by chemical synthesis or manipulation of separate nucleic acid segments through genetic engineering techniques. Techniques for nucleic acid manipulation are well known.
[0090] The term "transgenic" includes any cell, cell line, callus, tissue, plant part or plant whose genotype is altered by the presence of heterologous nucleic acid, including the original transgenic so altered and progeny individuals generated by sexual hybridization or asexual reproduction of the original transgenic. In the present invention, the term "transgenic" does not include alterations (chromosomal or extrachromosomal) of the genome by conventional plant breeding methods or naturally occurring events, such as random cross-fertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition or spontaneous mutation.
[0091] As used herein, "heterologous" means that the first molecule is not normally found in combination with the second molecule in nature. For example, a molecule can be derived from a first species and inserted into the genome of a second species. Thus, such a molecule is heterologous to the host cell and has been artificially introduced into the genome of the host cell.
[0092] Cultivation of a transgenic soybean event LP207-1 that is resistant to lepidopteran insects and tolerant to glyphosate and glufosinate herbicides can be achieved by the following steps: first, sexually hybridizing a first parent soybean plant with a second parent soybean plant to produce a variety of first-generation progeny plants, wherein the first parent soybean plant is composed of soybean plants cultivated from the transgenic soybean event LP207-1 and its progeny, and the transgenic soybean event LP207-1 and its progeny are obtained by transformation using the expression cassette of the present invention that is resistant to lepidopteran insects and tolerant to glyphosate and glufosinate herbicides, and the second parent soybean plant lacks resistance to lepidopteran insects and / or has tolerance to glyphosate and glufosinate herbicides; and then selecting progeny plants that are resistant to lepidopteran insect infestation and / or have tolerance to glyphosate and glufosinate herbicides, thereby cultivating soybean plants that are resistant to lepidopteran insects and have tolerance to glyphosate and glufosinate herbicides. These steps can further include backcrossing the lepidopteran insect-resistant and / or glyphosate- and glufosinate-tolerant progeny plants to a second parent soybean plant or a third parent soybean plant, and then selecting the progeny by infestation with lepidopteran insects, application of glyphosate and glufosinate herbicides, or by identification of molecular markers associated with the trait (e.g., DNA molecules comprising the junction sites identified at the 5' and 3' ends of the insertion sequence in transgenic soybean event LP207-1), thereby producing soybean plants that are resistant to lepidopteran insects and tolerant to glyphosate and glufosinate herbicides.
[0093] It should also be understood that two different transgenic plants can also be crossed to produce offspring containing two independent, segregating added exogenous genes. Selfing of appropriate offspring can produce offspring plants that are homozygous for both added exogenous genes. Backcrossing of the parent plants and outcrossing with non-transgenic plants as described above are also contemplated, as are asexual propagation.
[0094] The term "probe" refers to an isolated nucleic acid molecule to which a conventional detectable label or reporter molecule, such as a radioisotope, ligand, chemiluminescent agent, or enzyme, may be conjugated. Such a probe is complementary to a strand of a target nucleic acid. In the present invention, the probe is complementary to a strand of genomic DNA from transgenic soybean event LP207-1, whether the genomic DNA is from transgenic soybean event LP207-1 or seeds, or from plants, seeds, or extracts thereof. The probes of the present invention include not only deoxyribonucleic acids (DNAs) or RNAs, but also polyamides and other probe materials that specifically bind to a target DNA sequence and can be used to detect the presence of that target DNA sequence.
[0095] The term "primer" refers to an isolated nucleic acid molecule that anneals to a complementary target DNA strand through nucleic acid hybridization, forming a hybrid between the primer and the target DNA strand, which is then extended along the target DNA strand by a polymerase (e.g., DNA polymerase). The primer pairs of the present invention relate to their use in amplifying a target nucleic acid sequence, for example, by polymerase chain reaction (PCR) or other conventional nucleic acid amplification methods.
[0096] Methods for designing and using primers and probes are well known in the art. DNA molecules comprising the full length or fragments of sequences SEQ ID NOs: 1-7 can be used as primers and probes for detecting soybean event LP207-1 and can be easily designed by those skilled in the art using the sequences provided herein.
[0097] The length of the probe and primer is generally 11 polynucleotides or more, preferably 18 polynucleotides or more, more preferably 24 polynucleotides or more, and most preferably 30 polynucleotides or more. Such probes and primers specifically hybridize with the target sequence under highly stringent hybridization conditions. Although probes that are different from the target DNA sequence and that maintain hybridization ability to the target DNA sequence can be designed by conventional methods, preferably, the probes and primers of the present invention have complete DNA sequence identity with the continuous nucleic acid of the target sequence.
[0098] Primers and probes based on the flanking genomic DNA and insert sequences of the present invention can be determined by conventional methods, for example, by isolating the corresponding DNA molecules from plant material derived from transgenic soybean event LP207-1 and determining the nucleic acid sequence of the DNA molecules. The DNA molecules contain the transgenic insert sequence and the soybean genomic flanking regions, and fragments of the DNA molecules can be used as primers or probes.
[0099] The nucleic acid probes and primers of the present invention hybridize to target DNA sequences under stringent conditions. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of DNA derived from transgenic soybean event LP207-1 in a sample. Nucleic acid molecules or fragments thereof are capable of specific hybridization to other nucleic acid molecules under certain circumstances. As used herein, two nucleic acid molecules are said to be capable of specific hybridization to each other if they can form an antiparallel double-stranded nucleic acid structure. If two nucleic acid molecules exhibit complete complementarity, one is said to be the "complement" of the other. As used herein, two nucleic acid molecules are said to exhibit "complete complementarity" when every nucleotide in one molecule is complementary to the corresponding nucleotide in the other. Two nucleic acid molecules are said to be "minimally complementary" if they can hybridize with sufficient stability to anneal and bind to each other under at least conventional "low stringency" conditions. Similarly, two nucleic acid molecules are said to be "complementary" if they can hybridize with sufficient stability to anneal and bind to each other under conventional "high stringency" conditions. Deviations from perfect complementarity are permissible as long as such deviations do not completely prevent the two molecules from forming a duplex structure. In order for a nucleic acid molecule to function as a primer or probe, it is only necessary that it possess sufficient sequence complementarity to allow a stable duplex structure to form under the particular solvent and salt concentration employed.
[0100] As used herein, a substantially homologous sequence is a nucleic acid molecule that is capable of specifically hybridizing to the complementary strand of a matching nucleic acid molecule under highly stringent conditions. Suitable stringent conditions for promoting DNA hybridization, such as treatment with 6.0× sodium chloride / sodium citrate (SSC) at approximately 45°C, followed by washing with 2.0×SSC at 50°C, are well known to those skilled in the art. For example, the salt concentration in the wash step can be selected from about 2.0×SSC at 50°C for low stringency conditions to about 0.2×SSC at 50°C for high stringency conditions. In addition, the temperature in the wash step can be increased from room temperature, about 22°C, for low stringency conditions, to about 65°C for high stringency conditions. Both the temperature and the salt concentration can be varied, or one of them can be held constant while the other is varied. Specifically, a nucleic acid molecule of the present invention can specifically hybridize to one or more nucleic acid molecules of the sequence SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7, or their complementary sequences, or any fragments thereof, under moderate stringency conditions, for example, at about 2.0×SSC and about 65° C. More specifically, a nucleic acid molecule of the present invention can specifically hybridize to one or more nucleic acid molecules of the sequence SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7, or their complementary sequences, or any fragments thereof, under high stringency conditions. In the present invention, a preferred marker nucleic acid molecule has the sequence SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, or SEQ ID NO: 7, or their complementary sequences, or any fragments thereof. Another preferred marker nucleic acid molecule of the present invention has 80% to 100% or 90% to 100% sequence identity to the sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, or SEQ ID NO: 7, or its complement, or any fragment thereof. The sequences of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, and SEQ ID NO: 7 can be used as markers in plant breeding methods to identify progeny of genetic crosses. Hybridization of the probe to the target DNA molecule can be detected by any method known to those skilled in the art, including, but not limited to, fluorescent labels, radioactive labels, antibody-based labels, and chemiluminescent labels.
[0101] With respect to amplification of a target nucleic acid sequence using specific amplification primers (e.g., by PCR), "stringent conditions" refer to conditions that only allow the primers to hybridize to the target nucleic acid sequence in a DNA thermal amplification reaction, wherein the primers having a wild-type sequence corresponding to the target nucleic acid sequence (or its complementary sequence) are capable of binding to the target nucleic acid sequence and preferably produce a unique amplification product, i.e., an amplicon.
