Broad-spectrum influenza mRNA vaccine

Abstract

Relates to the field of biological medicine and virology, in particular to an mRNA vaccine for preventing or treating influenza virus infection. Polynucleotides encoding influenza virus NP and M2e, such as mRNA, are provided, which are optimized with human cell preference codon sequences. Also provided are compositions and vaccines comprising the polynucleotides, as well as methods of treating or preventing influenza virus infection using the polynucleotides, compositions, or vaccines.

Description

A broad-spectrum influenza mRNA vaccine Technical Field

[0001] The present invention relates to the fields of biomedicine and virology, and in particular to an mRNA vaccine for preventing or treating influenza virus infection. Background Art

[0002] Influenza poses a serious threat to global public health, causing significant harm to human health and the global economy. Vaccination is one of the most effective measures to prevent influenza. Currently available influenza vaccines include split-virus vaccines, whole-virus inactivated vaccines, live-attenuated vaccines, and subunit vaccines. They primarily protect against influenza by inducing neutralizing antibodies specific for hemagglutinin (HA) and neuraminidase (NA) on the influenza virus envelope.

[0003] The HA type of influenza viruses is highly variable, and antigenic drift and shift in HA often lead to seasonal influenza epidemics and pandemics. When the vaccine strain and the circulating strain do not match, protective efficacy is lacking. Currently, seasonal influenza vaccines primarily target HA and NA antigens, and new vaccines need to be prepared almost annually based on predicted strains. To reduce the frequency of vaccine re-preparation, it is necessary to develop broad-spectrum influenza vaccines, such as those targeting conserved influenza virus antigens such as the matrix protein 2 extracellular domain (M2e), matrix protein 1 (M1), and nucleoprotein (NP).

[0004] CN101899461B discloses a fusion gene encoding influenza A virus NP protein and M2e polypeptide. The influenza A virus NP and M2e fusion protein NM2e can be efficiently expressed in Escherichia coli, and the purified NM2e fusion protein can be used to prepare a protein subunit vaccine.

[0005] However, the preparation of protein subunit vaccines involves protein expression and purification, which takes a long time and is difficult to prepare in a timely manner when an outbreak occurs. Therefore, it is necessary to establish a more efficient and rapid vaccine preparation method, such as an mRNA vaccine that can achieve high expression in subjects.

[0006] Summary of the Invention

[0007] In one aspect, the present invention provides a polynucleotide comprising a nucleotide sequence encoding a fusion protein of SEQ ID NO: 1, wherein the nucleotide sequence has at least 80% identity with a nucleotide sequence selected from 5, 6, 7, 8, 15, 16, 17 and 18.

[0008] In some embodiments, the polynucleotide is RNA. In some embodiments, the RNA is mRNA. In some embodiments, the mRNA further comprises a 5'UTR, a 3'UTR, and a polyA. In some embodiments, the 5'UTR comprises the nucleotide sequence of SEQ ID NO: 2. In some embodiments, the 3'UTR comprises the nucleotide sequence of SEQ ID NO: 3. In some embodiments, the polyA comprises 75 adenylate residues.

[0009] In some embodiments, the polynucleotide comprises a nucleotide sequence that is at least 80% identical to one of SEQ ID NOs: 10-13.

[0010] In a second aspect, the present invention provides a composition comprising a polynucleotide of the present invention. In some embodiments, the composition comprises a lipid encapsulating the polynucleotide. In some embodiments, the composition comprises a lipid-polymer complex. In some embodiments, the lipid encapsulating the polynucleotide comprises a cationic lipid, a non-cationic lipid, and a polyethylene glycol-modified lipid; optionally, the composition further comprises a cationic polymer, wherein the cationic polymer associates with the polynucleotide to form a complex, and together they are encapsulated in the lipid to form a lipid-polymer complex.

[0011] In a third aspect, the present invention provides a vaccine formulation comprising a polynucleotide or composition of the present invention. In some embodiments, the lipid encapsulating the polynucleotide in the vaccine formulation comprises 10-70 mol% of M5, 10-70 mol% of 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 10-70 mol% of cholesterol, and 0.05-20 mol% of 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol (DMG-PEG) 2000; preferably, the lipid is M5, DOPE, cholesterol, and (DMG-PEG) 2000 in a molar ratio of 40:15:43.5:1.5,

[0012] In some embodiments, the vaccine formulation is a liquid formulation or a lyophilized formulation. In some embodiments, the vaccine formulation is administered by intramuscular injection. In some embodiments, the vaccine formulation is administered intramucosally, such as a nasal spray.

[0013] In a fourth aspect, the present invention provides a method for preventing or treating influenza virus infection in a subject in need thereof, the method comprising administering the polynucleotide, composition or vaccine formulation of the present invention to the subject in need thereof.

[0014] The present invention also provides use of the polynucleotide, composition or vaccine formulation of the present invention in the preparation of a medicament for preventing and / or treating influenza virus infection in a subject in need thereof.

[0015] The present invention also provides the polynucleotide, composition or vaccine formulation of the present invention in preparation for use in preventing and / or treating influenza virus infection in a subject in need thereof.

[0016] In some embodiments, the subject is a human or a non-human animal. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] FIG1 shows a flow chart for constructing lipid polyplexes (LPPs) of mRNA.

[0018] Figure 2 shows the results of western blot analysis of the expression of NP protein (Figure 2A) and M2e protein (Figure 2B) in 293T cells transfected with LPP preparations, as well as the titer of antibodies against NM2e in mice immunized with different doses (1 and 10 μg) of LPP.

[0019] FIG3 shows the anti-NP protein and anti-M2e IgG titers induced by LPP preparations in mice.

[0020] Figures 4 and 5 show the cellular immune responses against NP protein and M2e induced by LPP preparations in mice.

[0021] FIG6 shows the results of challenge experiments in which mice were immunized with LPP preparations and then challenged with influenza virus strains X31 ( FIG6A ), PR8 ( FIG6B ), and AH ( FIG6C ).

[0022] Detailed Description of the Invention

[0023] 1. General Definition

[0024] All patents, patent applications, scientific publications, manufacturer's instructions and guidelines, etc., cited herein, whether supra or infra, are hereby incorporated by reference in their entirety. Nothing herein should be construed as an admission that the present disclosure is not entitled to antedate such publication.

[0025] Unless otherwise specified, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. In addition, the terms related to protein and nucleic acid chemistry, molecular biology, cell and tissue culture, and microbiology used herein are terms widely used in the corresponding fields (see, for example, Molecular Cloning: A Laboratory Manual, 2 ndEdition, J. Sambrook et al. eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor 1989). Meanwhile, for a better understanding of the present invention, definitions and explanations of relevant terms are provided below.

[0026] As used herein, the expressions "comprise," "include," "contain," and "have" are open ended and mean the inclusion of the listed elements, steps, or components but not the exclusion of other unlisted elements, steps, or components. The expression "consisting of excludes any element, step, or component not specified. The expression "consisting essentially of means that the scope is limited to the specified elements, steps, or components, plus optional elements, steps, or components that do not significantly affect the basic and novel properties of the claimed subject matter. It should be understood that the expressions "consisting essentially of" and "consisting of are encompassed within the meaning of the expression "comprising."

[0027] As used herein, the singular forms "a," "an," or "the" include plural referents unless the context indicates otherwise. The terms "one or more" or "at least one" encompass 1, 2, 3, 4, 5, 6, 7, 8, 9 or more.

[0028] Recitation of ranges of values ​​herein is intended merely to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each separate value is incorporated into the specification as if it were individually recited herein. Unless expressly indicated to the contrary, values ​​or ranges recited herein are modified by "about" to mean ±20%, ±10%, ±5%, or ±3% of the recited or claimed value or range.

[0029] Unless otherwise stated, all methods described herein can be performed in any suitable order.

[0030] As used herein, the term "wild type" means that the sequence is naturally occurring and has not been artificially modified, including naturally occurring mutants.

[0031] As used herein, the term "% identity" with respect to sequences refers to the percentage of identical nucleotides or amino acids in an optimal alignment between the sequences to be compared. The differences between the two sequences can be distributed over local regions (segments) or over the entire length of the sequences to be compared. The identity between the two sequences is usually determined after optimal alignment of a segment or "comparison window." Optimal alignment can be performed manually, or by means of algorithms known in the art, including but not limited to the local homology algorithm described by Smith and Waterman, 1981, Ads App. Math. 2,482 and Neddleman and Wunsch, 1970, J. Mol. Biol. 48,443, the search for similarity method described by Pearson and Lipman, 1988, Proc. Natl Acad. Sci. USA 88,2444, or using computer programs such as GAP, BESTFIT, FASTA, BLAST P, BLAST N, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Drive, Madison, Wis. For example, the percent identity of two sequences can be determined using the publicly available BLASTN or BLASTP algorithms available on the National Center for Biotechnology Information (NCBI) website.

[0032] In some embodiments, the % homogeneity is given in the region of at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or about 100%. In some embodiments, the homogeneity is given to the whole length of the reference sequence. The comparison of sequence homogeneity can be determined with instruments known in the art, preferably using optimal sequence alignment, for example, using Align, using standard settings, preferably EMBOSS::needle, Matrix:Blosum62, Gap Open 10.0, Gap Extend 0.5.

[0033] As used herein, "nucleotides" include deoxyribonucleotides and ribonucleotides and their derivatives. As used herein, "ribonucleotides" are constituents of ribonucleic acid (RNA), consisting of one base molecule, one pentose molecule, and one phosphate molecule. They refer to nucleotides with a hydroxyl group at the 2' position of the β-D-ribofuranosyl group. "Deoxyribonucleotides" are constituents of deoxyribonucleic acid (DNA), also consisting of one base molecule, one pentose molecule, and one phosphate molecule. They refer to nucleotides in which the hydroxyl group at the 2' position of the β-D-ribofuranosyl group is replaced by hydrogen, and are the main chemical components of chromosomes. "Nucleotides" are usually referred to by a single letter representing the base: "A (a)" refers to deoxyadenosine or adenylate containing adenine, "C (c)" refers to deoxycytidine or cytidine containing cytosine, "G (g)" refers to deoxyguanosine or guanylate containing guanine, "U (u)" refers to uridine containing uracil, and "T (t)" refers to deoxythymidylate containing thymine.

