Pharmaceutical composition for treating diabetic retinopathy
Through the composition of dioxins, hydroxycentella asiaticin, rutin and betaine, the problems of complex composition and insignificant efficacy of existing drugs have been solved, and effective treatment of diabetic retinopathy and quality of life have been achieved.
Patent Information
- Application Number
- CN202510602194.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-12
- Publication Date
- 2025-07-25
AI Technical Summary
The existing drugs for treating diabetic retinopathy have problems such as complex composition, difficult quality to control, small content of active ingredients, and insignificant efficacy. Most modern dosage forms are crude extracts and the dosage is taken large.
The composition of dioxins, hydroxycentella asiaticin, rutin and betaine is prepared in the form of tablets, capsules, etc. through different weight ratios, and is administered through the gastrointestinal tract or parenteral tract for the treatment of diabetic retinopathy.
Significantly improve the patient's subjective symptoms, inhibit the development of the disease, improve the quality of life, have no toxic side effects, and has clinical practical value.
Smart Images

Figure CN120361027A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of pharmaceutical technology, and particularly relates to a pharmaceutical composition for treating diabetic retinopathy. Background Art
[0002] Diabetic retinopathy (DR) is one of the most common and severe microvascular complications of diabetes. Simple diabetic retinopathy is mainly characterized by symptoms such as dilation of fundus veins, microaneurysms, and bleeding. When the lesion involves the macula, causing extensive proliferative lesions such as vitreous hemorrhage and rupture of new blood vessels, it will cause obvious damage to vision, and in severe cases, blindness. Diabetic retinopathy is related to the disease course and the degree of blood glucose control, while age, gender, and diabetes type have little effect. The incidence of fundus changes is high in those with a disease course of more than 10 years regardless of age. The main treatment of DR in Western medicine is to control blood glucose, blood pressure, and blood lipid. Currently, there is no specific drug for treatment.
[0003] Diabetic retinopathy belongs to the categories of "consumptive thirst with eye disease", "dimness of vision", "sudden blindness", "hemorrhage into the pupil" in traditional Chinese medicine. After a long period of consumptive thirst, the body fluid is deficient and cannot nourish the eye collaterals, and the essence of the eye loses nourishment; or due to deficiency of liver and kidney yin, the deficiency fire flares up, burning the eye collaterals and causing blood to overflow; or due to yin deficiency and excessive fire, it burns body fluid into phlegm, which stays and blocks the meridians, causing stasis of collaterals, resulting in the obstruction of the divine light and blindness. The basic pathogenesis is qi and yin deficiency, and blood stasis obstruction. The treatment should be to supplement qi and nourish yin, and promote blood circulation to remove blood stasis.
[0004] Currently, for diabetic retinopathy, the main clinical manifestations are the excess syndromes of phlegm and blood stasis such as microaneurysms, punctate hemorrhage, hard exudates, and retinal edema. Therefore, most of the traditional Chinese medicine drugs for treating diabetic retinopathy are mainly to dispel pathogenic factors, and the formula and medication are inseparable from promoting blood circulation to remove blood stasis, clearing the liver and improving eyesight, such as Zhixue Quyu Mingmu Tablets. However, due to the direct decoction of traditional prescriptions, the ingredients are complex and unclear, making it difficult to carry out quality control; some modern dosage forms are mostly crude extracts, and the content of active ingredients is relatively small, with disadvantages such as large dosage and insignificant curative effect. Based on literature research and the research accumulation of the research group, in this study, diosgenin, madecassoside, rutin, and betaine were used in combination to delay the progression of retinopathy, and relevant research was carried out, which is of great significance for the development of drugs for treating diabetic retinopathy. Summary of the Invention
[0005] Aiming at the deficiencies of the prior art, the present invention provides a pharmaceutical composition for treating diabetic retinopathy, and studies its biological activity and medical use.
[0006] In the first aspect, the present invention provides a pharmaceutical composition for treating diabetic retinopathy, which is composed of the following raw materials: 4 - 50 parts by weight of diosgenin, 1 - 25 parts by weight of madecassoside, 3 - 60 parts by weight of rutin, and 5 - 70 parts by weight of betaine.