[0102] The term "specifically binds to (a target sequence)" means that the probe or primer hybridizes only to the target sequence in a sample containing the target sequence under stringent hybridization conditions.
[0103] As used herein, "amplified DNA," "amplification product," or "amplicon" refers to the product of nucleic acid amplification of a target nucleic acid sequence that is part of a nucleic acid template. For example, to determine whether a soybean plant was produced by sexual crosses containing the transgenic soybean event LP207-1 of the present invention, or whether a soybean sample collected from a field contains the transgenic soybean event LP207-1, or whether a soybean extract, such as meal, flour, or oil, contains the transgenic soybean event LP207-1, DNA extracted from the soybean plant tissue sample or extract can be subjected to a nucleic acid amplification method using a primer pair to produce an amplicon that is diagnostic for the presence of transgenic soybean event LP207-1 DNA. The primer pair includes a first primer derived from flanking sequences adjacent to the insertion site of the inserted exogenous DNA in the plant genome, and a second primer derived from the inserted exogenous DNA. The amplicon has a length and sequence that is also diagnostic for the transgenic soybean event LP207-1. The length of the amplicon can range from the combined length of the primer pair plus one nucleotide base pair, preferably plus about fifty nucleotide base pairs, more preferably plus about two hundred and fifty nucleotide base pairs, and most preferably plus about four hundred and fifty nucleotide base pairs or more.
[0104] Alternatively, the primer pairs can be derived from flanking genomic sequences on either side of the insert DNA to produce an amplicon that includes the entire insert nucleic acid sequence. One of the primer pairs derived from a plant genomic sequence can be positioned at a distance from the insert DNA sequence that can range from one nucleotide base pair to approximately 20,000 nucleotide base pairs. The use of the term "amplicon" specifically excludes primer dimers formed during thermal DNA amplification reactions.
[0105] Nucleic acid amplification reactions can be performed by any nucleic acid amplification reaction method known in the art, including polymerase chain reaction (PCR). Various nucleic acid amplification methods are well known to those skilled in the art. PCR amplification methods have been developed to amplify 22 kb of genomic DNA and 42 kb of phage DNA. These methods, as well as other DNA amplification methods in the art, can be used in the present invention. The inserted exogenous DNA sequence and the flanking DNA sequence from the transgenic soybean event LP207-1 can be amplified by using the provided primer sequences on the genome of the transgenic soybean event LP207-1, and after amplification, the PCR amplicon or cloned DNA is subjected to standard DNA sequencing.
[0106] DNA detection kits based on DNA amplification methods can contain DNA primer molecules that specifically hybridize to the target DNA under appropriate reaction conditions and amplify a diagnostic amplicon. The kit can provide agarose gel-based detection methods or many methods known in the art for detecting diagnostic amplicons. Kits containing DNA primers homologous or complementary to any portion of the soybean genomic region of sequence SEQ ID NO:3 or SEQ ID NO:4, and homologous or complementary to any portion of the transgene insertion region of sequence SEQ ID NO:5 are provided by the present invention. In particular, the primer pairs identified as useful in DNA amplification methods are sequences SEQ ID NO:8 and SEQ ID NO:9, which amplify a diagnostic amplicon homologous to a portion of the 5' transgene / genomic region of transgenic soybean event LP207-1, wherein the amplicon includes the sequence SEQ ID NO:1. Other DNA molecules used as DNA primers can be selected from SEQ ID NO:5.
[0107] The amplicons generated by these methods can be detected using a variety of techniques. One method is GeneticBit Analysis, in which a DNA oligonucleotide strand is designed that spans the insert DNA sequence and the adjacent flanking genomic DNA sequence. This oligonucleotide strand is immobilized in a microwell of a microplate, and after PCR amplification of the target region (using one primer within the insert sequence and one primer within the adjacent flanking genomic sequence), the single-stranded PCR product can be hybridized to the immobilized oligonucleotide strand and used as a template for a single-base extension reaction using a DNA polymerase and ddNTPs specifically labeled for the next expected base. The results can be obtained using fluorescence or ELISA-type methods. The signal represents the presence of the insert / flanking sequence, indicating that the amplification, hybridization, and single-base extension reactions were successful.
[0108] Another method is Pyrosequencing technology. This method designs an oligonucleotide chain that spans the inserted DNA sequence and the adjacent genomic DNA binding site. The oligonucleotide chain is hybridized with the single-stranded PCR product of the target region (one primer is used in the inserted sequence and one primer is used in the adjacent flanking genomic sequence) and then incubated with DNA polymerase, ATP, sulfhydrylase, luciferase, apyrase, adenosine-5'-phosphosulfate and luciferin. dNTPs are added separately and the resulting light signal is measured. The light signal represents the presence of the inserted / flanking sequence, which indicates that the amplification, hybridization, and single-base or multi-base extension reaction are successful.
[0109] The fluorescence polarization phenomenon described by Chen et al. (Genome Res. 9:492-498, 1999) is also a method that can be used to detect the amplicon of the present invention. Using this method requires designing an oligonucleotide chain that spans the inserted DNA sequence and the adjacent genomic DNA binding site. The oligonucleotide chain is hybridized with the single-stranded PCR product of the target region (one primer each is used in the inserted sequence and the adjacent flanking genomic sequence), and then incubated with DNA polymerase and a fluorescently labeled ddNTPs. Single-base extension will result in the insertion of ddNTPs. This insertion can be measured using a fluorescence instrument to measure its polarization change. The change in polarization represents the presence of the inserted / flanking sequence, which indicates that the amplification, hybridization and single-base extension reactions are successful.
[0110] Taqman is described as a method for detecting and quantifying the presence of DNA sequences and is described in detail in the manufacturer's instructions. As a brief example, a FRET oligonucleotide probe is designed that spans the binding sites of an insert DNA sequence and the adjacent genomic flanking sequence. The FRET probe and PCR primers (one primer within the insert sequence and one primer in the adjacent flanking genomic sequence) are cycled in the presence of a thermostable polymerase and dNTPs. Hybridization of the FRET probe results in the cleavage of the fluorescent and quenching moieties on the FRET probe and the release of the fluorescent moiety. The generation of a fluorescent signal represents the presence of the insert / flanking sequence, indicating that amplification and hybridization were successful.
[0111] Suitable techniques for detecting plant material derived from transgenic soybean event LP207-1 based on hybridization principles may also include Southern blot hybridization, Northern blot hybridization, and in situ hybridization. Specifically, suitable techniques include incubating the probe with the sample, washing to remove unbound probe, and detecting whether the probe has hybridized. The detection method depends on the type of label attached to the probe; for example, radiolabeled probes can be detected by exposure and development of X-ray film, or enzyme-labeled probes can be detected by color change caused by substrate conversion.
[0112] Tyangi et al. (Nat. Biotech. 14:303-308, 1996) introduced the application of molecular markers in sequence detection. A brief description is as follows: a FRET oligonucleotide probe is designed that spans the insertion DNA sequence and the adjacent genomic flanking binding site. The unique structure of the FRET probe causes it to contain a secondary structure that can maintain a fluorescent moiety and a quenching moiety in close proximity. The FRET probe and PCR primers (one primer each is used in the insertion sequence and in the adjacent flanking genomic sequence) are cyclically reacted in the presence of a thermostable polymerase and dNTPs. After successful PCR amplification, the hybridization of the FRET probe and the target sequence causes the loss of the probe secondary structure, thereby separating the fluorescent moiety and the quenching moiety in space and generating a fluorescent signal. The generation of the fluorescent signal represents the presence of the insertion / flanking sequence, indicating that the amplification and hybridization are successful.
[0113] Other described methods, such as microfluidics, provide methods and apparatus for separating and amplifying DNA samples. Optical dyes are used to detect and measure specific DNA molecules. Nanotube devices comprising electronic sensors for detecting DNA molecules or nanobeads that bind specific DNA molecules and are thus detectable are useful for detecting the DNA molecules of the present invention.
[0114] DNA detection kits can be developed using the compositions of the present invention and methods described or known in the art of DNA detection. The kits are useful for identifying the presence of transgenic soybean event LP207-1 DNA in a sample and for growing soybean plants containing transgenic soybean event LP207-1 DNA. The kits can contain DNA primers or probes that are homologous to or complementary to at least a portion of the sequence of SEQ ID NO: 1, 2, 3, 4, or 5, or other DNA primers or probes that are homologous to or complementary to DNA contained in transgenic genetic elements of the DNA. These DNA sequences can be used in DNA amplification reactions or as probes in DNA hybridization methods.
