Application of CDK10 inhibitor in enhancing anti-tumor immune response
By combining CDK10 inhibitors with PD-1/PD-L1 antibodies, the drug resistance problem in tumor immunotherapy is solved, significantly inhibiting tumor growth and enhancing the effect of immunotherapy, providing an important basis and application potential for CDK10 targeted drugs.
Patent Information
- Application Number
- CN202510471822.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-15
- Publication Date
- 2025-07-25
AI Technical Summary
Among the existing tumor immunotherapy, the therapeutic effect of PD-1/PD-L1 and CTLA-4 immune checkpoint inhibitors is limited, and the drug resistance problem is prominent. The mechanism of CDK10 in tumor immune escape is unclear, and effective targeted drugs and combined treatment strategies are lacking.
By inhibiting the expression or protein activity of the CDK10 gene in tumor cells and using PD-1/PD-L1 antibody in combination, the CDK10 inhibitor Ponatinib and PD-1/PD-L1 antibody are used to enhance the anti-tumor immune response.
It significantly inhibits tumor growth, enhances the tumor's sensitivity to PD-1/PD-L1 antibodies, and synergistically enhances anti-tumor activity, providing personalized treatment basis and foundation for new drug development.
Smart Images

Figure CN120361229A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of tumor immunotherapy, and particularly to the application of CDK10 inhibitors in enhancing anti-tumor immune responses. Background Art
[0002] Tumor immunotherapy, especially the application of PD-1 / PD-L1 and CTLA-4 immune checkpoint inhibitors, has significantly changed the landscape of clinical tumor treatment. However, only a small number of patients can obtain durable therapeutic benefits from it, and the vast majority of patients still face the problem of drug resistance, and its specific mechanism still needs to be further explored.
[0003] In tumor treatment, protein kinases have become the object of extensive research due to their good potential for drug development. CDK4 / 6 inhibitors represented by palbociclib, ribociclib, and abemaciclib have achieved remarkable clinical results in the treatment of hormone receptor-positive breast cancer; not only have they prolonged the progression-free survival of patients, but they have also significantly improved the overall survival rate. This successful experience has inspired the research enthusiasm of scientific researchers for other members of the CDK family. For example, CDK2 inhibitors have shown potential in preclinical and clinical studies of various cancer types. In addition, transcription-related CDKs, such as CDK9, CDK11, CDK12, and CDK13, have also attracted much attention due to their potential therapeutic value.
[0004] In contrast, the research on CDK10 has been lagging behind for a long time. Although this kinase has been discovered for more than thirty years, its function among transcription-related CDKs still remains a major mystery. Current research has revealed that cyclin M is an activating partner of CDK10, and this discovery provides an important clue for understanding how CDK10 phosphorylates the ETS2 oncoprotein and regulates its stability.
[0005] It is worth noting that CDK10 exhibits a complex dual role in different types of cancers, and can act as both a tumor suppressor and an oncogene. In addition to its role in cancer, CDK10 is also associated with severe developmental disorders such as STAR syndrome and Al Kaissi syndrome. However, although some studies have explored the role of CDK10 in tumorigenesis, most studies are still limited to in vitro systems or immunodeficient mouse models.
[0006] Therefore, exploring the mechanism of action of CDK10 in the tumor immune microenvironment, especially its potential function in tumor immune escape, and ultimately developing highly selective CDK10 small molecule inhibitors or degraders, not only helps to reveal the new functions of CDK10 in tumor immune regulation, but also provides new drug targets and intervention strategies for tumor immunotherapy. Summary of the Invention
[0007] The present invention provides the use of a CDK10 inhibitor in enhancing the anti-tumor immune response. It has been found through research that by inhibiting the expression of the CDK10 gene or its protein activity in tumor cells and in combination with the use of PD-1 / PD-L1 antibodies, compared with monotherapy (PD-1 antibody or CDK10 inhibitor), the combination regimen can significantly enhance the inhibitory effect on tumor growth. This is specifically achieved through the following techniques.