[0034] As used herein, the terms "polynucleotide" and "nucleic acid" are used interchangeably to refer to a polymer of deoxyribonucleotides (deoxyribonucleic acid, DNA) or a polymer of ribonucleotides (ribonucleic acid, RNA). "Polynucleotide sequence," "nucleic acid sequence," and "nucleotide sequence" are used interchangeably to refer to the order of nucleotides in a polynucleotide. It will be understood by those skilled in the art that a DNA coding strand (sense strand) and the RNA it encodes can be considered to have the same nucleotide sequence, with deoxythymidylic acid in the DNA coding strand sequence corresponding to uridine in the RNA sequence it encodes.

[0035] As used herein, "coding sequence" refers to a nucleotide sequence in a polynucleotide that can be used as a template for synthesizing a nucleotide sequence having a defined nucleotide sequence (e.g., tRNA and mRNA) or a defined amino acid sequence in a biological process. The coding sequence can be a DNA sequence or an RNA sequence. If the mRNA corresponding to the DNA sequence (including a coding strand identical to the mRNA sequence and a template strand complementary thereto) is translated into a polypeptide in a biological process, the DNA sequence or mRNA sequence can be considered to encode the polypeptide.

[0036] As used herein, "codon" refers to three consecutive nucleotide sequences (also known as triplet codes) in a polynucleotide that encode a specific amino acid. Synonymous codons (codons encoding the same amino acid) are used at different frequencies in different species, which is called "codon preference". It is generally believed that for a given species, the coding sequence using the codons of its preference can have higher translation efficiency and accuracy in the species expression system. Therefore, polynucleotides can be "codon optimized", that is, the codons in the polynucleotides are changed to reflect the codons of the host cell preference, and preferably the amino acid sequence encoded by them is not changed. It will be understood by those skilled in the art that due to the degeneracy of codons, the polynucleotides of the present invention may include such coding sequences, which are different from the coding sequences described herein (e.g., having about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% homology to the coding sequences described herein) but encode the same amino acid sequence. In certain embodiments, the RNA of the invention comprises codons optimized for host (e.g., subject, particularly mammalian) cells, such that the polypeptide of the invention is optimally expressed in the subject, such as a mammal, bird, or human.

[0037] As used herein, the term "expression" includes transcription and / or translation of a nucleotide sequence. Thus, expression can involve the production of transcripts and / or polypeptides. The term "transcription" refers to the process by which the genetic code in a DNA sequence is transcribed into RNA (transcript). The term "in vitro transcription" refers to the in vitro synthesis of RNA, particularly mRNA, in a cell-free system (e.g., in an appropriate cell extract) (see, e.g., Pardi N., Muramatsu H., Weissman D., Karikó K. (2013). In: Rabinovich P. (eds) Synthetic Messenger RNA and Cell Metabolism Modulation. Methods in Molecular Biology (Methods and Protocols), vol 969. Humana Press, Totowa, NJ.). A vector that can be used to produce a transcript is also referred to as a "transcription vector," which contains regulatory sequences required for transcription. The term "transcription" encompasses "in vitro transcription."

[0038] As used herein, "encoding" refers to the inherent property of a specific nucleotide sequence within a polynucleotide, such as a gene, cDNA, or mRNA, which can serve as a template for the synthesis of polymers and macromolecules involved in other biological processes, given a well-defined nucleotide sequence or amino acid sequence. Thus, a gene encoding a protein means that the gene's mRNA, through transcription and translation, produces the protein in a cell or other biological system.

[0039] As used herein, the term "polypeptide" refers to a polymer comprising two or more amino acids covalently linked by peptide bonds. A "protein" may comprise one or more polypeptides, wherein the polypeptides interact with each other through covalent or non-covalent means. Unless otherwise indicated, "polypeptide" and "protein" are used interchangeably.

[0040] As used herein, the term "host cell" refers to a cell that is used to receive, maintain, replicate, or express a polynucleotide or vector. In some embodiments, the host cell may be a cell in which a polypeptide of the present invention is expressed.

[0041] As used herein, "antigen" refers to a molecule that can induce an acquired immune response in the body after entering the body. This immune response may involve the production of antibodies, specific immunogenic cells, or both. Those skilled in the art will understand that any macromolecule, including almost all proteins or peptides, can serve as an antigen. Furthermore, antigens can be derived from recombinant or genomic DNA or RNA. Those skilled in the art will understand that any DNA or RNA herein, their nucleotide sequence or partial nucleotide sequence can encode a protein that can induce acquired immunity in the body. Furthermore, those skilled in the art will understand that an antigen does not need to encode the full-length nucleotide sequence of a gene alone. Obviously, the present invention includes but is not limited to the use of partial nucleotide sequences of more than one gene, and these nucleotide sequences form different mixtures to induce the occurrence of a response. Furthermore, those skilled in the art will understand that antigens do not need to be completely encoded by a gene. Obviously, antigens can be synthesized or derived from biological samples. Biological samples include but are not limited to tissue samples, tumor samples, cells or biological fluids.

[0042] As used herein, "antibody" refers to a protective protein produced by the body in response to antigenic stimulation. It is a type of immunoglobulin produced by B lymphocytes. An antibody monomer is a Y-shaped molecule composed of four polypeptide chains. These chains consist of two identical heavy chains and two identical light chains, linked by disulfide bonds. Each heavy chain is 50 kDa, and each light chain is 25 kDa, with disulfide bonds linking the heavy and light chains. Antibodies are unique in their high affinity and specificity for their binding partners.

[0043] As used herein, "vaccine" refers to a composition comprising an active ingredient (e.g., a polynucleotide of the present invention) that is capable of eliciting an immune response in a subject upon inoculation. In specific embodiments, the immune response induced provides immune protection sufficient to prevent and / or alleviate at least one symptom associated with infection with a pathogen or disease. According to the present invention, the polynucleotides or compositions described herein can be used as vaccines to provide prophylactic and / or therapeutic immunity against influenza virus in subjects in need thereof.

[0044] As used herein, the term "neutralizing antibody" refers to an antibody or fragment thereof that is capable of neutralizing, i.e., preventing, inhibiting, reducing, or interfering with the ability of a pathogen to cause and / or maintain infection in a host (e.g., a host organism or host cell). According to the present invention, neutralizing antibodies against influenza virus can be produced in a subject vaccinated with the vaccine of the present invention, for example, in the subject's immune serum. The neutralizing antibody titer level in the immune serum can be measured using methods known in the art.

[0045] As used herein, "immune response" refers to processes involving the activation and / or induction of effector functions, which occur, for example, but not limited to, T cells, B cells, natural killer cells, and / or antigen-presenting cells. Thus, an immune response may be understood by those skilled in the art to include, but not limited to, any detectable antigen-specific activation and / or induction of T helper cells, cytotoxic T cell activity or response, antibody production, antigen-presenting cell activity or infiltration, macrophage activity or infiltration, neutrophil activity or infiltration, or the like.

[0046] As used herein, "Th1" refers to the initial CD 4+ Under the induction of interferon-γ (IFN-γ), T cells can differentiate into Th1 cells, secrete IFN-γ, and participate in cell-mediated immune responses and monocyte- or macrophage-mediated inflammatory responses; under the induction of IL-4, they can differentiate into Th2 cells, secrete cytokines such as IL-4 and IL-5, participate in humoral immune responses, stimulate B cells to promote antibody production, and promote the proliferation and function of mast cells and eosinophils.

[0047] As used herein, "influenza virus" is a member of the Orthomyxoviridae family and is an enveloped negative-strand RNA virus. The influenza virus genomic RNA combines with nucleoprotein (NP) to form a ribonucleoprotein (RNP) complex. The influenza virus also contains matrix protein, hemagglutinin and neuraminidase. Hemagglutinin (HA) and neuraminidase (NA) are glycoproteins in the influenza virus envelope that are responsible for surface contact between the virus and the host. The virus requires the regulation of HA to enter the host, which binds to cell receptors and promotes the fusion of the viral membrane with the endosomal membrane. Influenza viruses can be divided into multiple subtypes based on the differences in HA and NA.

[0048] The NP protein is a basic protein consisting of 498 amino acids. Its N-terminus contains an RNA-binding domain and two NP-NP self-interaction regions. These regions are crucial for the maintenance of the viral ribonucleoprotein, interact with various host proteins, and play a crucial role in the influenza virus replication cycle. The NP protein contains regions that are highly conserved among different influenza viruses.

[0049] "M2e" refers to the extracellular domain of matrix protein 2. M2 is a matrix protein of influenza viruses. It is 97 amino acids long and consists of a 24-amino acid extracellular domain at the N-terminus, a 19-amino acid transmembrane domain, and a 54-amino acid intracellular domain at the C-terminus. The extracellular domain of M2 is highly conserved among influenza viruses.

[0050] As used herein, the term "NM2e" refers to a fusion polypeptide of NP protein and M2e, comprising full-length NP protein (positions 1-498 of SEQ ID NO: 1), variants or fragments thereof and residues 2-24 of M2 protein (positions 499-521 of SEQ ID NO: 1).

[0051] As used herein, “NP 55–69 ” refers to a peptide consisting of residues 55-69 of the NP protein, which is an H-2d restricted Th epitope and has the amino acid sequence RLIQNSLTIERMVLS.

[0052] As used herein, “NP 147–155 ” refers to a peptide consisting of residues 147-155 of the NP protein, which is an H-2d-restricted CTL epitope and has the amino acid sequence TYQRTRALV.

[0053] As used herein, "M2e peptide pool" refers to a mixed peptide of M2e protein, which contains three peptides corresponding to residues 1-15 (MSLLTEVETPIRNEW), residues 5-19 (TEVETPIRNEWGCRC) and residues 9-23 (TPIRNEWGCRCNDSS) of M2 protein, respectively.