[0007] Further, the raw materials of the pharmaceutical composition are as follows: diosgenin 4 - 50 parts by weight, or 8 - 45 parts by weight, or 12 - 40 parts by weight, or 16 - 35 parts by weight, or 20 - 35 parts by weight, or 28 - 35 parts by weight, such as 32 parts by weight; and,
[0008] asiaticoside 1 - 25 parts by weight, or 1 - 21 parts by weight, or 1 - 15 parts by weight, or 1 - 9 parts by weight, such as 3 parts by weight; and,
[0009] rutin 3 - 60 parts by weight, or 3 - 49 parts by weight, or 3 - 35 parts by weight, or 3 - 21 parts by weight, or 5 - 14 parts by weight, such as 7 parts by weight; and,
[0010] betaine 5 - 70 parts by weight, or 14 - 65 parts by weight, or 21 - 65 parts by weight, or 35 - 60 parts by weight, or 49 - 60 parts by weight, such as 56 parts by weight.
[0011] Further, the rutin includes one or a combination of rutin powder, rutin extract, and rutin extract.
[0012] The pharmaceutical composition can be prepared according to methods known in the art. For this purpose, if necessary, the active ingredient can be combined with one or more solid or liquid pharmaceutical excipients and / or adjuvants to form a suitable administration form or dosage form for human use.
[0013] Further, the excipients include one or more of solvents, disintegrants, flavoring agents, preservatives, coloring agents, binders, lubricants, diluents, and pharmaceutical carriers.
[0014] Further, the excipients include one or more of solvents, disintegrants, flavoring agents, preservatives, coloring agents, binders, lubricants, diluents, and pharmaceutical carriers.
[0015] Those skilled in the art are fully aware that excipients (such as pharmaceutical excipients) include solvents, propellants, solubilizers, cosolvents, emulsifiers, coloring agents, binders, disintegrants, fillers, lubricants, wetting agents, osmotic pressure regulators, stabilizers, glidants, flavoring agents, preservatives, suspending agents, coating materials, fragrances, antiadhesives, chelating agents, penetration enhancers, pH regulators, buffers, plasticizers, surfactants, foaming agents, defoaming agents, thickeners, clathrates, humectants, absorbents, diluents, flocculants and deflocculants, filter aids, and release retardants.
[0016] Among them, the diluent can be one or more of mannitol, sucrose, lactose, sorbitol, xylitol, polyethylene glycol, propylene glycol, vegetable oil, and mineral oil; the disintegrant can be one or more of croscarmellose sodium, colloidal silicon dioxide, and citric acid; the binder can be one or more of starch paste, ethanol, water, and povidone alcohol solution; the preservative can be one or more of ethyl p-hydroxybenzoate, propyl hydroxybenzoate, sorbic acid, potassium sorbate, calcium propionate, sodium dehydroacetate, sodium diacetate, and sodium lactate; the antioxidant can be one or more of ethylenediaminetetraacetic acid, disodium ethylenediaminetetraacetate, dibutylhydroxytoluene, glycine, inositol, ascorbic acid, sodium ascorbate, lecithin, malic acid, hydroquinone, citric acid, succinic acid, and sodium metabisulfite; the flavoring agent can be one or more of aspartame, sucrose, xylitol, stevioside, sodium cyclamate, sorbitol, cocoa, pure vanilla, vanillin, ethyl vanillin, chocolate, malt, and mint; the suspending agent can be one or more of xanthan gum, polyvinylpyrrolidone, sodium alginate, aluminum stearate, and hydrogenated vegetable oil; the emulsifier can be one or more of alkyl sulfates, soaps, dodecylbenzenesulfonates, lactate esters, sulfosuccinates, monoglyceride sulfonates, phosphate esters, siloxanes, and taurates.
[0017] Furthermore, the dosage form includes any one of tablets, capsules, pills, powders, ointments, pills, suspensions, powders, injections, sustained-release preparations, and controlled-release preparations.
[0018] Among them, the drug is administered through gastrointestinal and non-gastrointestinal administration routes.
[0019] In particular, the non-gastrointestinal administration route is selected from injection administration, respiratory administration, skin administration, mucosal administration, or cavity administration.
[0020] Among them, the non-gastrointestinal administration preparations are selected from injections, sprays, aerosols, patches, etc.
[0021] In particular, the gastrointestinal administration preparations are selected from tablets, capsules, powders, granules, pills, solutions, emulsions, or syrups, etc.