[0008] In the first aspect of the present invention, there is provided the use of a combination of a CDK10 inhibitor and a PD-1 / PD-L1 inhibitor in enhancing the anti-tumor immune response, wherein the CDK10 inhibitor is used to enhance the anti-tumor immune response of the PD-1 / PD-L1 inhibitor.
[0009] Furthermore, the CDK10 inhibitor is a compound or biological material that inhibits the expression of the CDK10 gene in tumor cells or inhibits the protein activity of CDK10 in tumor cells.
[0010] Even further, the CDK10 inhibitor is a nucleic acid molecule, nucleic acid construct, lentivirus, antibody or small molecule compound.
[0011] Optionally, the CDK10 inhibitor is Ponatinib.
[0012] Optionally, the CDK10 inhibitor is any one or more of siRNA, shRNA, sgRNA that knocks down the expression of the CDK10 gene.
[0013] When sgRNA is selected, the target sequence of the sgRNA is as shown in SEQ ID NO.1 or SEQ ID NO.2.
[0014] Furthermore, the tumor includes but is not limited to colon cancer, rectal cancer, melanoma.
[0015] In the second aspect of the present invention, there is provided an anti-tumor preparation, which is composed of a CDK10 inhibitor and a PD-1 / PD-L1 antibody.
[0016] It has been found through experimental research in the present invention that knocking out the Cdk10 gene can significantly inhibit the growth of subcutaneous transplanted tumors of various tumor cells (including CT26, MC38, B16-F10) in mice with a normal immune system. Further experimental research shows that Cdk10 gene knockout significantly enhances the infiltration and effector function of CD8 + T cells in the tumor microenvironment and improves the sensitivity of tumors to PD-1 / PD-L1 immune checkpoint blockade therapy, thus providing a basis for personalized treatment.
[0017] The present invention identifies Ponatinib as a small molecule inhibitor of CDK10 through high-throughput screening, verifies that it can effectively inhibit the activity of CDK10, and shows significant anti-tumor effects in in vivo experiments. In particular, when combined with PD-1 / PD-L1 antibodies for treatment, Ponatinib can significantly enhance the tumor inhibitory effect and exhibit synergistic anti-tumor activity.
[0018] In a third aspect of the present invention, there is provided an application of a CDK10 detection reagent in the preparation of a tumor immunotherapy prediction reagent, where the CDK10 detection reagent is used to detect the expression level of the CDK10 gene or the activity of the CDK10 protein in tumor / cancer tissues without the purpose of disease diagnosis and treatment, so as to predict the sensitivity of tumor / cancer tissues to PD-1 / PD-L1 antibodies.
[0019] In a fourth aspect of the present invention, there is provided a method for predicting the sensitivity of tumor / cancer tissues to PD-1 / PD-L1 antibodies without the purpose of disease diagnosis and treatment, which is predicted by detecting the expression level of the CDK10 gene or the activity of the CDK10 protein in tumor / cancer tissues.
[0020] It should be noted that the "without the purpose of disease diagnosis and treatment" as mentioned in the present invention means that the method is not used in the clinical stage or does not use human or animal living subjects for experiments. For example, various cancer / tumor cell lines purchased or obtained can be used as experimental subjects to study the sensitivity of tumors to alternative therapeutic drugs, and then more effective treatment regimens can be screened out.
[0021] Compared with the prior art, the advantages of the present invention are as follows:
[0022] 1. The present invention for the first time reveals the inhibitory effect of CDK10 knockout on tumor growth. Knocking out CDK10 in tumor cells can significantly inhibit the growth of tumor cells in mice with normal immune systems. This finding clarifies the key role of CDK10 in tumor immune escape and provides an important theoretical basis for anti-tumor immunotherapy targeting CDK10.
[0023] 2. Through clinical sample analysis, the present invention finds that in human colorectal cancer patients, the patients who respond to PD-1 antibody treatment have significantly lower CDK10 expression levels. This result indicates that there is a significant correlation between low CDK10 expression and immunotherapy sensitivity, providing a clinical basis for CDK10 as a biomarker for predicting the efficacy of immunotherapy.