[0054] As used herein, the term "lipid" refers to an organic compound comprising a hydrophobic portion and optionally a hydrophilic portion. Lipids are generally poorly soluble in water but soluble in many organic solvents. Typically, amphipathic lipids comprising a hydrophobic portion and a hydrophilic portion can be organized into a lipid bilayer structure in an aqueous environment, for example, in the form of vesicles. Lipids may include, but are not limited to, fatty acids, glycerides, phospholipids, sphingolipids, glycolipids, steroids, and cholesterol esters.

[0055] As used herein, the term "cationic polymer" refers to any ionic polymer that can carry a net positive charge at a specified pH, thereby electrostatically binding to nucleic acids. Examples of cationic polymers include, but are not limited to, poly-L-lysine, protamine, and polyethyleneimine (PEI). The polyethyleneimine can be linear or branched.

[0056] The term "protamine" refers to a low molecular weight basic protein rich in arginine, which exists in sperm cells of various animals (especially fish) and replaces histones to bind to DNA. In a preferred embodiment, the cationic polymer is protamine (e.g., protamine sulfate).

[0057] 2. Peptides

[0058] The present invention relates to NM2e polypeptides. In some embodiments, the NM2e polypeptide comprises an amino acid sequence that is at least 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO: 1. In some embodiments, the NM2e comprises variants and / or fragments of the NP protein, and M2e, wherein the variants and / or fragments of the NP protein comprise a conserved region of the NP protein. In some embodiments, the conserved region does not comprise mutations (including amino acid substitutions, deletions, and insertions). In some embodiments, the conserved region comprises conservative substitutions.

[0059] In some embodiments, the NP segment of NM2e comprises at least one amino acid modification, such as an insertion, substitution, and / or deletion. In some embodiments, the NP segment of NM2e comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more amino acid substitutions, insertions, and / or deletions.

[0060] 3. Polynucleotides

[0061] The present invention also relates to polynucleotides encoding the NM2e polypeptide. Polynucleotides may be single-stranded or double-stranded. Polynucleotides include, but are not limited to, DNA, cDNA, RNA (e.g., mRNA), recombinantly produced, and chemically synthesized polynucleotides. The polynucleotides may be contained in a vector. The polynucleotides of the present invention may include naturally occurring, synthetic, and modified nucleotides.

[0062] In some embodiments, the polynucleotides of the present invention are used to express the polypeptides described herein in cells to provide polypeptide antigens. In some embodiments, the polypeptide antigens can induce an immune response, such as a cellular immune response and an antibody response, against influenza virus in a suitable subject.

[0063] The polynucleotide may comprise one or more segments (nucleotide fragments) (e.g., 1, 2, 3, 4, 5, 6, 7, 8 segments). The polynucleotide may comprise a segment encoding a polypeptide of interest (e.g., a polypeptide and polypeptide antigen described herein). In a specific embodiment, the polynucleotide may comprise a coding sequence for a polypeptide of interest and a regulatory sequence (including but not limited to transcriptional and translational regulatory sequences). In one embodiment, the regulatory sequence comprises one or more of the following: a promoter sequence, a 5' untranslated region (5'UTR) sequence, a 3' untranslated region (3'UTR) sequence, and a poly(A) sequence.

[0064] In some embodiments, the polynucleotides of the present invention comprise the coding sequence of a polypeptide antigen as described herein. In one embodiment, the polynucleotides of the present invention comprise a nucleotide sequence complementary to the coding sequence as described herein. In some embodiments, the polynucleotides of the present invention comprise the coding sequence of a polypeptide as described herein. In one embodiment, the coding sequence comprises a start codon at its 5' end and a stop codon at its 3' end. In one embodiment, the coding sequence comprises an open reading frame (ORF) as described herein.

[0065] In some embodiments, the polynucleotide comprises a nucleotide sequence having at least 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or higher identity to SEQ ID NO: 4. In some embodiments, the NM2e encoded by the polynucleotide comprises an amino acid sequence having at least 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or higher identity to SEQ ID NO: 1. In some embodiments, the NM2e comprises a variant and / or fragment of the NP protein, and M2e, wherein the variant and / or fragment of the NP protein comprises a conserved region of the NP protein. In some embodiments, the conserved region does not comprise a mutation (including amino acid substitutions, deletions, and insertions). In some embodiments, the conserved region comprises a conservative substitution.

[0066] In some embodiments, the NP segment of NM2e comprises at least one amino acid modification, such as an insertion, substitution, and / or deletion. In some embodiments, the NP segment of NM2e comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more amino acid substitutions, insertions, and / or deletions. In some embodiments, the NP segment comprises a conserved region of the NP protein, which does not comprise the amino acid modification.

[0067] In some embodiments, the polynucleotides of the present invention are RNA. As used herein, the definition of "RNA" encompasses single-stranded, double-stranded, linear and circular RNA. The RNA of the present invention can be chemically synthesized, recombinantly produced and in vitro transcribed RNA. In one embodiment, the RNA of the present invention is used to express a polypeptide of the present invention in a host cell.

[0068] In some embodiments, the RNA of the present invention is single-stranded RNA. In one embodiment, the RNA of the present invention is in vitro transcribed RNA (IVT-RNA). IVT-RNA can be obtained by in vitro transcription using a DNA template by RNA polymerase (e.g., as described herein).

[0069] In some embodiments, the RNA of the present invention is a messenger RNA (mRNA). Generally speaking, the mRNA may comprise a 5'-UTR sequence, a coding sequence for a polypeptide, a 3'-UTR sequence, and an optional poly(A) sequence. The mRNA can be produced, for example, by in vitro transcription or chemical synthesis. In one embodiment, the mRNA of the present invention is obtained by in vitro transcription using an RNA polymerase (e.g., T7 RNA polymerase) using a DNA template. In one embodiment, the mRNA of the present invention comprises (1) a 5'-UTR, (2) a coding sequence, (3) a 3'-UTR, and (4) an optional poly(A) sequence. The 5'-UTR, coding sequence, 3'-UTR, and poly(A) sequence are as described herein. In one embodiment, the mRNA of the present invention is a nucleoside-modified mRNA. In one embodiment, the mRNA of the present invention comprises an optional 5' cap.

[0070] In some embodiments, the RNA of the present invention comprises a coding sequence for a polypeptide antigen as described herein. In some embodiments, the RNA of the present invention comprises a coding sequence for a polypeptide as described herein.

[0071] In some embodiments, the RNA of the present invention further comprises structural elements that help improve the stability and / or translation efficiency of the RNA, including but not limited to a 5' cap, a 5'-UTR, a 3'-UTR, and a poly(A) sequence.

[0072] As used herein, the term "untranslated region (UTR)" generally refers to a region (non-coding region) in RNA (such as mRNA) that is not translated into an amino acid sequence, or a corresponding region in DNA. Generally, the UTR located at the 5' end (upstream) of the open reading frame (start codon) can be referred to as the 5' untranslated region 5'-UTR; the UTR located at the 3' end (downstream) of the open reading frame (stop codon) can be referred to as the 3'-UTR. In the presence of a 5' cap, the 5'-UTR is located downstream of the 5' cap, for example, directly adjacent to the 5' cap. In a specific embodiment, an optimized "Kozak sequence" can be included in the 5'-UTR, for example, near the start codon, to improve translation efficiency. In the presence of a poly (A) sequence, the 3'-UTR is located upstream of the poly (A) sequence, for example, directly adjacent to the poly (A) sequence.

[0073] In some embodiments, the RNA of the present invention comprises a 5'-UTR. In a preferred embodiment, the 5'-UTR comprises the nucleotide sequence of SEQ ID NO: 2. In a preferred embodiment, the 3'-UTR comprises the nucleotide sequence of SEQ ID NO: 3. In some embodiments, the RNA of the present invention comprises a 5'-UTR and a 3'-UTR. In a specific embodiment, the 5'-UTR comprises the nucleotide sequence of SEQ ID NO: 2, and the 3'-UTR comprises the nucleotide sequence of SEQ ID NO: 3.

[0074] In some embodiments, the RNA of the present invention comprises a poly(A) sequence. A "poly(A) sequence" or "poly(A) tail" refers to a nucleotide sequence containing continuous or discontinuous adenosine nucleotides. The poly(A) sequence is typically located at the 3' end of the RNA, such as the 3' end (downstream) of a 3'-UTR. In some embodiments, the poly(A) sequence does not contain nucleotides other than adenosine nucleotides at its 3' end. The poly(A) sequence can be generated during the preparation of the IVT-RNA by transcription from a coding sequence of a DNA template by a DNA-dependent RNA polymerase, or can be attached to the free 3' end of the IVT-RNA, such as the 3' end of a 3'-UTR, by a DNA-independent RNA polymerase (poly(A) polymerase).

[0075] In one embodiment, the poly(A) sequence comprises contiguous adenylate nucleotides. In one embodiment, the poly(A) sequence may comprise at least 20, 30, 40, 50, 60, 70, 75, 80, 85, 95, or 100, and up to 120, 150, 180, 200, or 300 adenylate nucleotides. In one embodiment, the contiguous adenylate sequence in the poly(A) sequence is interrupted by a sequence comprising U, C, or G nucleotides. Preferably, the poly(A) sequence comprises 75 adenylate nucleotides.

[0076] The poly(A) sequence may comprise at least 20, 30, 40, 50, 60, 70, 75, 80, 85, 95, or 100, and up to 120, 150, 180, 200, or 300 nucleotides. In one embodiment, the poly(A) sequence comprises at least 50 nucleotides. In one embodiment, the poly(A) sequence comprises at least 80 nucleotides. In one embodiment, the poly(A) sequence comprises at least 100 nucleotides. In some embodiments, the poly(A) sequence comprises about 70, 80, 90, 100, 120, or 150 nucleotides. In a specific embodiment, the poly(A) sequence comprises 75 nucleotides.

[0077] As used herein, the term "5' cap" generally refers to an N7-methylguanosine structure (also known as an "m7G cap," "m7Gppp-") attached to the 5' end of an mRNA via a 5' to 5' triphosphate bond. The 5' cap can be co-transcriptionally added to the RNA during in vitro transcription (e.g., using the anti-reverse cap analog "ARCA"), or it can be attached to the RNA post-transcriptionally using a capping enzyme.