[0022] In the second aspect, the present invention provides the use of the pharmaceutical composition in the preparation of a drug for treating diabetic retinopathy, and the active ingredients of the pharmaceutical composition are composed of diosgenin, madecassoside, rutin, and betaine.
[0023] Furthermore, diosgenin, madecassoside, rutin, and betaine as active ingredients can be used in combination in the preparation of the drug, or can be compounded with other components having anti-inflammatory activity.
[0024] Further, the drug does not contain other active ingredients with anti-inflammatory activity except diosgenin, asiaticoside, rutin and betaine.
[0025] Further, the raw materials of the drug composition are as follows: diosgenin 4 - 50 parts by weight, or 8 - 45 parts by weight, or 12 - 40 parts by weight, or 16 - 35 parts by weight, or 20 - 35 parts by weight, or 28 - 35 parts by weight, such as 32 parts by weight; and,
[0026] asiaticoside 1 - 25 parts by weight, or 1 - 21 parts by weight, or 1 - 15 parts by weight, or 1 - 9 parts by weight, such as 3 parts by weight; and,
[0027] rutin 3 - 60 parts by weight, or 3 - 49 parts by weight, or 3 - 35 parts by weight, or 3 - 21 parts by weight, or 5 - 14 parts by weight, such as 7 parts by weight; and,
[0028] betaine 5 - 70 parts by weight, or 14 - 65 parts by weight, or 21 - 65 parts by weight, or 35 - 60 parts by weight, or 49 - 60 parts by weight, such as 56 parts by weight.
[0029] In this specification, "parts by weight" of each drug component represents the dosage ratio relationship between the components, rather than an actual mass unit. According to the actual situation, a unit part by weight can be any mass, such as 1 part by weight can be 1 g, 500 g or 1 kg, and even can be 15 g, 30 g, etc.
[0030] Further, the drug composition is made into a pharmaceutically acceptable dosage form with pharmaceutically acceptable excipients.
[0031] Further, the excipients include one or more of solvents, disintegrants, flavoring agents, preservatives, coloring agents, binders, lubricants, diluents and drug carriers.
[0032] Further, the excipients include one or more of solvents, disintegrants, flavoring agents, preservatives, coloring agents, binders, lubricants, diluents and drug carriers.
[0033] Those skilled in the art fully understand that excipients (such as pharmaceutical excipients) include solvents, propellants, solubilizers, cosolvents, emulsifiers, coloring agents, binders, disintegrants, fillers, lubricants, wetting agents, osmotic pressure regulators, stabilizers, glidants, flavoring agents, preservatives, suspending agents, coating materials, fragrances, antiadhesives, chelating agents, penetration enhancers, pH regulators, buffers, plasticizers, surfactants, foaming agents, defoaming agents, thickeners, clathrates, humectants, absorbents, diluents, flocculants and deflocculants, filter aids, and release retardants.
[0034] Among them, the diluent can be one or several of mannitol, sucrose, lactose, sorbitol, xylitol, polyethylene glycol, propylene glycol, vegetable oil, and mineral oil; the disintegrant can be one or several of croscarmellose sodium, colloidal silicon dioxide, and citric acid; the binder can be one or several of starch paste, ethanol, water, and povidone alcohol solution; the preservative can be one or several of ethyl p-hydroxybenzoate, propyl hydroxybenzoate, sorbic acid, potassium sorbate, calcium propionate, sodium dehydroacetate, sodium diacetate, and sodium lactate; the antioxidant can be one or several of ethylenediaminetetraacetic acid, disodium ethylenediaminetetraacetate, dibutylhydroxytoluene, glycine, inositol, ascorbic acid, sodium ascorbate, lecithin, malic acid, hydroquinone, citric acid, succinic acid, and sodium metabisulfite; the flavoring agent can be one or several of aspartame, sucrose, xylitol, stevioside, sodium cyclamate, sorbitol, cocoa, pure vanilla, vanillin, ethyl vanillin, chocolate, malt, and mint; the suspending agent can be one or more of xanthan gum, polyvinylpyrrolidone, sodium alginate, aluminum stearate, and hydrogenated vegetable oil; the emulsifier can be one or several of alkyl sulfates, soaps, dodecylbenzenesulfonates, lactate esters, sulfosuccinates, monoglyceride sulfonates, phosphate esters, siloxanes, and taurates.