[0115] Contained in the soybean genome and in Figure 1 The DNA construct of the transgenic insert sequence and soybean genome described in Table 1 comprises: the soybean LP207-1 flanking genomic region located at the 5' end of the transgenic insert sequence, a portion of the insert sequence from the right border region (RB) of Agrobacterium tumefaciens, a first expression cassette consisting of the Arabidopsis thaliana ubiquitin gene promoter Ubi (pAtUbi10), operably linked to the insect resistance gene Cry1Fa (Cry1Fa) of Bacillus thuringiensis, operably linked to the terminator tORF25PolyA from Agrobacterium tumefaciens pTi15955; and a second expression cassette consisting of the cauliflower mosaic virus (CaMV) p35S promoter, operably linked to a gene encoding phosphinothricin acetyltransferase (cPAT), operably linked to a cauliflower mosaic virus (CaMV) 35S promoter. terminator; the third expression cassette consists of the promoter and leader sequence (pAtRbcS4) of the Arabidopsis thaliana 1,5-bisphosphate carboxylase / oxygenase small subunit, the E9 Arabidopsis thaliana gene promoter, operably linked to the signal peptide sequence (spAtRbcS4) of the Arabidopsis thaliana 1,5-bisphosphate carboxylase / oxygenase small subunit, operably linked to the Cry1Ab protein (Cry1Ab) of insect resistance of Bacillus thuringiensis, and operably linked to the 3'UTR sequence transcription terminator of the PT1 gene encoding a phosphate transporter from Medicago truncatula (tMtPt The fourth expression cassette consists of the promoter from the Tsf1 gene (pGm17gTsf1) of the soybean elongation factor EF-1alpha, operably linked to the Arabidopsis thaliana chloroplast transit peptide (spAtCTP2), operably linked to the glyphosate-tolerant 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) from Agrobacterium tumefaciens strain CP4, and operably linked to the 3' non-transcribed sequence terminator (tPsE9) from the pea ribosomal 1,5-bisphosphate carboxylase small subunit (RbcS2) E9 gene. The cassette also contains a portion of the left border region (LB) of the Agrobacterium insert and a flanking genomic region (SEQ ID NO:5) from the soybean plant LP207-1 located at the 3' end of the transgenic insert. In the DNA amplification method, the primer DNA molecule can be any portion of the transgenic insert sequence from the transgenic soybean event LP207-1 or any portion of the flanking soybean genomic DNA region from the transgenic soybean event LP207-1.
[0116] The transgenic soybean event LP207-1 can be combined with other transgenic soybean varieties, such as soybeans tolerant to herbicides (e.g., PPO, dicamba, etc.), or transgenic soybean varieties carrying genes resistant to other insects (e.g., scarab beetles, white grubs, blind bugs, and two-spotted leaf beetles). Various combinations of these different transgenic events, when bred with the transgenic soybean event LP207-1 of the present invention, can produce improved hybrid transgenic soybean varieties that are resistant to multiple pests and tolerant to multiple herbicides. These varieties can exhibit superior characteristics, such as increased yield, compared to non-transgenic varieties and single-trait transgenic varieties.
[0117] The present invention provides a transgenic soybean event LP207-1, as well as nucleic acid sequences and detection methods for detecting soybean plants containing the event. The transgenic soybean event LP207-1 is resistant to feeding damage by lepidopteran pests and tolerates the phytotoxic effects of agricultural herbicides including glyphosate and glufosinate. The dual-trait soybean plant expresses the Cry1Ab and Cry1Fa proteins of Bacillus thuringiensis, which provide resistance to feeding damage by lepidopteran pests (such as cotton bollworm, beet armyworm, Spodoptera litura, soybean borer, and fall armyworm); and expresses the glyphosate-resistant 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) protein of Agrobacterium strain CP4 and the glufosinate-resistant glufosinate acetyltransferase (PAT) protein of Streptomyces viridochromogenes, which confer tolerance to glyphosate and glufosinate. BRIEF DESCRIPTION OF THE DRAWINGS
[0118] Figure 1 This is a schematic diagram of the structure of the transgenic insertion sequence and soybean genome of the present invention;
[0119] Figure 2 Schematic diagram of the structure of the recombinant expression vector pLP207 of the present invention;
[0120] Figure 3 The in vitro resistance effect of the transgenic soybean comprising the transgenic soybean event LP207-1 of the present invention against lepidopteran pests;
[0121] Figure 4 This is a diagram showing the effect of artificial inoculation of transgenic soybeans containing transgenic soybean event LP207-1 of the present invention with cotton bollworms in the field;
[0122] Figure 5 This is a diagram showing the effects of the natural occurrence conditions of the beet armyworm in transgenic soybeans containing the transgenic soybean event LP207-1 of the present invention;
[0123] Figure 6 This is a diagram showing the field effects of the transgenic soybeans comprising the transgenic soybean event LP207-1 of the present invention under the natural occurrence conditions of the fall armyworm;
[0124] Figure 7 This is a field effect diagram of transgenic soybeans comprising the transgenic soybean event LP207-1 of the present invention when sprayed with 4 times the recommended spraying concentration of glyphosate herbicide;
[0125] Figure 8 This is a field effect diagram of the transgenic soybean comprising the transgenic soybean event LP207-1 of the present invention when sprayed with 4 times the recommended spraying concentration of glufosinate-ammonium herbicide. DETAILED DESCRIPTION
[0126] The present invention is further described in detail below by way of examples, through which the features and advantages of the present invention will become more clearly understood.
[0127] The professional word “exemplary” used herein means “serving as an example, example, or illustration.” Any embodiment described herein as “exemplary” is not necessarily to be construed as preferred or advantageous over other embodiments.
[0128] In addition, the technical features involved in different embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.
[0129] The following is a detailed description of the transgenic soybean event LP207-1 and its detection method.
[0130] Example 1 Cloning and transformation
[0131] 1.1. Vector cloning
[0132] Standard gene cloning techniques were used to construct the recombinant expression vector pLP207 ( Figure 2The vector pLP207 contains four tandem transgenic expression cassettes. The first expression cassette consists of the Arabidopsis thaliana ubiquitin gene promoter Ubi (pAtUbi10), operably linked to the insect resistance gene Cry1Fa (Cry1Fa) of Bacillus thuringiensis, and operably linked to the terminator tNos from Agrobacterium tumefaciens. The second expression cassette consists of the cauliflower mosaic virus (CaMV) p35S promoter, operably linked to the gene encoding glufosinate acetyltransferase (PAT), and operably linked to the cauliflower mosaic virus (CaMV) 35S terminator; the third expression cassette consists of the Arabidopsis thaliana promoter and leader sequence (pATRbcS4) encoding the small subunit of 1,5-bisphosphate carboxylase / oxygenase, the E9 Arabidopsis thaliana gene promoter, operably linked to the Arabidopsis thaliana signal peptide sequence (spAtRbcS4) encoding the small subunit of 1,5-bisphosphate carboxylase / oxygenase, operably linked to the Cry1Ab protein (Cry1Ab) of insect resistance from Bacillus thuringiensis, and operably linked to the 3'UTR sequence transcription terminator of the PT1 gene encoding a phosphate transporter from Medicago truncatula (tMtPt The fourth expression cassette consisted of the promoter of the Tsf1 gene (pGm17gTsf1) derived from the soybean elongation factor EF-1alpha, operably linked to the Arabidopsis thaliana chloroplast transit peptide (spAtCTP2), operably linked to the glyphosate-tolerant 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) from the Agrobacterium tumefaciens strain CP4, and operably linked to the 3' non-transcribed sequence terminator (tPsE9) from the pea ribosomal 1,5-bisphosphate carboxylase small subunit (RbcS2) E9 gene. This vector, pLP207, was transformed into Agrobacterium tumefaciens LBA4404 (Invitrogen, Chicago, USA; Cat. No. 18313-015) using liquid nitrogen. Transformed cells were selected using the 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) selectable marker.
[0133] 1.2 Plant Transformation
[0134] Conventional Agrobacterium infection was used for transformation. Aseptically cultured soybean (soybean variety Tianlong No. 1) immature embryos were co-cultured with the Agrobacterium described in Example 1.1 to transfer the T-DNA in the constructed recombinant expression vector pLP207 into the soybean chromosome to produce a transgenic soybean event.