[0078] In some embodiments, the RNA of the present invention comprises the nucleotide sequence of SEQ ID NO: 10, 11, 12 or 13. In some embodiments, the RNA of the present invention comprises (a) a nucleotide sequence having at least 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or higher identity with the nucleotide sequence of SEQ ID NO: 10, 11, 12 or 13; and (b) encoding an amino acid sequence having at least 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or higher identity with the amino acid sequence of SEQ ID NO: 1. In some embodiments, the polypeptide encoded by the RNA of the present invention comprises a conserved region of the NP protein. In some embodiments, the conserved region does not comprise a mutation (including substitutions, deletions and insertions of amino acids). In some embodiments, the conserved region comprises a conservative substitution.

[0079] In some embodiments, the polynucleotides of the present invention are DNA. Such DNA can be, for example, a DNA template for in vitro transcription of the RNA of the present invention or a DNA vaccine for expressing a polypeptide antigen in a host cell. The DNA can be double-stranded, single-stranded, linear, or circular.

[0080] The DNA template can be provided in a suitable transcription vector. Generally speaking, the DNA template can be a double-stranded complex, which comprises a nucleotide sequence identical to the coding sequence described herein (coding strand) and a nucleotide sequence complementary to the coding sequence described herein (template strand). As known to those skilled in the art, the DNA template can include a promoter, 5'-UTR, coding sequence, 3'-UTR and optionally a poly (A) sequence. The promoter can be an available promoter for a suitable RNA polymerase (particularly DNA-dependent RNA polymerase) known to those skilled in the art, including but not limited to promoters of SP6, T3 and T7 RNA polymerases. In some embodiments, the 5'-UTR, coding sequence, 3'-UTR and poly (A) sequence in the DNA template are the corresponding sequences included in the RNA described herein or are complementary thereto. As the polynucleotide of a DNA vaccine, it can be provided in a plasmid vector (e.g., a circular plasmid vector).

[0081] In some embodiments, the DNA of the present invention comprises a coding sequence for a polypeptide antigen as described herein. In some embodiments, the DNA of the present invention comprises a coding sequence for a polypeptide as described herein. In some embodiments, the DNA of the present invention comprises, from the 5' end to the 3' end, (1) a T7 promoter, (2) a 5'-UTR, (3) a coding sequence, (4) a 3'-UTR, and (5) an optional poly(A) sequence as described herein.

[0082] IV. Compositions and Vaccine Formulations

[0083] The present invention also provides a composition comprising a polynucleotide of the present invention (particularly RNA). In one embodiment, the composition of the present invention is used to provide preventive and / or therapeutic immunity against influenza virus in a subject. In some embodiments, the composition of the present invention comprises a polynucleotide of the present invention. In some embodiments, the composition of the present invention comprises a DNA of the present invention. In some embodiments, the composition of the present invention comprises an RNA of the present invention. In one embodiment, the RNA is in vitro transcribed RNA. In one embodiment, the RNA is mRNA.

[0084] In some embodiments, the compositions of the invention comprise a polynucleotide (particularly RNA, such as mRNA) as described herein and a lipid encapsulating the polynucleotide.

[0085] Particularly preferred nucleic acid compositions can be, for example, lipid nanoparticles (LNP) and lipid polymer complexes (LPP) as described herein. Methods for preparing such compositions can be found in, for example, Kaczmarek, JC et al., 2017, Genome Medicine 9, 60 or as described herein. In some embodiments, the compositions of the present invention comprise lipid nanoparticles (LNP) or lipid polymer complexes (LPP). In some embodiments, the compositions of the present invention are lipid nanoparticles (LNP) or lipid polymer complexes (LPP) comprising the RNA of the present invention.

[0086] In some embodiments, the lipid encapsulating the polynucleotide comprises a cationic lipid and a non-cationic lipid. In a preferred embodiment, the cationic lipid is an ionizable cationic lipid.

[0087] In one embodiment, the cationic lipid comprises DOTMA, DOTAP, DDAB, DOSPA, DODAC, DODAP, DC-Chol, DMRIE, DMOBA, DLinDMA, DLenDMA, CLinDMA, DMORIE, DLDMA, DMDMA, DOGS, N4-cholesteryl-spermamine, DLin-KC2-DMA, DLin-MC3-DMA, or a combination thereof.

[0088] In one embodiment, the cationic lipid comprises M5, which has the structure:

[0089] In one embodiment, the cationic lipid comprises DOTMA.In one embodiment, the cationic lipid comprises DOTAP.In one embodiment, the cationic lipid comprises DOTMA and DOTAP.

[0090] In one embodiment, the non-cationic lipid comprises a phospholipid as described herein. In one embodiment, the non-cationic lipid comprises a steroid as described herein. In one embodiment, the non-cationic lipid comprises a phospholipid as described herein and a steroid. In one embodiment, the phospholipid comprises DSPC, DPPC, DMPC, DOPC, POPC, DOPE, DOPG, DPPG, POPE, DPPE, DMPE and DSPE or a combination thereof. In one embodiment, the steroid is cholesterol. In one embodiment, the non-cationic lipid comprises DOPE. In one embodiment, the non-cationic lipid comprises cholesterol. In one embodiment, the non-cationic lipid comprises DOPE and cholesterol.

[0091] In one embodiment, the cationic lipid comprises M5 and the non-cationic lipid comprises DOPE and cholesterol.

[0092] In some embodiments, the lipids encapsulating the polynucleotides further comprise polyethylene glycol-modified lipids. In one embodiment, the polyethylene glycol-modified lipids comprise DMG-PEG (e.g., DMG-PEG 2000), DOGPEG, and DSPE-PEG, or a combination thereof. In one embodiment, the polyethylene glycol-modified lipids comprise DSPE-PEG. In one embodiment, the polyethylene glycol-modified lipids comprise DMG-PEG (e.g., DMG-PEG 2000).

[0093] In some embodiments, the composition of the present invention further comprises a cationic polymer, which is associated with the polynucleotide as a complex and is co-encapsulated in the lipid.

[0094] In one embodiment, the cationic polymer comprises poly-L-lysine, protamine, polyethyleneimine (PEI), or a combination thereof. In one embodiment, the cationic polymer is protamine. In one embodiment, the cationic polymer is polyethyleneimine.

[0095] In one embodiment, the amount of lipid in the composition is calculated as a mole percent (mol %), which is determined based on the total moles of lipid in the composition.

[0096] In one embodiment, the amount of cationic lipid in the composition is about 10-about 70 mol%. In some embodiments, the amount of cationic lipid in the composition is about 20-about 60 mol%, about 30-about 50 mol%, about 35-about 45 mol%, about 38-about 45 mol%, about 40-about 45 mol%, about 40-about 50 mol%, or about 45-about 50 mol%.

[0097] In one embodiment, the amount of phospholipids in the composition is about 10 to about 70 mol%. In one embodiment, the amount of phospholipids in the composition is about 20 to about 60 mol%, about 30 to about 50 mol%, about 10 to about 30 mol%, about 10 to about 20 mol%, or about 10 to about 15 mol%.

[0098] In one embodiment, the amount of cholesterol in the composition is about 10 to about 70 mol%. In one embodiment, the amount of cholesterol in the composition is about 20 to about 60 mol%, about 30 to about 50 mol%, about 35 to about 40 mol%, about 35 to about 45 mol%, about 40 to about 45 mol%, or about 45 to about 50 mol%.

[0099] In one embodiment, the amount of polyethylene glycol-modified lipid in the composition is about 0.05-about 20 mol%. In one embodiment, the amount of polyethylene glycol-modified lipid in the composition is about 0.5-about 15 mol%, about 1-about 10 mol%, about 5-about 15 mol%, about 1-about 5 mol%, about 1.5-about 3 mol%, or about 2-5 mol%.

[0100] In some embodiments, RNA of the present invention (particularly mRNA) is formulated as lipid nanoparticles (LNPs). As used herein, "lipid nanoparticles" or "LNPs" refer to particles formed by lipids, in which nucleic acids (e.g., mRNAs) are encapsulated.

[0101] In one embodiment, the LNP comprises the RNA of the present invention and a lipid that encapsulates the RNA, wherein the lipid that encapsulates the RNA comprises a cationic lipid, a phospholipid, cholesterol, and a polyethylene glycol-modified lipid. In one embodiment, the cationic lipid is M5. In one embodiment, the phospholipid is DSPC. In one embodiment, the polyethylene glycol-modified lipid is DMG-PEG 2000. In one embodiment, the cationic lipid is M5, the phospholipid is DSPC, and the polyethylene glycol-modified lipid is DMG-PEG 2000.

[0102] In one embodiment, the RNA-encapsulating lipid comprises 50 mol% M5, 10 mol% DSPC, 38.5 mol% cholesterol, and 1.5 mol% DMG-PEG 2000.

[0103] In some embodiments, the RNA (particularly mRNA) of the present invention is formulated as a lipid polyplex (LPP). As used herein, "lipid polyplex" or "LPP" refers to a core-shell structure comprising a nucleic acid core encapsulated by a lipid shell, wherein the nucleic acid core comprises a nucleic acid (e.g., mRNA) associated with a polymer.

[0104] In one embodiment, the LPP comprises the RNA of the present invention, which is associated with a cationic polymer as a complex; and a lipid encapsulating the complex, wherein the lipid encapsulating the complex comprises a cationic lipid, a non-cationic lipid, and a polyethylene glycol-modified lipid. In one embodiment, the non-cationic lipid comprises a phospholipid and a steroid. In one embodiment, the non-cationic lipid comprises a phospholipid selected from 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), distearoylphosphatidylcholine (DSPC), or a combination thereof, and cholesterol. In one embodiment, the cationic polymer comprises protamine. In one embodiment, the polyethylene glycol-modified lipid comprises DMG-PEG 2000.