[0035] Furthermore, the dosage form includes any one of tablets, capsules, pills, powders, ointments, pills, suspensions, powders, injections, sustained-release preparations, and controlled-release preparations.
[0036] Among them, the drug is administered through gastrointestinal and non-gastrointestinal administration routes.
[0037] In particular, the non-gastrointestinal administration route is selected from injection administration, respiratory administration, skin administration, mucosal administration, or cavity administration.
[0038] Among them, the non-gastrointestinal administration preparations are selected from injections, sprays, aerosols, patches, etc.
[0039] In particular, the gastrointestinal administration preparations are selected from tablets, capsules, powders, granules, pills, solutions, emulsions, or syrups, etc.
[0040] Furthermore, the dosage form is an oral dosage form or an injection dosage form, and controlled-release or sustained-release dosage forms well-known in the modern pharmaceutical industry can also be adopted.
[0041] The dosage of the pharmaceutical composition of the present invention depends on many factors, such as the sex, age, weight and individual response of the patient or animal, the route of administration and the frequency of administration, etc. The above dosage can be administered in a single dosage form or divided into several, for example, two, three or four dosage forms. The dosage level must be selected according to the specific route of administration, the severity of the condition to be treated and the condition and past medical history of the patient to be treated, etc. However, the practice in the art is that the dosage starts from a level lower than that required to obtain the desired therapeutic effect and gradually increases until the desired effect is obtained.
[0042] It should be recognized that the total daily dosage of the pharmaceutical composition of the present invention must be determined by the attending physician within the scope of reliable medical judgment. For any specific patient, the specific therapeutically effective dosage level must depend on a variety of factors, including the disorder being treated and the severity of the disorder; the specific composition employed; the patient's age, weight, general health, sex and diet; the time of administration, the route of administration and the excretion rate; the duration of treatment; the drugs used in combination or concurrently; and similar factors well known in the medical field. For example, the practice in the art is that the dosage of administration starts from a level lower than that required to obtain the desired therapeutic effect and gradually increases until the desired effect is obtained.
[0043] Generally speaking, the dosage of the pharmaceutical composition of the present invention calculated based on the active ingredient for mammals, especially humans, can range from 1 - 1000 mg / kg body weight / day, for example, from 1 - 500 mg / kg body weight / day, for example, from 50 - 500 mg / kg body weight / day, or 100 - 500 mg / kg, or 150 - 500 mg / kg, or 200 - 500 mg / kg, or 250 - 500 mg / kg.
[0044] Beneficial effects: Verified by animal experiments, the pharmaceutical composition of the present invention has a good therapeutic or disease development inhibitory effect on diabetic retinopathy, can improve the subjective symptoms of patients, improve the quality of life of patients, and has no toxic side effects and is not prone to produce tolerance. This discovery will have a significant impact on the research and treatment of diabetic retinopathy and has clinical practical value. BRIEF DESCRIPTION OF THE DRAWINGS
[0045] Figure 1 Shows the effect of the present invention on the retinal tissue morphology of DR rats;
[0046] Figure 2 Is the protein expression map of occludin and Caspase-3 in the rat retina. DETAILED DESCRIPTION OF THE INVENTION
[0047] To enable those skilled in the art to better understand the technical solution of the present invention, the present invention will be described in detail below in conjunction with specific embodiments. The experimental methods without specific conditions noted in the following examples are generally carried out according to conventional conditions or according to the conditions recommended by the manufacturer. The test materials used in the following examples are all obtained from regular biochemical reagent stores unless otherwise specified. Unless otherwise stated, percentages and parts are calculated by weight. Unless otherwise defined, all professional and scientific terms used herein have the same meaning as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to the described content can be applied to the present invention. The preferred implementation methods and materials described herein are for illustrative purposes only.
[0048] In the ranges disclosed herein, the endpoints and any value are not limited to the exact range or value, and these ranges or values should be understood to include values close to these ranges or values. For numerical ranges, between the endpoint values of each range, between the endpoint values of each range and individual point values, and between individual point values, they can be combined with each other to obtain one or more new numerical ranges, and these numerical ranges should be regarded as specifically disclosed herein.
[0049] The technical solution of the present invention will be further described in detail below in conjunction with specific embodiments and the accompanying drawings. It should be understood that the following embodiments are only used to explain the present invention and are not used to limit the present invention.