[0024] 3. The present invention further confirms that knocking out CDK10 in tumor cells can significantly enhance the sensitivity to immunotherapy. Combining the knockout of the Cdk10 gene in mice with PD-1 / PD-L1 antibodies can synergistically inhibit or even completely eliminate the growth of tumor cells in vivo. This finding provides a new therapeutic idea for the anti-tumor strategy of jointly targeting CDK10 and immune checkpoints.
[0025] 4. Through high-throughput screening, the present invention successfully identified a small molecule compound, Ponatinib, which can selectively inhibit the kinase activity of CDK10 and exhibits significant anti-tumor effects. This compound provides an important lead compound for the development of anti-tumor drugs targeting CDK10.
[0026] Moreover, the present invention further found that the combination of Ponatinib and PD-1 / PD-L1 antibodies can significantly enhance the sensitivity of tumor cells to PD-1 / PD-L1 antibodies, thereby significantly inhibiting the growth of tumor cells in vivo. This synergistic effect lays an experimental foundation for the development of combination immunotherapy regimens based on CDK10 inhibitors and has important clinical application potential.
[0027] In summary, the present invention not only reveals the important role of CDK10 in tumor immune escape, but also provides important technical support and candidate compounds for the development of new anti-tumor drugs and combination immunotherapy strategies through clinical sample analysis and high-throughput screening. The technical solution of the present invention has significant clinical application value and market prospects. BRIEF DESCRIPTION OF THE DRAWINGS
[0028] Figure 1 It is the immunoblotting result of knocking out Cdk10 in CT26 cells.
[0029] Figure 2 In Figure 2 A and Figure 2 B are respectively the tumor growth curve graph and the tumor weight statistical result graph after subcutaneous transplantation of sgControl, sgCdk10#1, and sgCdk10 #2 CT26 cells into BALB / c mice with normal immune systems.
[0030] Figure 3 In Figure 3 A is the immunoblotting result of knocking out Cdk10 in MC38 cells; Figure 3 B and Figure 3 C are the tumor growth curve graph and the tumor weight statistical result graph after subcutaneous transplantation of sgControl, sgCdk10 #1, and sgCdk10 #2 MC38 cells into C57BL / 6J mice with normal immune systems; Figure 3 D is the immunoblotting result of knocking out Cdk10 in B16-F10 cells;Figure 3 E and Figure 3 F are the tumor growth curve graph and the statistical result graph of tumor weight after subcutaneous transplantation of sgControl, sgCdk10 #1, and sgCdk10 #2 B16-F10 cells in normal immune system C57BL / 6J mice.
[0031] Figure 4 It is the effect of Cdk10 gene knockout on the function of CD8 + T cells in the tumor microenvironment. Among them, Figure 4 A is the statistical result graph of flow cytometry analysis of CD8 + T cells infiltrating in the subcutaneous tumor of mice after knocking out Cdk10 in CT26 cells; Figure 4 B-4D are the flow cytometry result statistical graphs of the proportions of IFNγ + , TNF + , and GzmB + in CD8 + T cells infiltrating in the subcutaneous tumor of mice after knocking out Cdk10 in CT26 cells.
[0032] Figure 5 It is the expression of CDK10 in tumor tissue specimens of colorectal cancer patients who respond or do not respond to PD-1 antibody. Among them, Figure 5 A is the IHC result of human colorectal cancer samples, detecting the expression of CDK10 in tumor tissue specimens of colorectal cancer patients who respond or do not respond to PD-1 antibody; Figure 5 B is the proportion of patients with low or high CDK10 expression who respond to PD-1 antibody.
[0033] Figure 6 It is the tumor growth curve graph of PD-1 antibody on subcutaneous sgControl and sgCdk10 #1 CT26 tumors in mice.
[0034] Figure 7 and Figure 8 are respectively the survival statistical graph and the tumor volume statistical graph of mice after subcutaneous transplantation of sgControl and sgCdk10 #1 CT26 cells in mice and combined with PD-1 antibody treatment.
[0035] Figure 9 It is the flow chart for high-throughput screening of CDK10 inhibitors using the ADP-Glo kinase assay.
[0036] Figure 10 It is the inhibitory effect of each compound on CDK10 activity at a concentration of 100 nM. It can be seen that 12 compounds can reduce the CDK10 activity to 50%.