[0105] In one embodiment, the cationic lipid comprises M5, which has the structure:

[0106] The non-cationic lipid comprises a phospholipid selected from 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), distearoylphosphatidylcholine (DSPC) or a combination thereof, and cholesterol;

[0107] The polyethylene glycol-modified lipid comprises 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol 2000 (DMG-PEG 2000);

[0108] The cationic polymer comprises protamine.

[0109] In one embodiment, the cationic polymer is protamine, the cationic lipid is M5, the phospholipid is DOPE, and the polyethylene glycol-modified lipid is DMG-PEG 2000.

[0110] In one embodiment, the lipid encapsulating complex comprises 40 mol% M5, 15 mol% DOPE, 43.5 mol% cholesterol, and 1.5 mol% DMG-PEG 2000.

[0111] In some embodiments, vaccine formulations of the invention comprise a polynucleotide described herein.

[0112] In some embodiments, the vaccine formulation of the invention comprises a composition as described herein, wherein the lipid comprises 10-70 mol% M5, 10-70 mol% DOPE, 10-70 mol% cholesterol, and 0.05-20 mol% DMG-PEG 2000,

[0113] wherein the polynucleotide encodes a polypeptide as described herein.

[0114] In some embodiments, the polynucleotide comprises a nucleotide sequence having at least 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or higher identity to SEQ ID NO: 4. In some embodiments, the NM2e encoded by the polynucleotide comprises an amino acid sequence having at least 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or higher identity to SEQ ID NO: 1. In some embodiments, the NM2e comprises a variant and / or fragment of the NP protein, and M2e, wherein the variant and / or fragment of the NP protein comprises a conserved region of the NP protein. In some embodiments, the conserved region does not comprise a mutation (including amino acid substitutions, deletions, and insertions). In some embodiments, the conserved region comprises a conservative substitution.

[0115] In some embodiments, the NP segment of NM2e comprises at least one amino acid modification, such as an insertion, substitution, and / or deletion. In some embodiments, the NP segment of NM2e comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more amino acid substitutions, insertions, and / or deletions. In some embodiments, the NP segment comprises a conserved region of the NP protein, which does not comprise the amino acid modification.

[0116] In some embodiments, the polynucleotides of the present invention are RNA. As used herein, the definition of "RNA" encompasses single-stranded, double-stranded, linear and circular RNA. The RNA of the present invention can be chemically synthesized, recombinantly produced and in vitro transcribed RNA. In one embodiment, the RNA of the present invention is used to express a polypeptide of the present invention in a host cell.

[0117] In some embodiments, the RNA of the present invention is single-stranded RNA. In one embodiment, the RNA of the present invention is in vitro transcribed RNA (IVT-RNA). IVT-RNA can be obtained by in vitro transcription using a DNA template by RNA polymerase (e.g., as described herein).

[0118] In some embodiments, the RNA of the present invention is a messenger RNA (mRNA). Generally speaking, the mRNA may comprise a 5'-UTR sequence, a coding sequence for a polypeptide, a 3'-UTR sequence, and an optional poly(A) sequence. The mRNA can be produced, for example, by in vitro transcription or chemical synthesis. In one embodiment, the mRNA of the present invention is obtained by in vitro transcription using an RNA polymerase (e.g., T7 RNA polymerase) using a DNA template. In one embodiment, the mRNA of the present invention comprises (1) a 5'-UTR, (2) a coding sequence, (3) a 3'-UTR, and (4) an optional poly(A) sequence. The 5'-UTR, coding sequence, 3'-UTR, and poly(A) sequence are as described herein. In one embodiment, the mRNA of the present invention is a nucleoside-modified mRNA. In one embodiment, the mRNA of the present invention comprises an optional 5' cap.

[0119] In some embodiments, the RNA of the present invention comprises a coding sequence for a polypeptide antigen as described herein. In some embodiments, the RNA of the present invention comprises a coding sequence for a polypeptide as described herein.

[0120] In some embodiments, the RNA of the present invention further comprises structural elements that help improve the stability and / or translation efficiency of the RNA, including but not limited to a 5' cap, a 5'-UTR, a 3'-UTR, and a poly(A) sequence.

[0121] As used herein, the term "untranslated region (UTR)" generally refers to a region (non-coding region) in RNA (such as mRNA) that is not translated into an amino acid sequence, or a corresponding region in DNA. Generally, the UTR located at the 5' end (upstream) of the open reading frame (start codon) can be referred to as the 5' untranslated region 5'-UTR; the UTR located at the 3' end (downstream) of the open reading frame (stop codon) can be referred to as the 3'-UTR. In the presence of a 5' cap, the 5'-UTR is located downstream of the 5' cap, for example, directly adjacent to the 5' cap. In a specific embodiment, an optimized "Kozak sequence" can be included in the 5'-UTR, for example, near the start codon, to improve translation efficiency. In the presence of a poly (A) sequence, the 3'-UTR is located upstream of the poly (A) sequence, for example, directly adjacent to the poly (A) sequence.

[0122] In some embodiments, the RNA of the present invention comprises a 5'-UTR. In a preferred embodiment, the 5'-UTR comprises the nucleotide sequence of SEQ ID NO: 2. In a preferred embodiment, the 3'-UTR comprises the nucleotide sequence of SEQ ID NO: 3. In some embodiments, the RNA of the present invention comprises a 5'-UTR and a 3'-UTR. In a specific embodiment, the 5'-UTR comprises the nucleotide sequence of SEQ ID NO: 2, and the 3'-UTR comprises the nucleotide sequence of SEQ ID NO: 3.

[0123] In some embodiments, the RNA of the invention comprises a poly(A) sequence.

[0124] In one embodiment, the poly(A) sequence comprises contiguous adenylate nucleotides. In one embodiment, the poly(A) sequence may comprise at least 20, 30, 40, 50, 60, 70, 75, 80, 85, 95, or 100, and up to 120, 150, 180, 200, or 300 adenylate nucleotides. In one embodiment, the contiguous adenylate sequence in the poly(A) sequence is interrupted by a sequence comprising U, C, or G nucleotides. Preferably, the poly(A) sequence comprises 75 adenylate nucleotides.

[0125] The poly(A) sequence may comprise at least 20, 30, 40, 50, 60, 70, 75, 80, 85, 95, or 100, and up to 120, 150, 180, 200, or 300 nucleotides. In one embodiment, the poly(A) sequence comprises at least 50 nucleotides. In one embodiment, the poly(A) sequence comprises at least 80 nucleotides. In one embodiment, the poly(A) sequence comprises at least 100 nucleotides. In some embodiments, the poly(A) sequence comprises about 70, 80, 90, 100, 120, or 150 nucleotides. In a specific embodiment, the poly(A) sequence comprises 75 nucleotides.

[0126] As used herein, the term "5' cap" generally refers to an N7-methylguanosine structure (also known as an "m7G cap," "m7Gppp-") attached to the 5' end of an mRNA via a 5' to 5' triphosphate bond. The 5' cap can be co-transcriptionally added to the RNA during in vitro transcription (e.g., using the anti-reverse cap analog "ARCA"), or it can be attached to the RNA post-transcriptionally using a capping enzyme.

[0127] In some embodiments, the RNA of the present invention comprises the nucleotide sequence of SEQ ID NO: 10, 11, 12 or 13. In some embodiments, the RNA of the present invention comprises (a) a nucleotide sequence having at least 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or higher identity with the nucleotide sequence of SEQ ID NO: 10, 11, 12 or 13; and (b) encoding an amino acid sequence having at least 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or higher identity with the amino acid sequence of SEQ ID NO: 1. In some embodiments, the polypeptide encoded by the RNA of the present invention comprises a conserved region of the NP protein. In some embodiments, the conserved region does not comprise a mutation (including substitutions, deletions and insertions of amino acids). In some embodiments, the conserved region comprises a conservative substitution.

[0128] 5. Lipids

[0129] 1. Cationic lipids

[0130] Cationic lipids are lipids that have a net positive charge at a given pH. Lipids with a net positive charge can associate with nucleic acids through electrostatic interactions.

[0131] Examples of cationic lipids include, but are not limited to, 1,2-di-O-octadecenyl-3-trimethylammonium-propane (DOTMA), 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), didecyldimethylammonium bromide (DDAB), 2,3-dioleoyloxy-N-[2(spermine carboxamide)ethyl]-N,N-dimethyl-l-propanamium trifluoroacetate (DOSPA), dioctadecyldimethylammonium chloride ... dioctadecyldimethylammonium chloride (DDAB), dioctadecyldimethylammonium bromide (DDAB), dioctadecyldimethylammonium bromide (DDAB), dioctadecyldimethylammonium bromide (DDAB), dioctadecyldimethylammonium bromide (DDAB), dioctadecyldimethylammonium bromide (DDAB), dioctadecyldimethylammonium brom chloride (DODAC), 1,2-dioleoyl-3-dimethylammonium-propane (DODAP), 3-(N—(N′,N′-dimethylaminoethane)-carbamoyl)cholesterol (DC-Chol), 2,3-di(tetradecoxy)propyl-(2-hydroxyethyl)-dimethylazanium (D MRIE), N,N-dimethyl-3,4-dioleyloxybenzylamine (DMOBA), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2-dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA), 3-dimethylamino-2-(cholest-5-en-3-β-oxybutane-4-oxy)-1-(cis, cis-9,1-(cis,cis-9,12-octadecadienoxy)propane (3-dimethylamino-2-(cholest-5-en-3-beta-oxybutan-4-oxy)-1-(cis,cis-9,12-oc-tadecadienoxy)propane, CLinDMA), N-(2-aminoethyl)-N,N-dimethyl-2,3-bis(tetradecyloxy)propan-1-aminium bromide bromide, DMORIE), N,N-dimethyl-2,3-bis(dodecyloxy)propan-1-amine (DLDMA), N,N-dimethyl-2,3-bis(tetradecyloxy)propan-1-amine (DMDMA), dioctadecylamidoglycyl spermine spermine (DOGS), N4-cholesteryl-spermine, 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), heptatriaconta-6,9,28,31-tetraen-19-yl-4-(dimethylamino)butyrate utanoate, DLin-MC3-DMA), heptadecan-9-yl-8-((2-hydroxyethyl)(6-oxo-6-((decyloxy)hexyl)amino)octanoate), ((4-hydroxybutyl)azanediyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate).