[0050] Example 1
[0051] 4 parts by weight of diosgenin, 6 parts by weight of madecassoside, 56 parts by weight of rutin, 28 parts by weight of betaine
[0052] Example 2
[0053] 8 parts by weight of diosgenin, 12 parts by weight of madecassoside, 49 parts by weight of rutin, 56 parts by weight of betaine
[0054] Example 3
[0055] 12 parts by weight of diosgenin, 18 parts by weight of madecassoside, 42 parts by weight of rutin, 21 parts by weight of betaine
[0056] Example 4
[0057] 16 parts by weight of diosgenin, 24 parts by weight of madecassoside, 35 parts by weight of rutin, 49 parts by weight of betaine
[0058] Example 5
[0059] 20 parts by weight of diosgenin, 3 parts by weight of madecassoside, 28 parts by weight of rutin, 14 parts by weight of betaine
[0060] Example 6
[0061] 24 parts by weight of diosgenin, 9 parts by weight of madecassoside, 21 parts by weight of rutin, 42 parts by weight of betaine
[0062] Example 7
[0063] 28 parts by weight of diosgenin, 15 parts by weight of madecassoside, 14 parts by weight of rutin, 7 parts by weight of betaine
[0064] Example 8
[0065] 32 parts by weight of diosgenin, 21 parts by weight of madecassoside, 7 parts by weight of rutin, 35 parts by weight of betaine
[0066] Verify the efficacy of the pharmaceutical composition
[0067] Establishment of animal model: Male Brown Norway rats, with a body weight of 150 - 210 g, were purchased from Beijing SPF Biotechnology Co., Ltd. (SPF level), and the animal production license number is: SCXK (Beijing) 2024 - 0001. According to the animal body weight, STZ was dissolved in pH 4.5 sodium citrate buffer at a dose of 30 mg / kg, mixed well and protected from light, and continuously intraperitoneally injected for 3 days. Before the first injection, the rats were fasted overnight for 12 h without water restriction. After 2 h of injection, feed was added, and after 4 h, 5% glucose drinking water was added. After 10 h, it was changed to normal drinking water. Rats in the normal group were injected with an equal volume of citrate buffer. 48 h after injecting the drug, the blood glucose of the model group rats increased, and the water intake and urine output increased. Random blood glucose was measured on the 7th day after injection. If the fasting blood glucose level of the rats > 11.1 mmol / L, the DM model was successfully established. After the continuous feeding was completed, the rats were sacrificed, and the retinal tissues of the rats were collected. During the experiment, the success of the DR rat model construction and the progression of the pathological state were judged through medical imaging indexes (optical coherence tomography and fundus fluorescein angiography detection) and HE staining results. During the experiment, the animal breeding density should not be too high, the ventilation should be appropriate, and environmental disinfection should be carried out to prevent mutual biting and cross-infection.
[0068] Animal grouping and administration: After successful diabetes modeling, the animals were randomly divided into: normal group (CON), model group (MOD), calcium dobesilate capsule group (CDC), and example groups (UDE1-UDE8). The rats in each group were given intragastric administration. The dose of the CDC group was 135 mg / kg / d, and the rats in the MOD group and the CON group were given 5% sodium carboxymethylcellulose solution by gavage once a day for 8 consecutive weeks. After the administration ended at the 8th week, the experimental rats were fasted (without water restriction) for 12 h, and the rats in each group were anesthetized with sodium pentobarbital (40 mg / ml). After dissection, blood was collected from the abdominal aorta, and the serum was separated by centrifugation at 3000 rpm / min for 15 min and aliquoted into 0.5 mL centrifuge tubes and stored at -80 °C for later use. The eyeballs were circularly cut along the corneal margin, the cornea, lens, and vitreous body were removed, the retina was fixed in an electron microscope fixative, and the rest were stored in liquid nitrogen and then stored at -80 °C for later use.
[0069] The data were analyzed and graphed using Graphpad prism 9.4.0 software, and the results were expressed as mean ± standard error (means ± SEM). The t-test (student’s t-test) was used for data comparison and analysis of more than two groups, and one-way ANOVA was used for data comparison and analysis of more than two groups.