[0135] For Agrobacterium-mediated soybean transformation, briefly, immature embryos are isolated from soybeans and contacted with a suspension of Agrobacterium, which is able to transform cry1Ab, cry1F, epsps, and patThe nucleic acid sequence of the gene is transferred to at least one cell of one of the embryos (step 1: infection step), in which the embryo is immersed in a suspension of Agrobacterium (OD 660 = 0.4-0.6, and inoculated with infection medium (4.3 g / L MS salts, MS vitamins, 300 mg / L casein, 68.5 g / L sucrose, 36 g / L glucose, 40 mg / L acetosyringone (AS), 1 mg / L 2,4-dichlorophenoxyacetic acid (2,4-D), pH 5.3) for initial inoculation. The immature embryos are co-cultivated with Agrobacterium for a period of three days (Step 2: Co-cultivation Step). Specifically, after the infection step, the immature embryos are cultured on solid medium (4.3 g / L MS salts, MS vitamins, 300 mg / L casein, 20 g / L sucrose, 10 g / L glucose, 100 mg / L acetosyringone (AS), 1 mg / L 2,4-dichlorophenoxyacetic acid (2,4-D), 8 g / L agar, pH 5.8). This co-cultivation period can be followed by an optional "recovery" step. During the "recovery" step, the recovery medium (4.3 g / L MS salts, MS vitamins, 300 mg / L casein, 30 g / L sucrose, 1 mg / L 2,4-dichlorophenoxyacetic acid (2,4-D), 3 g / L phytagel, pH 5.8) contains at least one antibiotic (cephalosporin) known to inhibit Agrobacterium growth, and no selective agent for plant transformants is added (Step 3: Recovery Step). Specifically, immature embryos are cultured on solid medium containing antibiotics but no selective agent to eliminate Agrobacterium and provide a recovery period for infected cells. Subsequently, the inoculated immature embryos are cultured on medium containing the selective agent (N-(phosphonomethyl)glycine) to select for growing transformed callus (Step 4: Selection Step). Specifically, immature embryos are cultured on a selective solid medium (MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, N-(phosphonomethyl)glycine 0.25 mol / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, phytagel 3 g / L, pH 5.8) containing a selective agent, resulting in the selective growth of transformed cells. Callus tissue is then regenerated into plants (step 5: regeneration step). Specifically, callus tissue grown on a medium containing a selective agent is cultured on solid media (MS differentiation medium and MS rooting medium) to regenerate plants.
[0136] The resistant callus obtained by screening was transferred to the MS differentiation medium (MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, 6-benzyladenine 2 mg / L, N-(phosphonomethyl)glycine 0.125 mol / L, phytagel 3 g / L, pH = 5.8) and cultured at 25°C for differentiation. The differentiated seedlings were transferred to the MS rooting medium (MS salts 2.15 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, indole-3-acetic acid 1 mg / L, agar 8 g / L, pH = 5.8), cultured at 25°C to a height of about 10 cm, and then moved to a greenhouse for culture until fruiting. In the greenhouse, culture was carried out at 28°C for 16 hours and then at 20°C for 8 hours each day.
[0137] 1.3 Identification and screening of transgenic events
[0138] A total of 1,500 independent transgenic T0 plants were generated. All T0 plants were subjected to molecular testing (including target gene copy number and insertion location), target traits (insect resistance and herbicide tolerance), and agronomic trait evaluation. Abnormal transformants were eliminated, and LP207-1 was selected.
[0139] Example 2 Detection of transgenic soybean event LP207-1 using TaqMan
[0140] About 100 mg of leaves from transgenic soybean event LP207-1 were taken as samples, and their genomic DNA was extracted using Qiagen's DNeasy PlantMaxi Kit. The Taqman probe fluorescence quantitative PCR method was used to detect the cry1Ab 、 cry1Fa 、 epsps and pat The copy number of the gene was determined. Wild-type soybean plants (non-transgenic, transgenic recipients) were used as controls and the assays were performed according to the above method. The experiment was repeated three times and the average value was taken.
[0141] The specific method is as follows:
[0142] Step 11: 100 mg of leaves from the transgenic soybean event LP207-1 were taken and ground into a homogenate using liquid nitrogen in a mortar. Three replicates were taken for each sample.
[0143] Step 12: Use Qiagen's DNeasy Plant Mini Kit to extract genomic DNA from the above samples. For specific methods, refer to the product manual.
[0144] Step 13: Determine the genomic DNA concentration of the sample using NanoDrop 2000 (Thermo Scientific);
[0145] Step 14: adjusting the genomic DNA concentration of the above samples to the same concentration value, wherein the concentration value ranges from 80 to 100 ng / μl;
[0146] Step 15: Taqman probe fluorescence quantitative PCR method was used to identify the copy number of the sample. The sample with known copy number was used as the standard, and the sample of wild-type soybean plant (non-transgenic, transformed recipient) was used as the control. Each sample was repeated three times, and the average value was taken. The fluorescence quantitative PCR primer and probe sequences were:
[0147] The following primers and probes were used for detection cry1Fa Gene sequence:
[0148] Primer 1: CTCGGTCTATGTTCAAGCTGCTAA, as shown in SEQ ID NO: 16 in the sequence listing;
[0149] Primer 2: ACCTTGCCCAAACGACACA, as shown in SEQ ID NO: 17 in the sequence listing;
[0150] Probe 1: CTGCACTTGTCACTACTGCGCGACG, as shown in SEQ ID NO: 18 in the sequence listing;
[0151] The following primers and probes were used to detect pat Gene sequence:
[0152] Primer 3: TTGAGATTAGGCCAGCTAC, as shown in SEQ ID NO: 19 in the sequence listing;
[0153] Primer 4: TGTGGTGTTTGTGGCTCTGTCCTAA, as shown in SEQ ID NO: 20 in the sequence listing;
[0154] Probe 2: TAACCATTACATTGAGACGTCTACAGTGAA, as shown in SEQ ID NO: 21 in the sequence listing;
[0155] The following primers and probes were used to detect cry1Ab Gene sequence:
[0156] Primer 5: TGGGAGGACGGAATGATATTG, as shown in SEQ ID NO: 22 in the sequence listing;
[0157] Primer 6: AACTCGTCCGTGAGCATCATC, as shown in SEQ ID NO: 23 in the sequence listing;
[0158] Probe 3: AACTCCGCGCTGCGATGAATCC, as shown in SEQ ID NO: 24 in the sequence listing;
[0159] The following primers and probes were used to detect epsps Gene sequence:
[0160] Primer 7: GGTGTGCAGGTGAAGTCTGAAG, as shown in SEQ ID NO: 25 in the sequence listing;
[0161] Primer 8: TTGGCGTTGGAGTCTTTGGT, as shown in SEQ ID NO: 26 in the sequence listing;
[0162] Probe 4: CGGTGATCGTCTTCCAGTTACCTTGCG, as shown in SEQ ID NO: 27 in the sequence listing;
[0163] The PCR reaction system is:
[0164] JumpStartTMTaq ReadyMixTM (Sigma) 10μL;
[0165] 50× primer / probe mixture 1 μL;
[0166] 3 μL of genomic DNA;
[0167] Water (ddH2O) 6 μL;
[0168] The 50× primer / probe mixture contained 45 μL of each primer at 1 mM concentration, 50 μL of probe at 100 μM concentration, and 860 μL of 1× TE buffer and was stored in amber tubes at 4°C.
[0169] PCR reaction conditions are:
[0170] Step Temperature Time
[0171] 21 95℃ 5min;
[0172] 22 95℃ 30s;
[0173] 23 60℃ 1min;
[0174] 24 Return to step 22 and repeat 40 times.
[0175] The data were analyzed using SDS2.3 software (Applied Biosystems), and a single-copy transgenic soybean event LP207-1 was obtained.
[0176] Example 3 Detection of Transgenic Soybean Event LP207-1
[0177] 3.1 Genomic DNA Extraction
[0178] DNA extraction was performed according to the conventional CTAB (cetyltrimethylammonium bromide) method: 2 g of young leaves of transgenic soybean event LP207-1 were ground into powder in liquid nitrogen, and then 0.5 mL of DNA extraction CTAB buffer (20 g / L CTAB, 1.4 M NaCl, 100 mM Tris-HCl, 20 mM EDTA (ethylenediaminetetraacetic acid)], adjust the pH to 8.0 with NaOH, mix thoroughly, and extract at 65°C for 90 minutes; add 0.5 times the volume of phenol and 0.5 times the volume of chloroform, mix by inversion; centrifuge at 12000 rpm (revolutions per minute) for 10 minutes; aspirate the supernatant, add 1 volume of isopropanol, gently shake the centrifuge tube, and let it stand at -20°C for 30 minutes; centrifuge at 12000 rpm for another 10 minutes; collect DNA to the bottom of the tube; discard the supernatant, wash the precipitate with 0.5 mL of 70% ethanol; centrifuge at 12000 rpm for 5 minutes; vacuum dry or blow dry in a clean bench; dissolve the DNA precipitate in an appropriate amount of TE buffer (10mM Tris-HCl, 1mM EDTA, pH 8.0) and store at -20°C.