[0132] In some embodiments, the cationic lipid is preferably an ionizable cationic lipid. Ionizable cationic lipids carry a net positive charge at, for example, acidic pH, and are neutral at higher pH (e.g., physiological pH). Examples of ionizable cationic lipids include, but are not limited to, dioctadecylamidoglycyl spermine (DOGS), N4-cholesteryl-spermine, 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), heptatriaconta-6,9,28,31-tetraen-19-yl-4-(dimethylamino)butyrate. utanoate, DLin-MC3-DMA), heptadecan-9-yl-8-((2-hydroxyethyl)(6-oxo-6-((decyloxy)hexyl)amino)octanoate), ((4-hydroxybutyl)azanediyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate).

[0133] In one embodiment, the cationic lipid comprises M5, which has the following structure:

[0134] 2. Non-cationic lipids

[0135] As used herein, "non-cationic lipids" refer to lipids that do not have a net positive charge at a given pH, such as anionic lipids and neutral lipids. The term "neutral lipid" refers to lipids that exist in an uncharged, neutral, or zwitterionic form at physiological pH. Neutral lipids may include, but are not limited to, phospholipids and steroids.

[0136] Examples of phospholipids include, but are not limited to, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1-palmitoyl-2-oleoylphosphatidylethanolamine (POPE), distearoylphosphatidylcholine (DSPC), distearoyl-phosphatidylethanolamine (DSPE), dioleoylphosphatidylcholine (DOPC), dimyristoylphosphatidylcholine (DMPC), dipalmitoylphosphatidylcholine (DPPC), diarachidonoylphosphatidylcholine (DPPC), diisoylphosphatidylcholine (DMPC), diisoylphosphatidylcholine (DPPC), diisoylphosphatidylcholine (DPPC), diisoylphosphatidylcholine (DPPC), diisoylphosphatidylcholine (DPPC), diisoylphosphatidylcholine (DPPC), diisoylphosphatidylcholine (DPPC), diisoylphosphatidylcholine (DPPC), diisoylphosphatidylcholine (DPPC), diisoylphosphatidylcholine (DPC), diisoylphosphatidylcholine (DPE), diisoylphosphatidylcholine (DOPC), diisoylphosphatidylcholine (DMPC), diisoylphosphatidylcholine (DPPC), diisoylphosphatidylcholine (DPPC), diisoylphosphatidylcholine (DPC), diisoylphosphatidylcholine (DPC), diisoylphosphatidylcholine (DPC), diisoylphosphatidylcholine (DP Choline (diarachidoylphosphatidylcholine, DAPC), dibehenoylphosphatidylcholine (DBPC), ditricosanoylphosphatidylcholine (DTPC), dilignoceroylphatidylcholine (DLPC), palmitoyloleoyl-phosphatidylcholine (POPC), dipalmitoyl-phosphatidylethanolamine (DPPE), dimyristoyl-phosphatidylethanolamine (DMPE) and dilauroyl-phosphatidylethanolamine (DLPE).

[0137] Examples of steroids include, but are not limited to, cholesterol, cholestanol, cholestanone, cholestenone, cholesteryl-2'-hydroxyethyl ether, cholesteryl-4'-hydroxybutyl ether, tocopherol, and derivatives thereof.

[0138] 3. Polyethylene glycol-modified lipids

[0139] As used herein, the term "PEG-modified lipid" refers to a molecule comprising a polyethylene glycol portion and a lipid portion. Examples of polyethylene glycol-modified lipids include, but are not limited to, 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol (DMG-PEG), 1,2-dioleoyl-rac-glycerol, methoxypolyethylene Glycol (DOGPEG), and 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-poly(ethylene glycol) (DSPE-PEG).

[0140] In one embodiment, the polyethylene glycol-modified lipid is DMG-PEG, such as DMG-PEG 2000. In one embodiment, DMG-PEG 2000 has the following structure:

[0141] The average value of n is 44.

[0142] VI. Prevention and Treatment of Influenza Virus Infection

[0143] The present invention provides the polynucleotide (particularly RNA), composition or vaccine formulation of the present invention for use in preventing and / or treating influenza virus infection in a subject in need thereof.

[0144] The present invention provides use of the polynucleotide (particularly RNA), composition or vaccine formulation of the present invention in the preparation of a medicament for preventing and / or treating influenza virus infection in a subject in need thereof.

[0145] The present invention provides a method for preventing and / or treating influenza virus infection in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a polynucleotide (particularly RNA), composition, or vaccine formulation of the present invention. In one embodiment, the method comprises administering a therapeutically effective amount of a composition comprising an mRNA of the present invention, particularly a composition comprising an LPP as described herein.

[0146] The term "prophylactically or therapeutically effective amount" refers to an amount sufficient to prevent or inhibit the occurrence of a disease or symptom and / or slow, alleviate, or delay the development or severity of a disease or symptom. The prophylactically or therapeutically effective amount is influenced by factors including, but not limited to, the rate of development and severity of the disease or symptom, the age, sex, weight, and physical condition of the subject, the duration of treatment, and the specific route of administration. The prophylactically or therapeutically effective amount can be administered in one or more doses. The prophylactically or therapeutically effective amount can be achieved through continuous or intermittent administration.

[0147] In some embodiments, the prophylactic or therapeutically effective amount is provided in one or more administrations. In some embodiments, the prophylactic or therapeutically effective amount is provided in two administrations. In some embodiments, the prophylactic or therapeutically effective amount is provided in three administrations.

[0148] In some embodiments, the compositions or vaccine formulations of the present invention can be administered to a subject by any method known to those skilled in the art, such as parenteral, oral, transmucosal, transdermal, intramuscular, intravenous, intradermal, subcutaneous or intraperitoneal. Preferably, the compositions or vaccine formulations of the present invention are administered by intramuscular injection.

[0149] As used herein, the term "subject" describes an organism, such as a human, a non-human mammal (such as a pig), or an avian (such as a chicken), to which therapy using a polynucleotide or composition of the invention can be provided.

[0150] 7. Beneficial Effects

[0151] The polynucleotides, compositions, vaccine formulations and methods of the present invention achieve higher levels of expression of NM2e polypeptides in cells than the prior art, induce significant cellular and antibody responses in animals, provide improved protection against different strains (homotypic and heterotypic strains), and can induce broad-spectrum cross-immune protection against conserved antigens in vivo. Example

[0152] The present invention is further described with reference to the following examples. It should be understood that these examples are intended to be illustrative only and are not intended to limit the present invention. The following materials and instruments are commercially available or prepared according to methods known in the art. The following experiments were performed according to the manufacturer's instructions or according to methods and procedures known in the art.

[0153] Example 1. Preparation of mRNA

[0154] 1.1. Design and synthesis of DNA templates

[0155] To achieve optimal expression, the inventors codon-optimized the nucleotide sequence encoding the NM2e fusion protein of SEQ ID NO: 1 to obtain the sequence shown in Table 1. NM2e-Ori represents the wild-type sequence, and NM2e-1, NM2e-2, NM2e-3, and NM2e-4 represent optimized sequences.

[0156] The T7 promoter sequence (TAATACGACTCACTATA), 5'-UTR sequence (SEQ ID NO: 19), 3'-UTR sequence (SEQ ID NO: 20) and poly(A) sequence (75 adenosine nucleotides) were also designed. The Kozak sequence "GCCACC" was included in the 5'UTR sequence.

[0157] Then, the T7 promoter sequence, 5'-UTR sequence, DNA ORF sequence, 3'-UTR sequence and poly(A) sequence were connected in the order of plasmid DNA template.

[0158] The DNA template was obtained by PCR amplification using a pair of tailed PCR primers (upstream primer: 5'TTGGACCCTCGTACAGAAGCTAATACG 3'; and downstream poly(T) long primer: 5'TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTACTTCCTACTCAGGCTTTATTCAAAGACCA 3') and a high-fidelity DNA polymerase-based PCR amplification kit (Baori Medical Biotechnology (Beijing) Co., Ltd.).

[0159] 1.2. In vitro transcription of mRNA from DNA template

[0160] The PCR product prepared in Example 1.1 was purified using a PCR product purification kit (Takara). Using the purified PCR product as a template, a co-transcriptional capping reaction was performed using T7 RNA polymerase to transcribe RNA in vitro to produce Cap1 mRNA. During in vitro transcription, 1-methyl-pseudouridine triphosphate was used instead of uridine triphosphate (UTP). Therefore, the modification ratio of 1-methyl-pseudouridine in the in vitro transcribed Cap1 mRNA was 100%. After transcription, the DNA template was digested with DNase I (Thermo Fisher Scientific) to reduce the risk of residual DNA template.

[0161] mRNA was purified using Dynabeads Myone (Thermo Fisher Scientific). The purified mRNA was dissolved in 1 mM sodium citrate buffer (pH 6.5), sterile-filtered, and stored frozen at -80°C until use. The obtained mRNA sequence is shown in Table 1.

[0162] Table 1. Nucleic acid sequences

[0163] Example 2: Preparation of LPP preparation

[0164] Experimental Materials

[0165] Cationic lipid M5 was synthesized by Si microorganisms; auxiliary phospholipid (DOPE) was purchased from CordenPharma; cholesterol was purchased from Sigma-Aldrich; mPEG2000-DMG (i.e., DMG-PEG 2000) was purchased from Avanti Polar Lipids, Inc.; PBS was purchased from Invitrogen; and protamine sulfate was purchased from Beijing Silian Pharmaceutical Co., Ltd.

[0166] 2.2. Preparation of mRNA Lipid Polyplex (LPP)

[0167] As shown in Figure 1, LPP was prepared. Specifically, the preparation included the following steps.

[0168] Preparation of mRNA aqueous solution: Each mRNA prepared as in Example 1.2 was diluted with 10 mM citric acid-sodium citrate buffer (pH 4.0) to a 0.2 mg / mL mRNA solution.