[0070] (1) Investigate the effect of administration on the retinal cell pathology of rats
[0071] Take fresh retinal tissue and fix it in an eyeball electron microscope fixative. After rinsing with a phosphate buffer solution for 3 min, fix it with 1% osmium tetroxide in the dark at room temperature for 2 h. Dehydrate step by step with alcohol, pour the embedding agent into the embedding plate, and leave the embedding plate in an oven at 37 °C overnight. Cut ultra-thin sections of 60-80 nm with an ultra-microtome. Observe under a transmission electron microscope and collect images for analysis (see Figure 1 ). The ratio of the gap area of the rod membrane disc to the membrane disc area (Gap area of rod membrane disc / Membrane disk area, G / M) of DM rats in each group was measured using ImageJ Pro Plus 6 software, and the results are shown in Table 1.
[0072] Table 1
[0073]
[0074] Note: Compared with the model group, * P < 0.05, ** P < 0.01, *** P < 0.001
[0075] As Figure 1As shown, the nuclear membranes of endothelial cells and pericytes in the rat retinal capillaries were slightly indented, heterochromatin condensation was obvious and marginal, the number of pinocytotic vesicles in the cytoplasm of endothelial cells increased, mitochondria were swollen, and the cytoplasm protruded into the lumen, but the lumen was not significantly deformed. The capillaries were dilated, the mitochondria of pericytes were swollen and the cristae disappeared, even showing vacuolar degeneration, and the basement membrane was thickened. As can be seen from Table 1, compared with the normal group, the ratio of the area of the rod outer segment disc space to the disc area in the model group was significantly increased; compared with the model group, the ratio of the area of the rod outer segment disc space to the disc area in each example group showed a downward trend, and the decrease in Example 2 was the most significant.
[0076] (2) Investigate the effect of drug administration on the protein expression of occludin and Caspase-3 in rat retinal tissue
[0077] The protein expression of occludin and Caspase-3 was detected by Western blotting. The specific method was as follows:
[0078] The tissue samples were minced on ice and RIPA lysis buffer and 1 mM PMSF were added. Ice bath lysis was performed according to the ratio of adding 150 - 250 μL of lysis buffer per 20 mg of tissue. Total protein was extracted, and the protein concentration of the supernatant was determined by the BCA method to adjust the protein concentration of each sample. 10% separating gel and 5% stacking gel were prepared. After the gel solution solidified, 1X electrophoresis buffer was added and samples were loaded. 3 μL of Marker and 10 μL of samples were used. The electrophoresis tank was connected to the power supply. The conditions were: voltage 60 V, electrophoresis time 30 min; the voltage was switched to 90 V and electrophoresis was carried out for 120 min. When the target bands were separated, electrophoresis was stopped. PVDF membrane (the PVDF membrane needs to be soaked in pure methanol for 30 - 60 seconds first) and filter paper were cut according to the size of the gel and placed in the transfer buffer for 10 min to equilibrate. In the order of sponge - 3 layers of filter paper - gel - membrane - 3 layers of filter paper - sponge, the gel was placed on the negative electrode side (black side). The transfer tank was placed in an ice bath, transfer buffer was added, the electrodes were inserted, the current was set to 300 mA, and the time was 1 - 2 h. The PVDF membrane was blocked with TBST solution containing 5% skim milk at room temperature for 1.5 h and washed three times with 1X TBST, 10 min each time. The primary antibody dilution was added and incubated overnight at 4°C. The next day, it was taken out and washed three times with 1X TBST, 10 min each time. The secondary antibody was added for blocking and reacted on a shaker at room temperature for 1.5 h. The membrane was washed 3 times with 1X TBST, 10 min each time. The enhanced chemiluminescence solution (A solution: B solution = 1:1 ratio, mixed evenly and used immediately) was prepared and dropped onto the PVDF membrane. The exposure time was set, and the PVDF membrane was imaged in a UVP gel imager and the band pictures were saved. The results were processed by Image J, the gray values of each group were calculated, and the ratio of the target protein to the internal reference protein was calculated. The results are shown in Table 2.
[0079] Table 2 Protein expression levels of occludin and Caspase-3 in the retinas of rats in each group
[0080]
[0081]
[0082] Note: Compared with the model group, * P < 0.05, ** P < 0.01, *** P < 0.001
[0083] As can be seen from the above table, compared with the normal group, the expression level of occludin protein in the model group decreased significantly; the expression of Caspase-3 protein increased significantly; compared with the model group, the expression levels of occludin protein in Example 1 and Group 7 increased significantly; compared with the model group, the expression of Caspase-3 protein in the positive drug group decreased significantly, and the decreasing trend of Caspase-3 protein expression in the remaining example groups was significantly different, indicating that the pharmaceutical composition of the present invention can promote the expression of occludin protein in the retinal tissue of rats with diabetic retinopathy and inhibit the expression of Caspase-3 protein.