[0179] 3.2 Analysis of flanking DNA sequences
[0180] The concentration of the DNA sample extracted above was measured to make the concentration of the sample to be tested between 80-100 ng / μL. Spe I. Pst I. Bss HII (5' end analysis) and Sac I. Kpn I. Xma I. NheI (3' end analysis) digested the genomic DNA separately. Add 26.5 μL of genomic DNA, 0.5 μL of the restriction endonuclease selected above, and 3 μL of digestion buffer to each digestion system, and digest for 1 hour at an appropriate temperature. After the digestion is completed, add 70 μL of anhydrous ethanol to the digestion system, ice bath for 30 minutes, centrifuge at 12000 rpm for 7 minutes, discard the supernatant, blow dry, then add 8.5 μL of double distilled water (ddH2O), 1 μL of 10×T4 Buffer, and 0.5 μL of T4 ligase and connect at 4°C overnight. PCR amplification is performed using a series of nested primers to separate 5' and 3' transgenic / genomic DNA. Specifically, the primer combination for separating 5' transgenic / genomic DNA includes sequences SEQ ID NO: 13 and SEQ ID NO: 34 as first primers, sequences SEQ ID NO: 35 and SEQ ID NO: 36 as second primers, and sequence SEQ ID NO: 13 as a sequencing primer. The primer combination for isolating 3' transgene / genomic DNA includes sequences of SEQ ID NO: 15 and SEQ ID NO: 37 as first primers, sequences of SEQ ID NO: 38 and SEQ ID NO: 39 as second primers, and sequence of SEQ ID NO: 15 as sequencing primer. The PCR reaction conditions are shown in Table 3.
[0181] The obtained amplicons were electrophoresed on a 2.0% agarose gel to separate the PCR products, and the target fragments were subsequently isolated from the agarose matrix using a QIAquickGel extraction kit (Catalog # 28704, Qiagen Inc., Valencia, CA). The purified PCR products were then sequenced (e.g., ABI Prism™ 377, PE Biosystems, Foster City, CA) and analyzed.
[0182] Standard PCR methods were used to confirm the 5' and 3' flanking sequences and junction sequences. The 5' flanking and junction sequences can be confirmed using the sequences of SEQ ID NO:8 or SEQ ID NO:12, or in combination with SEQ ID NO:9, SEQ ID NO:13, or SEQ ID NO:34. The 3' flanking and junction sequences can be confirmed using the sequences of SEQ ID NO:11 or SEQ ID NO:14, or in combination with SEQ ID NO:10, SEQ ID NO:15, or SEQ ID NO:37. The PCR reaction system and amplification conditions are shown in Tables 3 and 4. Those skilled in the art will appreciate that other primer sequences can also be used to confirm the flanking and junction sequences.
[0183] DNA sequencing of the PCR products provides DNA that can be used to design other DNA molecules that serve as primers and probes for identification of soybean plants or seeds derived from transgenic soybean event LP207-1.
[0184] The soybean genomic sequence is found at nucleotides 1-514 of SEQ ID NO:5, flanking the right border of the insertion sequence of transgenic soybean event LP207-1 (the 5' flanking sequence). The soybean genomic sequence is found at nucleotides 13923-14370 of SEQ ID NO:5, flanking the left border of the insertion sequence of transgenic soybean event LP207-1 (the 3' flanking sequence). The 5' junction sequence is listed in SEQ ID NO:1, and the 3' junction sequence is listed in SEQ ID NO:2.
[0185] 3.3. PCR zygosity determination
[0186] Junction sequences are relatively short polynucleotide molecules that are novel DNA sequences that, when detected in a polynucleotide detection assay, are diagnostic for the DNA of transgenic soybean event LP207-1. The binding sequence of SEQ ID NO:1 consists of 10 bp on either side of the T-DNA RB region insertion site and the soybean genomic DNA insertion site of transgenic soybean event LP207-1. The binding sequence of SEQ ID NO:2 consists of 10 bp on either side of the T-DNA LB region insertion site and the soybean genomic DNA insertion site of transgenic soybean event LP207-1. Longer or shorter polynucleotide junction sequences can be selected from sequences of SEQ ID NO:3 or SEQ ID NO:4. Junction sequences (5' junction region of SEQ ID NO:1 and 3' junction region of SEQ ID NO:2) are useful as DNA probes or primers in DNA detection methods. Junction sequences of SEQ ID NO:6 and SEQ ID NO:7 are also novel DNA sequences in transgenic soybean event LP207-1 and can also be used as DNA probes or primers to detect the presence of transgenic soybean event LP207-1 DNA. The sequence SEQ ID NO:6 (nucleotides 515-1080 of SEQ ID NO:3) spans the LP207 construct DNA sequence and the pAtUbil0 transcription promoter sequence, and the sequence SEQ ID NO:7 (nucleotides 1-612 of SEQ ID NO:4) spans the tPsE9 transcription termination sequence and the LP207 construct DNA sequence.
[0187] Additionally, amplicons were generated by using primers derived from at least one of the sequences of SEQ ID NO: 3 or SEQ ID NO: 4, which when used in a PCR method produced an amplicon diagnostic for transgenic soybean event LP207-1.
[0188] Specifically, a PCR product was generated from the 5' end of the transgenic insert sequence, which PCR product is a portion of the genomic DNA flanking the 5' end of the T-DNA insert sequence in the genome of plant material derived from transgenic soybean event LP207-1. This PCR product comprises the sequence SEQ ID NO: 3. For PCR amplification, primer 11 (SEQ ID NO: 8) was designed to hybridize to the genomic DNA sequence flanking the 5' end of the transgenic insert sequence, and primer 12 (SEQ ID NO: 9) was paired with primer 11, which is located in the transcriptional promoter sequence of the transgenic pAtUbil0.
[0189] A PCR product was generated from the 3' end of the transgenic insert sequence. This PCR product comprises a portion of genomic DNA from plant material of transgenic soybean event LP207-1 flanking the 3' end of the T-DNA insert sequence. This PCR product comprises SEQ ID NO: 4. For PCR amplification, primer 14 (SEQ ID NO: 11) was designed to hybridize to the genomic DNA sequence flanking the 3' end of the transgenic insert sequence. Primer 13 (SEQ ID NO: 10) was paired with the tNos transcriptional terminator sequence located at the 3' end of the insert.
[0190] The DNA amplification conditions described in Tables 3 and 4 can be used in the above-described PCR zygosity assay to generate diagnostic amplicons for transgenic soybean event LP207-1. Detection of the amplicons can be performed using a Stratagene Robocycle, MJEngine, Perkin-Elmer 9700, or Eppendorf Mastercycler Gradient thermocycler, or other methods and equipment known to those skilled in the art.
[0191] Table 3. 5' transgenic insert / genomic junction region for transgenic soybean event LP207-1
[0192] Identified PCR steps and reaction mixture conditions
[0193]
[0194] Table 4. Perkin-Elmer 9700 Thermal Cycler Conditions
[0195]
[0196] Mix gently and add 1-2 drops of mineral oil over each reaction mixture if there is no insulating cap on the thermal cycler. PCR was performed using the above cycling parameters (Table 4) on a Stratagene Robocycler (Stratagene, La Jolla, CA), an MJ Engine (MJ R-Biorad, Hercules, CA), a Perkin-Elmer 9700 (Perkin Elmer, Boston, MA), or an Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) thermal cycler. The MJ Engine or Eppendorf Mastercycler Gradient thermal cycler should be run in calculated mode. The Perkin-Elmer 9700 thermal cycler should be run with the ramp speed set to maximum.
[0197] The experimental results showed that: primers 11 and 12 (sequence SEQ ID NO: 8 and 9), when used in the PCR reaction of the genomic DNA of the transgenic soybean event LP207-1, produced an amplification product of a 1080 bp fragment, and when used in the PCR reaction of the untransformed soybean genomic DNA and the non-LP207-1 soybean genomic DNA, no fragment was amplified; primers 13 and 14 (sequence SEQ ID NO: 10 and 11), when used in the PCR reaction of the genomic DNA of the transgenic soybean event LP207-1, produced an amplification product of a 1060 bp fragment, and when used in the PCR reaction of the untransformed soybean genomic DNA and the non-LP207-1 soybean genomic DNA, no fragment was amplified.
[0198] PCR zygosity assays can also be used to identify whether material derived from transgenic soybean event LP207-1 is homozygous or heterozygous. Primer 15 (SEQ ID NO: 12), primer 16 (SEQ ID NO: 13), and primer 17 (SEQ ID NO: 14), or primer 16 (SEQ ID NO: 13), primer 17 (SEQ ID NO: 14), and primer 18 (SEQ ID NO: 15) are used in an amplification reaction to generate a diagnostic amplicon for transgenic soybean event LP207-1. The DNA amplification conditions described in Tables 5 and 6 can be used in the above zygosity assays to generate a diagnostic amplicon for transgenic soybean event LP207-1.