[0169] Preparation of lipid solution: cationic lipid (M5): DOPE: cholesterol: DMG-PEG 2000 were dissolved in anhydrous ethanol at a molar ratio of 40:15:43.5:1.5 to prepare a 10 mg / mL lipid solution.

[0170] Preparation of protamine sulfate solution: Dissolve protamine sulfate in nuclease-free water to prepare a protamine sulfate solution with a working concentration of 0.25 mg / mL.

[0171] Preparation of core nanoparticle solution: Using microfluidic technology (Maianna (Shanghai) Technology Co., Ltd., model: Inano D), the protamine sulfate solution and the mRNA solution were mixed under the following conditions to obtain a core nanoparticle solution formed by protamine and mRNA: Volume = 4.0 mL; Flow rate ratio = 5 (mRNA): 1 (protamine solution), Total flow rate = 12 mL / min, start waste = 0.35 mL, end waste = 0.1 mL, room temperature.

[0172] Preparation of LPP: The core nanoparticle solution and the lipid solution were mixed twice under the following conditions: Volume = 4.0 mL, Flow rate ratio = 1 (lipid solution): 3 (core nanoparticle solution), Total flow rate = 12 mL / min, front waste = 0.35 mL, rear waste = 0.1 mL, room temperature, diluted with PBS solution to obtain LPP solution.

[0173] Centrifugal ultrafiltration: The LPP solution was subjected to ultrafiltration centrifugation to remove ethanol (speed 3000 rpm, centrifugation time 60 min, temperature 4°C) to obtain LPP-NM2e preparations LPP-NPM2e-Ori, LPP-NPM2e-1, LPP-NPM2e-2, LPP-NPM2e-3 and LPP-NPM2e-4.

[0174] Example 3. Expression of mRNA in cells

[0175] 293T cells were transfected with non-optimized LPP-NM2e-Ori and optimized LPP-NM2e-1, LPP-NM2e-2, LPP-NM2e-3, and LPP-NM2e-4, and the cells were collected 24 hours later for Western blot analysis.

[0176] As shown in Figures 2A and 2B, the expression of LPP-NM2e was significantly improved after optimization.

[0177] Example 4: Detection of immunogenicity of LPP preparations

[0178] 4.1. Five-week-old BALB / c mice (n=8, female, Shanghai Lingchang Biotechnology Co., Ltd.) were administered intramuscularly with unoptimized LPP-NM2e-Ori and optimized LPP-NM2e-1, LPP-NM2e-2, LPP-NM2e-3, and LPP-NM2e-4 at doses of 1 μg (low-dose group) and 10 μg (high-dose group), respectively. Serum was collected retroorbitally two weeks after the primary immunization and two weeks after the boost, and assayed for NPM2e-binding antibodies.

[0179] As shown in Figure 2C, the antibody titers in mice immunized with the optimized LPP-NPM2e-1, LPP-NM2e-2, LPP-NM2e-3, and LPP-NM2e-4 were significantly higher than those in mice immunized with the unoptimized LPP-NM2e-Ori, regardless of whether they were in the 1 μg or 10 μg groups. The humoral immunity induced by LPP-NM2e-3 was more robust than that induced by the other optimized mRNAs. The antibody titer in the low-dose group reached 70,400 two weeks after the initial immunization and 525,000 two weeks after the boost. The antibody titer in the high-dose group reached 128,000 two weeks after the initial immunization and 1,600,000 two weeks after the boost (Figure 2C). Therefore, we selected LPP-NPM2e-3 (hereinafter referred to as LPP-NPM2e) to further characterize its humoral and cellular immunity and conduct challenge experiments.

[0180] 4.2. Characterization of LPP-NM2e-induced immune responses

[0181] Five-week-old BALB / c mice (female, Shanghai Lingchang Biotechnology Co., Ltd.) were randomly divided into three groups and administered (prime-boost) by intramuscular injection (prime-boost) with LPP (100 μl, Mock group, n=10), 1 μg LPP-NM2e (low-dose group, n=15), and 10 μg LPP-NM2e (high-dose group, n=15) without mRNA. Each dose was given two times, three weeks apart. Two weeks after each dose, blood was collected from the eye sockets for antibody detection, and spleen mononuclear cells were prepared from the mouse spleen for cellular immune response detection.

[0182] The results of antibody detection are shown in Figure 3. After the first dose of LPP-NM2e preparation, the titers of NP protein-specific antibodies (IgG) were 6.28×10 3 (low-dose group) and 2.88×10 4 (high-dose group), showing a significant dose-dependent effect (P<0.0001). After the second dose of LPP-NM2e preparation, the NP protein-specific antibody titer increased to 5.60×10 4(low-dose group) and 1.34×10 5 (high-dose group), which was significantly higher than the antibody titer induced by the first dose (P<0.05) and showed significant dose-dependence (P<0.0001) ( Figure 3A ).

[0183] After the first dose of LPP-NM2e preparation, the M2e-specific antibody (IgG) titers were 1.2×10 2 (low-dose group) and 1.86×10 2 (High-dose group). After the second dose of LPP-NM2e preparation, the M2e-specific antibody titer increased to 9.70×10 2 (low-dose group) and 3.98×10 3 (high-dose group), the titer of the high-dose group was significantly higher than the M2e-specific antibody titer detected after administration of the first dose of LPP-NM2e preparation (P<0.05) (Figure 3B).

[0184] In addition, the IgG2a and IgG1 subtypes of antibodies were detected after immunization with LPP-NM2e vaccine (n=4). The results are shown in Tables 2 and 3. The NP protein and M2e-specific IgG2a:IgG1 ratios in the low-dose and high-dose groups were basically greater than 1 (only one mouse was less than 1), suggesting that a Th1-biased immune response was induced.

[0185] Table 2 NP antigen-specific IgG2a / IgG1 ratio

[0186] Table 3 M2e antigen-specific IgG2a / IgG1 ratio

[0187] Use NP 55-69 NP 147-155 The cellular immune response induced by mice immunized with LPP-NM2e was detected by IFN-γ ELISPOT, and the results are shown in FIG3 .

[0188] After the first administration, NPs in spleen mononuclear cells from the low-dose and high-dose groups 55-69 NP 147-155 The average density of M2e-specific spot-forming (IFN-γ secreting) cells was 24SFC (spot-forming cells) / 10 6 SMNC (spleen mononuclear cells), 448SFC / 10 6 SMNC, 10SFC / 10 6 SMNC and 10SFC / 10 6SMNC, 383SFC / 10 6 SMNC and 25SFC / 10 6 There was no significant difference between the SMNC and control groups.

[0189] After the second administration, the cellular immune response was enhanced. 55-69 NP 147-155 The average density of M2e-specific SFC was 196 SFC / 10 6 SMNC, 1943SFC / 10 6 SMNC, 98SFC / 10 6 SMNC, significantly higher than the level after the first administration (P < 0.01, P < 0.05 and P < 0.05); NP in the high-dose group 55-69 NP 147-155 The average density of M2e-specific SFC was 278 SFC / 10 6 SMNCs, 2950SFC / 10 6 SMNCs, 128SFC / 10 6 SMNCs, NP 55-69 NP 147-155 The specific cellular immune response was significantly higher than that after the first administration (P<0.0001). There was no statistically significant difference in the M2e-specific immune response, but it showed a dose-dependent trend.

[0190] In addition, flow cytometry analysis was performed on spleen cells from mice (n=4) 5 months after immunization with LPP-NM2e vaccine and stimulated with NM2e peptide pool. The results are shown in Figures 4 and 5 , showing a strong antigen-specific T cell response, mainly manifested by an increase in CD8 and CD4 secreting cytokines IFN-γ and TNF-α, and the T cell response still showed a dose-dependent trend.

[0191] The results showed that the LPP preparation of the mRNA of the present invention induced significant cellular and antibody responses against influenza virus NP protein and M2e. The antibody response showed significant dose-dependence, while the cellular response against NP and M2e proteins also showed a dose-dependent trend.

[0192] Example 5: Immune protection induced by LPP preparation in mice

[0193] In this example, influenza virus strains X31 (H3N2), PR8 (H1N1), and AH (H7N9) from the Chinese Center for Disease Control and Prevention, National Institute of Viral Disease Prevention and Control were used for challenge experiments to detect the immune protection induced by LPP preparations in mice.

[0194] Mice were immunized as described in Example 4. Five weeks after the first dose, the mice were intranasally administered with influenza virus (5xLD50 dose of strain X31 (n=10), 3xLD50 dose of strain PR8 (n=10), and 3xLD50 dose of strain AH (n=10 (high dose group), n=11 (low dose group)) for a challenge experiment to detect the immune protection induced by the LPP preparation in mice. After inoculation with influenza virus, the weight changes and survival of the mice were observed and recorded daily for two weeks.

[0195] The changes in body weight are shown in the left panels of Figures 6A, B, and C. The body weight of mice in both the low-dose and high-dose groups decreased to the lowest level 5 days after challenge, and then gradually increased and recovered to the level equivalent to Day 0.

[0196] Mouse survival is shown in the right panels of Figures 6A, B, and C. All mice in the Mock group died 5 days (X31), 6 days (PR8), and 5 days (AH) after challenge. For mice administered LPP preparations, the survival rates of mice inoculated with strain X31 were 60% (low-dose group) and 100% (high-dose group) ( Figure 6A ); the survival rates of mice inoculated with strain PR8 were 90% (low-dose group) and 100% (high-dose group) ( Figure 6B ); and the survival rates of mice inoculated with strain AH were 82% (low-dose group) and 90% (high-dose group) ( Figure 6C ).

[0197] The results showed that the LPP preparation of the present invention can effectively protect mice not only against the attack of the same type of influenza virus X31 (H3N2), but also against the attack of the heterotypic influenza virus strain PR8 (H1N1) and the highly pathogenic avian influenza virus strain AH (H7N9).