[0084] (3) Investigate the effect of drug administration on the leakage volume of Evans blue (EB) in the rat retina
[0085] At the end of the 8th week after the last drug administration, the rats were anesthetized, and EB (45 mg / kg) was injected into the tail vein. After 2 h of circulation, the left ventricle was perfused with normal saline until the liver turned white to remove EB from the systemic circulation of the rats. The eyeballs were immediately removed, and the retinal tissues were taken out under a dissecting microscope and placed in a vacuum drying oven at 55 °C for vacuum drying for 5 h, and the mass of the dried retinal tissues was weighed. 200 μL of formamide was added to the retinal tissues, and EB was extracted after 18 h of water bath at 7 °C. The extraction solution was centrifuged at 12,000 rpm for 30 min, and the supernatant was taken to measure the absorbance values at 620 nm and 740 nm with an enzyme-linked immunosorbent assay (ELISA) reader to obtain the net absorbance value A; a standard curve of EB dye concentration was established with formamide. According to the relationship between the net A value and EB, the concentration of EB in the reagent solution was calculated, and the results are shown in Table 3.
[0086] The calculation formula is: Retinal EB penetration (ng) = EB actual concentration × 200 μL
[0087] Normalized EB penetration (ng / mg) = Retinal EB leakage (ng) / Dry weight of retina
[0088] Table 3
[0089]
[0090] Note: Compared with the model group, * P < 0.05, ** P < 0.01, ***P < 0.001
[0091] As can be seen from Table 3, the Evans blue leakage in the retinas of rats in the normal group was less, and the Evans blue leakage in the retinas of rats in the model group increased significantly compared with that in the normal group, indicating that the diabetic retinopathy rat model was successfully induced. Compared with the model group, the Evans blue leakage in the retinal tissues of rats in each of the other example groups could be reduced.
[0092] (4) Investigate the effects of drug administration on the contents of VEGF in rat serum and TXNIP in vitreous
[0093] The contents of VEGF in rat serum and TXNIP in vitreous were detected using a rat VEGF ELISA kit (product number: EHC108QT.96) and a rat thioredoxin-interacting protein (TXNIP) ELISA kit (product number: CSB-EL025383RA) respectively. The detailed experimental operation steps were carried out according to the standard procedures in the corresponding instructions. The results are shown in Table 4.
[0094] Table 4
[0095]
[0096] Note: Compared with the model group, * P < 0.05, ** P < 0.01, *** P < 0.001
[0097] As can be seen from the above table, compared with the normal group, the VEGF in the rats of the model group increased significantly. Except for Example 4, the VEGF levels in the other implementation groups decreased. The TXNIP level in the rats of the model group increased significantly; compared with the model group, the TXNIP levels in the rats of Example 1-8 groups decreased significantly.
[0098] (5) Investigate the effects of drug administration on the contents of PEDF, IRBP, SS and NGF in rat retinal tissues
[0099] The contents of IRBP, SS, NGF and PEDF in rat retinal tissues were detected using a rat interstitial retinol-binding protein (IRBP) enzyme-linked immunosorbent assay kit (product number: ML-(E)-a6557), a rat somatostatin (SS) enzyme-linked immunosorbent assay kit (product number: MM-0494R2), a rat nerve growth factor (NGF) enzyme-linked immunosorbent assay kit (product number: MM-0187R2), and a rat pigment epithelium-derived factor (PEDF) enzyme-linked immunosorbent assay kit (product number: MM-0313R2). The detailed experimental operation steps were carried out according to the standard procedures in the corresponding instructions. The results are shown in Table 5.
[0100] Table 5
[0101]
[0102] Note: Compared with the model group, * P < 0.05, ** P < 0.01, *** P < 0.001
[0103] As can be seen from the above table, compared with the normal group, the levels of PEDF and IRBP in the rats of the model group showed a decreasing trend. Compared with the model group, the levels of PEDF and IRBP in groups 4 - 8 of the uniform design were significantly increased; compared with the normal group, the levels of SS and NGF in the rats of the model group were significantly decreased, and the SS in the positive drug group showed an increasing trend compared with the model group; the levels of SS in the remaining drug - administered groups were significantly increased; compared with the model group, the content of NGF in the rats of the positive drug group and Example 1 - 2 groups showed an increasing trend, and the content of NGF in the remaining drug - administered groups was significantly increased.