[0199] Table 5. Zygosity assay reaction solution
[0200]
[0201] Table 6. Zygosity determination conditions for Perkin-Elmer 9700 thermal cycler
[0202]
[0203] PCR was performed using the above cycling parameters (Table 6) on a Stratagene Robocycler (Stratagene, La Jolla, CA), an MJ Engine (MJ R-Biorad, Hercules, CA), a Perkin-Elmer 9700 (Perkin Elmer, Boston, MA), or an Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) thermal cycler. The MJ Engine or Eppendorf Mastercycler Gradient thermal cycler should be run in calculated mode. The Perkin-Elmer 9700 thermal cycler should be run with the ramp speed set to maximum.
[0204] In the amplification reaction, the biological sample containing template DNA contains DNA diagnostic for the presence of transgenic soybean event LP207-1 in the sample. Alternatively, the reaction will produce two distinct DNA amplicons from a biological sample containing DNA derived from a soybean genome that is heterozygous for the allele corresponding to the inserted DNA present in transgenic soybean event LP207-1. These two distinct amplicons will correspond to a first amplicon derived from a wild-type soybean genomic locus and a second amplicon diagnostic for the presence of transgenic soybean event LP207-1 DNA. A soybean DNA sample that produces only a single amplicon corresponding to the second amplicon described for a heterozygous genome can be diagnostic for the presence of transgenic soybean event LP207-1 in the sample, and the sample is produced from soybean seeds that are homozygous for the allele corresponding to the inserted DNA present in the transgenic soybean plant LP207-1.
[0205] It should be noted that primer pairs specific to transgenic soybean event LP207-1 were used to generate amplicons diagnostic for genomic DNA from transgenic soybean event LP207-1. These primer pairs, including but not limited to primers 11 and 12 (SEQ ID NOs: 8 and 9), and primers 13 and 14 (SEQ ID NOs: 10 and 11), were used in the described DNA amplification method. Additionally, control primers 9 and 10 (SEQ ID NOs: 28 and 29), designed to amplify endogenous soybean genes, were included as an internal standard for reaction conditions. Analysis of transgenic soybean event LP207-1 DNA extracts should include a positive control DNA extract from transgenic soybean event LP207-1, a negative control DNA extract from a non-transgenic soybean event LP207-1, and a negative control containing no template soybean DNA. In addition to these primer pairs, any primer pair derived from the sequences of SEQ ID NO: 3 or SEQ ID NO: 4, or their complements, which, when used in a DNA amplification reaction, produce an amplicon comprising the sequences of SEQ ID NO: 1 or SEQ ID NO: 2, respectively, that is diagnostic for tissue derived from transgenic soybean event LP207-1 can be used. The DNA amplification conditions described in Tables 4-6 can be used to generate diagnostic amplicons for transgenic soybean event LP207-1 using appropriate primer pairs. Extracts presumed to contain soybean plant or seed DNA comprising transgenic soybean event LP207-1, or products derived from transgenic soybean event LP207-1, that produce amplicons diagnostic for transgenic soybean event LP207-1 when tested in a DNA amplification method can be used as templates for amplification to determine the presence of transgenic soybean event LP207-1.
[0206] Example 4 Detection of Transgenic Soybean Event LP207-1 by Southern Blot Hybridization
[0207] 4.1 DNA Extraction for Southern Blot Hybridization
[0208] Southern blot analysis was performed using homozygous transformation events from the T4 and T5 generations. Approximately 5 to 10 g of plant tissue was ground in liquid nitrogen using a mortar and pestle. The tissue was resuspended in 12.5 mL of extraction buffer A (0.2 M Tris pH 8.0, 50 mM EDTA, 0.25 M NaCl, 0.1% v / v β-mercaptoethanol, 2.5% w / v polyvinylpyrrolidone) and centrifuged at 4000 rpm for 10 minutes (2755 g). The supernatant was discarded and the pellet was resuspended in 2.5 mL of extraction buffer B (0.2 M Tris pH 8.0, 50 mM EDTA, 0.5 M NaCl, 1% v / v β-mercaptoethanol, 2.5% w / v polyvinylpyrrolidone, 3% sarkosyl, 20% ethanol) and incubated at 37°C for 30 minutes. During the incubation period, the sample was mixed once with a sterile loop. After incubation, add an equal volume of chloroform / isoamyl alcohol (24:1), mix gently by inversion, and centrifuge at 4000rpm for 20 minutes. Collect the aqueous layer and centrifuge at 4000rpm for 5 minutes to precipitate DNA after adding 0.54 volume isopropanol. Discard the supernatant and resuspend the DNA pellet in 500μL TE. In order to degrade any RNA present, at 37°C, DNA and 1μL 30mg / mL RNAaseA were incubated for 30 minutes, centrifuged at 4000rpm for 5 minutes, and in the presence of 0.5 volume 7.5M ammonium acetate and 0.54 volume isopropanol, precipitate the DNA by centrifugation at 14000rpm for 10 minutes. After discarding the supernatant, wash the pellet with 500μL of 70% ethanol by mass and resuspend it in 100μL TE after drying.
[0209] 4.2 Restriction enzyme digestion
[0210] Quantify the DNA concentration using a spectrophotometer or fluorometer (using 1×TAE and GelRED dye). Digest 5 μg of DNA each time in a 100 μL reaction system. SnaB I and Mf I digested genomic DNA, using the partial sequence of Cry1Fa on T-DNA as a probe; using restriction endonuclease Sph I and Sac I digested genomic DNA and used the partial sequence of PAT on T-DNA as a probe; Sac I and Hind The genomic DNA was digested separately using the partial sequences of Cry1Ab and EPSPS on the T-DNA as probes. The digests were incubated overnight at an appropriate temperature for each enzyme. The samples were spun down to 30 μL using a speed vacuum.
[0211] 4.3 Gel Electrophoresis
[0212] Bromophenol blue loading dye was added to each sample from Example 4.2, and each sample was loaded onto a 0.7% agarose gel containing ethidium bromide and separated by electrophoresis in TBE running buffer. The gel was run at 20 volts overnight.
[0213] Wash the gel for 15 minutes in 0.25M HCl to depurinate the DNA, then wash with water. Set up Southern blot hybridization as follows: place 20 thick dry blotting papers in a dish, and place 4 thin dry blotting papers on it. In 0.4M NaOH, pre-wet 1 thin blotting paper and place it on the paper stack, then place 1 Hybond-N+ transfer membrane (Amersham Pharmacia Biotech, #RPN303B) pre-wetted in 0.4M NaOH. The gel is placed on the top to ensure that there are no bubbles between the gel and the membrane. 3 additional pre-soaked blotting papers are placed on the top of the gel and fill the buffer tray with 0.4M NaOH. Connect the gel stack and buffer tray with a wick pre-soaked in 0.4M NaOH and transfer the DNA to the membrane. Carry out DNA transfer for about 4 hours at room temperature. After the transfer, rinse the Hybond membrane for 10 seconds in 2×SSC, and the DNA is bound to the membrane by UV cross-linking.
[0214] 4.4 Hybridization
[0215] Use PCR to amplify a suitable DNA sequence for probe preparation. The DNA probe is the sequence SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32 and SEQ ID NO:33, or a portion thereof that is homologous or complementary to the above sequences. 25 ng of probe DNA was boiled in 45 μL TE for 5 minutes, placed on ice for 7 minutes, and then transferred to a Rediprime II (Amersham Pharmacia Biotech, #RPN1633) tube. After adding 5 μL 32P-labeled dCTP to the Rediprime tube, the probe was incubated at 37°C for 15 minutes. The probe was purified by centrifugation through a microcentrifuge G-50 column (Amersham Pharmacia Biotech, #27-5330-01) according to the manufacturer's instructions to remove unincorporated dNTPs. Probe activity was measured using a scintillation counter. Prehybridize the Hybond membrane by wetting it with 20 mL of pre-warmed Church's prehybridization solution (500 mM Na3PO4, 1 mM EDTA, 7% SDS, 1% BSA) at 65°C for 30 minutes. Boil the labeled probe for 5 minutes and place on ice for 10 minutes. Add an appropriate amount of probe (1 million counts per 1 mL of prehybridization buffer) to the prehybridization buffer and hybridize overnight at 65°C. The next day, discard the hybridization buffer, rinse with 20 mL of Church's wash solution 1 (40 mM Na3PO4, 1 mM EDTA, 5% SDS, 0.5% BSA), and then wash the membrane in 150 mL of Church's wash solution 1 at 65°C for 20 minutes. Repeat this process twice with Church's wash solution 2 (40 mM Na3PO4, 1 mM EDTA, 1% SDS). Expose the membrane to a phosphor screen or X-ray film to detect probe binding sites.