[0198] Although the present invention has been disclosed above with reference to preferred embodiments, this is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

[0199] Example 6. Materials and Methods

[0200] 1. Cells, proteins, and antibodies

[0201] HEK293 cells were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% FBS (Gibco), 100 U / mL penicillin, and 100 mg / mL streptomycin (Gibco) at 37° C. and 5% CO 2 .

[0202] The recombinant NP, M2e, and NPM2e proteins used in ELISA assays were purchased from Sino Biological and expressed in Escherichia coli or baculovirus-insect cells.

[0203] Antibodies used for western blotting included: anti-influenza A M2 protein antibody purchased from Abcam; anti-influenza NP protein antibody purchased from Sino Biological, anti-mouse horseradish peroxidase (HRP)-conjugated antibody and anti-rabbit horseradish peroxidase (HRP)-conjugated antibody purchased from Abbkine.

[0204] 2. Combined with IgG antibody detection

[0205] NP, M2e or NPM2e protein were diluted to 1 μg / ml with 0.05 M sodium carbonate buffer and added to 96-well ELISA plates ( Greiner) (100 μl / well) at 4 ° C overnight. The plate was washed with PBS-T (phosphate buffered saline + 0.05% Tween-20) and then blocked with 2% BSA (prepared in PBS-T) at 37 ° C for 60 minutes. 2-fold serial dilutions of mouse serum samples were added to the coated plate and incubated at 37 ° C for 60 minutes. The plate was then incubated with HRP-conjugated secondary antibody at 37 ° C for 60 minutes. After washing the plate 3 times, TMB substrate (Biyuntian Biotechnology) was added. After the reaction was terminated, the optical density (OD) at a wavelength of 450 was read using a microplate reader (BioTek). The absorbance value of the sample was higher than the reciprocal value of the highest dilution of 2.1 times the negative control sample as the final titer.

[0206] 3. Cell transfection

[0207] One day before transfection, 1.0×10 6 HEK293 cells were seeded in 6-well culture dishes. The next day, when cell confluency reached 70-90%, the medium was replaced with fresh culture medium and the cells were incubated with 2.5 μg of NPM2e mRNA-LPP. After 24 hours, the cells were harvested and lysed with 1× SDS-PAGE loading buffer (Beyotime) for analysis by SDS-PAGE and Western blot.

[0208] 4. Enzyme-linked immunospot (ELISpot) assay

[0209] IFN-γ ELISpot was used according to the manufacturer's instructions. PLUSMouse IFN-γ ELISpot assay was performed using a kit (Mabtech). Briefly, the plate was blocked and incubated in RPMI 1640 medium (supplemented with 10% FBS) for 30 minutes. The spleen of the mouse was removed, ground and filtered, and treated with red blood cell lysis buffer. The obtained cells (i.e., spleen mononuclear cells) were counted and counted at 3×10 5 Cells were plated / well and stimulated in vitro with 8 μg / ml NP55-69 peptide, 8 μg / ml NP14-155 peptide, 8 μg / ml M2e peptide pool, and 10 μg / ml NM2e peptide pool (all purchased from Shanghai Jier Biochemical Co., Ltd.), phytohemagglutinin (PHA) + ionomycin (positive control), or RPMI 1640 medium alone (negative control) and incubated for 20 hours at 37°C, 5% CO2. Cells were then detected using a biotinylated IFN-γ detection antibody and streptavidin-alkaline phosphatase (ALP), developed with BCIP / NBT-plus (5-bromo-4-chloro-3-indolyl-phosphate / nitro blue tetrazolium-plus) substrate, and counted using an ELISpot plate reader (ImmunoSpot S6 Core Analyzer (CTL)).

[0210] Peptide pool sequence:

[0211] NP 55–69 The amino acid sequence is RLIQNSLTIERMVLS.

[0212] NP 147–155 The amino acid sequence is TYQRTRALV.

[0213] The M2e peptide pool is a mixed peptide of the M2e protein, which contains three peptides corresponding to residues 1-15 (MSLLTEVETPIRNEW), residues 5-19 (TEVETPIRNEWGCRC), and residues 9-23 (TPIRNEWGCRCNDSS) of the M2 protein, respectively.

[0214] The NM2e peptide pool is a peptide library consisting of peptide segments corresponding to the full-length NM2e protein, with a length of 15 amino acids and overlapping with each other by 11 amino acids.

[0215] 5. Animal research

[0216] Five-week-old female BALB / c mice were immunized with 100 μL of the mRNA-LPP preparation via bilateral intramuscular injection on days 0 (D0) and 21 (D21). All blood samples were collected by retroorbital bleeding, with approximately 200 μL of blood per blot and centrifuged at 1,500 g for 10 minutes at 4°C for serum separation.

[0217] 6. Statistical analysis

[0218] Statistical analyses of the animal studies were performed using GraphPad Prism 8.0 software. Data are expressed as mean ± SEM. Two experimental groups were compared using a two-tailed T-test. For comparisons of more than two experimental groups, one-way ANOVA was used. P values ​​less than 0.05 were considered significant. *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001.

[0219] sequence

[0220] SEQ ID NO:1 Amino acid sequence of NM2e fusion polypeptide

[0221] SEQ ID NO:2 5'UTR

[0222] SEQ ID NO:3 3'UTR

[0223] SEQ ID NO:4 Unoptimized coding DNA sequence NM2e-Ori

[0224] SEQ ID NO:5 Optimized coding DNA sequence NM2e-1

[0225] SEQ ID NO:6 Optimized coding DNA sequence NM2e-2

[0226] SEQ ID NO:7 optimized coding DNA sequence NM2e-3

[0227] SEQ ID NO:8 optimized coding DNA sequence NM2e-4

[0228] SEQ ID NO:9 mRNA sequence NM2e-Ori

[0229] SEQ ID NO:10 mRNA sequence NM2e-1

[0230] SEQ ID NO:11 mRNA sequence NM2e-2

[0231] SEQ ID NO:12 mRNA sequence NM2e-3

[0232] SEQ ID NO:13 mRNA sequence NM2e-4

[0233] SEQ ID NO: 14 Unoptimized coding RNA sequence NM2e-Ori

[0234] SEQ ID NO: 15 Optimized coding RNA sequence NM2e-1

[0235] SEQ ID NO: 16 Optimized coding RNA sequence NM2e-2

[0236] SEQ ID NO: 17 Optimized coding RNA sequence NM2e-3

[0237] SEQ ID NO: 18 Optimized coding RNA sequence NM2e-4

[0238] SEQ ID NO:19 5'UTR DNA sequence

[0239] SEQ ID NO:20 3'UTR DNA sequence

Claims

1. A polynucleotide comprising a nucleotide sequence encoding a fusion protein of SEQ ID NO: 1, wherein the nucleotide sequence has at least 80% identity with a nucleotide sequence selected from the group consisting of SEQ ID NO: 5, 6, 7, 8, 15, 16, 17 and 18.

2. The polynucleotide of claim 1, which is RNA.

3. The polynucleotide of claim 2, wherein the RNA is mRNA. The polynucleotide of claim 3 , wherein the mRNA further comprises a 5′UTR, a 3′UTR, and polyA. The polynucleotide of claim 4 , wherein the 5′UTR comprises the nucleotide sequence of SEQ ID NO:

2. The polynucleotide of claim 4 , wherein the 3′UTR comprises the nucleotide sequence of SEQ ID NO:

3.

7. The polynucleotide of claim 4, wherein the polyA comprises 75 adenylate residues.

8. The polynucleotide of any one of claims 1-7, comprising a nucleotide sequence that is at least 80% identical to one of SEQ ID NOs: 10-13.

9. A composition comprising the polynucleotide of any one of claims 1 to 8.

10. The composition of claim 9, comprising a lipid encapsulating the polynucleotide.

11. The composition of claim 9 or 10, comprising a lipid multiplex.

12. The composition of claim 10 or 11, wherein the lipids encapsulating the polynucleotide comprise cationic lipids, non-cationic lipids, and polyethylene glycol-modified lipids; optionally, the composition further comprises a cationic polymer, wherein the cationic polymer associates with the polynucleotide to form a complex and is co-encapsulated in lipids to form a lipid polymer complex.

13. The composition of claim 12, wherein the cationic polymer is selected from the group consisting of poly-L-lysine, protamine, and polyethyleneimine; preferably, the cationic polymer is protamine.

14. A vaccine formulation comprising the polynucleotide of any one of claims 1 to 8 or the composition of any one of claims 9 to 13.

15. The vaccine formulation of claim 14, wherein the lipid encapsulating the polynucleotide comprises 10-70 mol% of M5, 10-70 mol% of 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 10-70 mol% of cholesterol, and 0.05-20 mol% of 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol (DMG-PEG) 2000; preferably, the lipid is M5, DOPE, cholesterol, and (DMG-PEG) 2000 in a molar ratio of 40:15:43.5:1.5, 16. The vaccine formulation according to claim 14 or 15, wherein the vaccine formulation is a liquid formulation or a freeze-dried formulation.

17. The vaccine formulation of any one of claims 14 to 16, wherein the vaccine formulation is administered by intramuscular injection or intramucosal administration.

18. Use of the polynucleotide of any one of claims 1 to 8, the composition of any one of claims 9 to 13, or the vaccine formulation of any one of claims 14 to 17 in the preparation of a medicament for preventing and / or treating influenza virus infection in a subject in need thereof.

19. The use of claim 18, wherein the subject is a human or a non-human animal.

20. A method for preventing or treating influenza virus infection in a subject in need thereof, the method comprising: Administering the polynucleotide of any one of claims 1-8, the composition of any one of claims 9-13, or the vaccine formulation of any one of claims 14-17 to a subject in need thereof.

21. The method of claim 20, wherein the subject in need thereof is a human or a non-human animal.

22. Use of the polynucleotide of any one of claims 1 to 8, the composition of any one of claims 9 to 13, or the vaccine formulation of any one of claims 14 to 17 for preventing or treating influenza virus infection in a subject in need thereof.

23. The polynucleotide, composition or vaccine formulation for use according to claim 22, wherein the subject is a human or a non-human animal.

Images