[0104] (6) Investigate the effect of drug administration on the level of PTENmRNA in the retinal tissue of rats
[0105] Extract the total RNA from the retinal tissue of rats. After reverse - transcribing it into cDNA, use fluorescence quantitative PCR to measure the mRNA expression level of the target gene PTEN, with GAPDH as the internal reference gene. The primer sequences are: PTEN - F: GGACGGACTGGTGTAATGATTTGTG,
[0106] PTEN - R: CGCCTCTGACTGGGAATAGTTACTC; The experimental results are shown in Table 6.
[0107] Table 6
[0108]
[0109]
[0110] Note: Compared with the model group, * P < 0.05, ** P < 0.01, *** P < 0.001
[0111] As can be seen from the above table, compared with the normal group, the expression level of PTEN mRNA in the model group showed an increasing trend; compared with the model group, the expression levels of PTEN mRNA in Example 3 - 8 groups were significantly decreased. It indicates that the pharmaceutical composition of the present invention can intervene in the imbalance of neuroprotective factors by regulating miR - 26a / PTEN, and inhibit the damage and apoptosis of nerve cells in diabetic retinopathy neurodegeneration.
[0112] Finally, it should be noted that the above description is only the preferred embodiment of the present invention. Those skilled in the art can make various similar representations under the inspiration of the present invention without violating the purpose and claims of the present invention. Such transformations all fall within the protection scope of the present invention.
Claims
1. A pharmaceutical composition for treating diabetic retinopathy, characterized in that, It consists of the following raw materials: 4 - 50 parts by weight of diosgenin, 1 - 25 parts by weight of madecassoside, 3 - 60 parts by weight of rutin, and 5 - 70 parts by weight of betaine.
2. The pharmaceutical composition according to claim 1, wherein The raw materials of the pharmaceutical composition are as follows: 4 - 50 parts by weight of diosgenin, or 8 - 45 parts by weight, or 12 - 40 parts by weight, or 16 - 35 parts by weight, or 20 - 35 parts by weight, or 28 - 35 parts by weight, such as 32 parts by weight; and, 1 - 25 parts by weight of madecassoside, or 1 - 21 parts by weight, or 1 - 15 parts by weight, or 1 - 9 parts by weight, such as 3 parts by weight; and, 3 - 60 parts by weight of rutin, or 3 - 49 parts by weight, or 3 - 35 parts by weight, or 3 - 21 parts by weight, or 5 - 14 parts by weight, such as 7 parts by weight; and, 5 - 70 parts by weight of betaine, or 14 - 65 parts by weight, or 21 - 65 parts by weight, or 35 - 60 parts by weight, or 49 - 60 parts by weight, such as 56 parts by weight.
3. The pharmaceutical composition according to claim 1, wherein The rutin is one or a combination of rutin powder and rutin extract.
4. Use of the pharmaceutical composition according to claims 1 - 3 in the preparation of a drug for treating diabetic retinopathy, wherein the pharmaceutical composition consists of diosgenin, madecassoside, rutin, and betaine.
5. The application according to claim 4, characterized in that, The drug is one of a gastrointestinal dosage form and a parenteral dosage form.
6. The application according to claim 4, wherein The gastrointestinal dosage form includes one of tablets, capsules, powders, granules, pills, solutions, emulsions, or syrups.
7. The application according to claim 4, characterized in that The parenteral dosage form includes one of injections, sprays, aerosols, and patches.
8. The application according to claim 4, characterized in that, The drug is made with pharmaceutically acceptable excipients using diosgenin, madecassoside, rutin, and betaine as active ingredients.
9. The application according to claim 4, wherein The drug is made with pharmaceutically acceptable excipients using diosgenin, madecassoside, rutin, betaine, and other components with anti - inflammatory activity as active ingredients.
10. The application according to claim 8 or 9, characterized in that, The excipients include one or more of solvents, disintegrants, flavoring agents, preservatives, coloring agents, binders, lubricants, diluents, and drug carriers.