[0216] Two control samples were included on each Southern run: (1) DNA from a negative (untransformed) segregant, which was used to identify any endogenous soybean sequences that hybridized to the element-specific probe; and (2) DNA from a positive segregant, in which the Hin The amount of dIII-digested pLP207 was equivalent to one copy number based on the probe length to illustrate the sensitivity of the assay in detecting single gene copies within the soybean genome.
[0217] Hybridization data provide conclusive evidence supporting TaqMan TM PCR analysis showed that soybean plant LP207-1 contained Cry1Fa 、 PAT 、 Cry1Ab and EPSPS Using this Cry1Fa probe, SnaB I and Mfe I enzyme digestion produced single bands of approximately 4.1 kb and 9.5 kb, respectively; using PAT probe, Sph I and Sac I enzyme digestion produced single bands of approximately 17.6 kb and 10.6 kb, respectively; using Cry1Ab probe, Sac I and Hind III enzyme digestion produced single bands of approximately 10.6 kb and 9.7 kb, respectively; using this EPSPS probe, Sac I and Hind The digestion with 1:1 fragment III produced single bands of approximately 18.7 kb and 9.7 kb, respectively, indicating that one copy each of Cry1Ab, PAT, Cry1Fa, and EPSPS was present in soybean transformation event LP207-1.
[0218] Example 5 Insect Resistance Detection
[0219] 5.1. Bioassay of soybean plant LP207-1
[0220] The transgenic soybean event LP207-1 and wild-type soybean plants (non-transgenic, transformed recipient control (CK-)) were infected with soybean borer ( Leguminivora glycinivorella )、Fall armyworm( Spodoptera frugiperda ), Spodoptera litura ( Spodoptera litura ), cotton bollworm ( Helicoverpa armigera ) and Spodoptera exigua ( Spodoptera exigua ) Bioassay was performed as follows:
[0221] Fresh leaves (V3-V4 stage) from transgenic soybean event LP207-1 and wild-type soybean plants (non-transgenic, transgenic recipient control (CK-)) were collected and rinsed with sterile water and blotted dry with absorbent paper. The leaves were then deveined and cut into approximately 1 cm × 2 cm strips. One to three (the number of leaves was determined based on insect feeding) strips were placed on filter paper moistened with distilled water at the bottom of a circular plastic Petri dish. Ten newly hatched larvae were placed in each dish. The test dishes were covered and incubated for 5 days at a temperature of 26-28°C, a relative humidity of 70%-80%, and a photoperiod (light / dark ratio) of 16:8. The results were then counted. Mortality was calculated (mortality = (number of dead insects / number of test insects) × 100%) to assess resistance levels. The results are shown in Tables 7 and 8. Figure 3 shown.
[0222] Table 7. In vitro insect resistance bioassay results of transgenic soybean event LP207-1 - mortality (%)
[0223]
[0224] 5.2. Field Insect Resistance Evaluation of Transgenic Soybean Event LP207-1
[0225] (1)Bollworm
[0226] The transgenic soybean event LP207-1 was artificially inoculated with insects at the soybean seedling stage, for a total of 2 inoculations. 20 artificially reared newly hatched larvae were inoculated on the front of each soybean leaf. Three days after inoculation, the second inoculation was carried out with the same number of insects as the first. 14-21 days after inoculation, the leaf damage rate, the number of surviving larvae on each leaf, and the length of leaf damage were investigated plant by plant. Usually, the investigation begins 14 days after inoculation. If the damage level of the negative control material (CK-) reaches susceptible or highly susceptible, it is considered effective. If it does not reach the level, the investigation can be appropriately postponed. However, if it still does not reach the corresponding level 21 days after inoculation, the inoculation is considered invalid. According to the leaf damage rate and the number of surviving larvae, the average damage level of cotton bollworm to leaves at the soybean seedling stage in each plot was calculated according to the standards in Table 8, and the resistance level of soybean seedlings to cotton bollworm was determined according to the standards in Table 9. The results of the resistance of the transgenic soybean event LP207-1 to cotton bollworm at the seedling stage are shown in the figure. Figure 4 and as shown in Table 10. The results showed that the transgenic soybean event LP207-1 had a high level of resistance to cotton bollworm, and the leaf damage rate, larval survival number and leaf damage level of the transgenic soybean event LP207-1 were significantly lower than those of the transformed receptor control (CK-).
[0227] Table 8. Grading standards for the degree of damage to soybean leaves caused by cotton bollworms
[0228]
[0229] Table 9. Evaluation criteria for soybean leaf resistance to cotton bollworm
[0230]
[0231] Table 10. Resistance results of transgenic soybean event LP207-1 to cotton bollworm at seedling stage
[0232]
[0233] (2) Beet armyworm
[0234] In March 2023, a field test of beet armyworm resistance was conducted on transgenic soybeans in Yazhou District, Sanya City, Hainan Province. Ten to 15 days after the initial infestation, when the control (CK-) plants were mostly infested by 4-6 instar larvae, the rate of beet armyworm damage to soybean plants was investigated plant by plant. Figure 5The results are shown in Table 11. The results showed that under the natural occurrence conditions of Spodoptera exigua, the damage rate of Spodoptera exigua to the transgenic soybean event LP207-1 was significantly reduced compared with the control (CK-), indicating that the transgenic soybean event LP207-1 has a high resistance to Spodoptera exigua.
[0235] Table 11. Resistance results of transgenic soybean event LP207-1 to beet armyworm under natural insect infestation conditions
[0236]
[0237] (3) Fall armyworm
[0238] In March 2023, a natural field test on fall armyworm was conducted at a transgenic soybean planting base in Yazhou District, Sanya City, Hainan Province. Ten to 15 days after the initial infestation, when the transformed receptor control (CK-) was mostly 4-6 instar larvae, the rate of fall armyworm damage to soybean plants was investigated plant by plant. The results of the transgenic soybean event LP207-1's resistance to fall armyworm are shown in the figure below. Figure 6 and as shown in Table 12. The results showed that under the natural occurrence conditions of Spodoptera frugiperda, the damage rate of Spodoptera frugiperda to transgenic soybean event LP207-1 was significantly reduced compared with the control (CK-), indicating that transgenic soybean event LP207-1 has a high resistance to Spodoptera frugiperda.
[0239] Table 12. Resistance results of transgenic soybean event LP207-1 to Spodoptera frugiperda under natural insect infestation conditions
[0240]
[0241] (4) Spodoptera litura
[0242] In March 2023, a natural field infestation trial against Spodoptera litura was conducted at a transgenic soybean planting base in Yazhou District, Sanya City, Hainan Province. Ten to 15 days after the initial infestation, when the transgenic control (CK-) was primarily infested by 4-6 instar larvae, the rate of S. litura damage to soybean plants was assessed plant by plant. Table 13 shows the resistance of transgenic soybean event LP207-1 to S. litura. The results showed that under naturally occurring conditions, the rate of S. litura damage to transgenic soybean event LP207-1 was significantly lower than that to the control (CK-), demonstrating that transgenic soybean event LP207-1 exhibits high resistance to S. litura.
[0243] Table 13. Resistance results of transgenic soybean event LP207-1 to L. litura under natural insect infestation conditions
[0244]
[0245] (5) Soybean borer
[0246] In March 2023, a natural field infestation trial against soybean borer was conducted at a transgenic soybean planting base in Yazhou District, Sanya City, Hainan Province. Ten to 15 days after the initial infestation, when the transgenic control (CK-) was primarily infested by 4-6-year-old larvae, the soybean borer damage rate was assessed plant by plant. Table 14 shows the resistance of transgenic soybean event LP207-1 to soybean borer. The results showed that under naturally occurring conditions, soybean borer damage rate was significantly reduced in transgenic soybean event LP207-1 compared to the control (CK-), demonstrating that transgenic soybean event LP207-1 exhibits high resistance to soybean borer.
[0247] Table 14. Resistance results of transgenic soybean event LP207-1 to soybean borer under natural insect infestation conditions
[0248]
[0249] Example 6 Glyphosate Herbicide Tolerance Testing of Transgenic Soybean Event LP207-1
[0250] This experiment used Roundup herbicide (41% glyphosate isopropyl ammonium salt solution) for spraying. A randomized block design was used with 3 replicates. The plot area was 20m 2 Plots were plotted in a 5 m × 4 m plot with 340 seedlings planted. Conventional cultivation and management were used, with 1 m wide isolation strips between plots. Transgenic soybean event LP207-1 and the transformed recipient control (CK-) were treated with the following two treatments: 1) spraying with plain water; 2) spraying with Roundup herbicide at a dose of 3360 g ae / ha at the V3 leaf stage, followed by a second spray at the V8 stage. It should be noted that the following conclusions are based on the conversion of different glyphosate herbicide concentrations and formulations to equivalent amounts of glyphosate acid. Pesticide injury symptoms were assessed one and two weeks after application, and plot yields were measured at harvest. The grading criteria for phytotoxicity symptoms are shown in Table 15. The herbicide damage rate was used as an evaluation metric to assess the herbicide tolerance of the transformation event. Specifically, herbicide damage rate (%) = ∑ (number of affected plants in the same class × number of classes) / (total number of plants × highest class) × 100; the herbicide damage rate refers to the glyphosate damage rate, which was determined based on the results of a phytotoxicity survey two weeks after glyphosate treatment. The soybean yield of each plot was calculated by weighing the total soybean grain yield (weight) of the three central rows of each plot. Yield differences between treatments were measured as yield percentages: Yield percentage (%) = sprayed yield / sprayed water yield × 100. The results of herbicide tolerance and soybean yield for the transgenic soybean event LP207-1 are shown in the figure below. Figure 7 and as shown in Table 16.
[0251] Table 15. Grading standards for the degree of damage caused by glyphosate herbicides to soybeans
[0252]
[0253] Table 16. Results of glyphosate herbicide tolerance and soybean yield of transgenic soybean event LP207-1
[0254]
[0255] The results showed that in terms of herbicide (glyphosate) damage rate: 1) the transgenic soybean event LP207-1 had a damage rate of essentially zero when treated with glyphosate herbicide (3360 g ae / ha), indicating that the transgenic soybean event LP207-1 had good glyphosate herbicide tolerance.
[0256] In terms of yield: There was no significant difference in the yield of the transgenic soybean event LP207-1 under the two treatments of spraying with pure water and spraying with 3360 g ae / ha of glyphosate. After spraying with glyphosate herbicide, the yield of the transgenic soybean event LP207-1 did not decrease basically, which further demonstrated that the transgenic soybean event LP207-1 has good glyphosate herbicide tolerance.
[0257] Example 7 Glufosinate Herbicide Tolerance Testing of Transgenic Soybean Event LP207-1
[0258] This experiment selected the herbicide Glufosinate-ammonium for spraying. A randomized block design was used with 3 replicates. The plot area was 20m 2Plots were arranged in a 5m x 4m plot with 350 seedlings and conventional cultivation management, with 1m-wide isolation strips between plots. Transgenic soybean event LP207-1 was subjected to two treatments: 1) no spraying; 2) spraying with 1680g ae / ha of Glufosinate herbicide at the V3 leaf stage, followed by another spray at the V8 stage. It should be noted that the following conclusions were based on the conversion of different glufosinate herbicide concentrations and formulations to equivalent amounts of glufosinate acid. Pesticide injury symptoms were assessed one and two weeks after application, and plot yields were measured at harvest. Pesticide injury symptom classification is shown in Table 17. The herbicide damage rate is used as an evaluation index to assess the herbicide tolerance of the transformation event. Specifically, the herbicide damage rate (%) = ∑ (number of affected plants at the same level × number of levels) / (total number of plants × highest level); the herbicide damage rate refers to the glufosinate damage rate, which is determined based on the results of the phytotoxicity survey two weeks after glufosinate treatment. The soybean yield of each plot is the total soybean yield (weight) of the three middle rows of each plot. The yield difference between different treatments is measured as a yield percentage, where yield percentage (%) = spraying yield / non-spraying yield. The results of the glufosinate herbicide tolerance and soybean yield of the transgenic soybean event LP207-1 are shown in the figure. Figure 8 and as shown in Table 18.
[0259] Table 17. Grading standards for the degree of damage caused by glufosinate herbicides to soybeans
[0260]
[0261] Table 18. Glufosinate tolerance and soybean yield results for transgenic soybean event LP207-1
[0262]
[0263] The results showed that in terms of herbicide (glufosinate) damage rate: 1) the transgenic soybean event LP207-1 had a damage rate of basically 0 under the treatment of glufosinate herbicide (1680 g ae / ha), thus, the transgenic soybean event LP207-1 had good glufosinate herbicide tolerance.
[0264] In terms of yield: There was no significant difference in the yield of the transgenic soybean event LP207-1 under the two treatments of no spraying and spraying with 1680g ae / ha of glufosinate. After spraying with glufosinate herbicide, the yield of the transgenic soybean event LP207-1 did not decrease basically, which further demonstrated that the transgenic soybean event LP207-1 has good tolerance to glufosinate herbicide.
[0265] In summary, TaqMan TM The regenerated transgenic soybean plants were assayed (see Example 2) for the presence of cry1Ab, cry1Fa, epsps, and pat Genes were selected and characterized for insect resistance and glyphosate and glufosinate herbicide tolerance lines. Based on the copy number of the target gene, good insect resistance, glyphosate and glufosinate herbicide tolerance, and agronomic performance (see Examples 5 and 6), the transgenic soybean event LP207-1 was selected as excellent through screening, having a single copy transgene, good insect resistance, glyphosate and glufosinate herbicide tolerance, and agronomic performance.
[0266] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the technical principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.
Claims
1. A nucleic acid molecule for detecting transgenic soybean event LP207-1, characterized in that: The sequence of the nucleic acid molecule is one or more groups shown in SEQ ID NO: 1-2, SEQ ID NO: 3-4 or SEQ ID NO: 5, and the nucleic acid molecule is derived from the transgenic soybean event LP207-1. The soybean seeds of the transgenic soybean event LP207-1 were deposited in the China Center for Type Culture Collection on May 23, 2025, with the deposit number CCTCC NO: P202516, and the classification name is soybean seed LP207-1 Glycine max L. LP207-1.
2. A DNA primer pair comprising a first primer and a second primer, characterized in that: When the first primer and the second primer are used together in an amplification reaction with DNA containing the transgenic soybean event LP207-1, an amplicon of the transgenic soybean event LP207-1 in the detection sample is produced; the sequence of the first primer is SEQ ID NO: 8, and the sequence of the second primer is SEQ ID NO: 9; or the sequence of the first primer is SEQ ID NO: 10, and the sequence of the second primer is SEQ ID NO: 11; soybean seeds containing the transgenic soybean event LP207-1 have been deposited with the China Center for Type Culture Collection under the deposit number CCTCCNO: P202516.
3. A method for detecting the presence of DNA of transgenic soybean event LP207-1 in a sample, characterized in that: include: (1) contacting a sample to be tested with the DNA primer pair described in claim 2 in a nucleic acid amplification reaction; (2) Performing nucleic acid amplification reaction; (3) Detecting the presence of amplification products; The sequence of the amplified product includes the nucleic acid sequence of SEQ ID NO: 1-2 or its complementary sequence, indicating that the test sample contains the DNA of the transgenic soybean event LP207-1; the soybean seeds containing the transgenic soybean event LP207-1 have been deposited in the China Center for Type Culture Collection with the deposit number CCTCC NO: P202516.
4. A DNA detection kit, characterized in that include: The DNA primer pair according to claim 2.
5. A method for protecting soybean plants from insect infestation, characterized in that The method comprises providing a transgenic soybean plant in the diet of a target insect, wherein the target insect that has ingested the transgenic soybean plant is inhibited from further ingesting the transgenic soybean plant; the target insect is a Lepidoptera insect; and the soybean seeds of the transgenic soybean plant have been deposited in the China Center for Type Culture Collection with the deposit number CCTCCNO: P202516.
6. A method for protecting soybean plants from damage caused by glyphosate and / or glufosinate herbicides, characterized in that Transgenic soybean plants are planted and an effective dose of glyphosate and / or glufosinate herbicide is applied. The soybean seeds of the transgenic soybean plants have been deposited in the China Center for Type Culture Collection with the deposit number CCTCC NO: P202516.
7. A method for controlling weeds in a field of soybean plants, characterized in that The method comprises applying an effective dose of glyphosate and / or glufosinate herbicide to a field where transgenic soybean plants are planted. The soybean seeds of the transgenic soybean plants have been deposited in the China Center for Type Culture Collection with the deposit number CCTCC NO: P202516.
Citation Information
Patent Citations
Transgenic soybean event LP086-2 and detection method thereof
CN116694812A