[0037] Figure 11IC of each candidate compound against CDK10 50 value.
[0038] Figure 12 It is the result graph of the influence of Ponatinib on the activities of CDK10 / CDK9.
[0039] Figure 13 It is the therapeutic effect of Ponatinib alone, PD-1 antibody alone, and the combination of Ponatinib and PD-1 antibody on subcutaneous CT26 tumors in mice. Among them, Figure 13 A-13C is the statistical result graph of the growth of subcutaneous CT26 tumors in mice, the tumor photograph graph, and the statistical result graph of tumor weight for Ponatinib alone, PD-1 antibody alone, and the combination of Ponatinib and PD-1 antibody.
[0040] Figure 14 A is the statistical result graph of the flow cytometry results of the proportion of CD8 + T cells in CD3 + infiltrating subcutaneous tumors of mice in each treatment group; Figure 14 B-14D is the statistical graph of the flow cytometry results of the proportion of IFNγ + TNF + and GzmB + in CD8 + T cells infiltrating subcutaneous tumors of mice in each treatment group. Detailed implementation manners
[0041] The technical solutions of the present invention will be described clearly and completely below. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. All other embodiments obtained by those of ordinary skill in the art without creative efforts based on the embodiments in the present invention belong to the scope of protection of the present invention.
[0042] The following specific implementation cases provided by the present invention mainly studied the influence of the combination of CDK10 inhibitors and PD-1 / PD-L1 antibodies on the growth of these cancers / tumors for several cancer / tumor cell lines such as CT26 mouse colorectal cancer cell line, MC38 mouse colorectal cancer cell line, and B16-F10 mouse melanoma cell line.
[0043] The information of the CDK10 gene is as follows: Gene ID of the CDK10 gene: 8558, and the detailed information can be obtained according to the Gene ID in the NCBI database.
[0044] Specifically, the following specific embodiments provided by the present invention also used the above cancer / tumor cell lines as experimental models to systematically study the effect of CDK10 knockout on tumor growth in different tumor models and deeply explore its mechanism of action.
[0045] Specifically, the following specific embodiments provided by the present invention also evaluated the combined application of CDK10 knockout and PD-1 antibody, and more specifically evaluated the combined application of the CDK10 inhibitor Ponatinib and PD-1 antibody on the synergistic effect of tumor growth.
[0046] Specifically, the present invention used CDK10 knockout tumor cell lines (including CT26, MC38 and B16-F10) as experimental objects as an alternative to study the effect of CDK10 inhibitors in cancer treatment.
[0047] Unless otherwise specifically stated, all raw materials, reagents, instruments and equipment used in the present invention can be obtained through market purchase or prepared by existing methods.
[0048] Examples
[0049] I. Test materials
[0050] In the following specific embodiments of the present invention, the materials used are as follows.
[0051] 1. Cell lines and clinical samples
[0052] Human embryonic kidney cell line HEK293T, CT26 mouse colorectal cancer cell line and B16-F10 mouse melanoma cell line were purchased from the ATCC cell bank.
[0053] The MC38 mouse colon cancer cell line was kindly provided by the laboratory of Dr. Arlene H. Sharpe at Harvard Medical School.
[0054] HEK293T, CT26, MC38 and B16-F10 were all cultured in DMEM cell culture medium (Cat. #C11995500BT, Hyclone) plus 10% fetal bovine serum (Cat. #SA211.02, Cellmax), 100 U penicillin and 100 mg / ml streptomycin.
[0055] Human colorectal cancer samples were provided by Zhongnan Hospital of Wuhan University and approved by the Medical Ethics Committee of Zhongnan Hospital of Wuhan University (Protocol #2020106).
[0056] 2. Test mice
[0057] The BALB / c wild-type (WT) mice and C57BL / 6J WT mice used in this invention were purchased from Jiangsu Jicui Yakang Co., Ltd. All protocols and experiments of the mouse model were carried out in accordance with relevant ethical regulations and approved by the Institutional Animal Care and Use Committee of Wuhan University (MRI2023-LAC052). The mice used in the experiment were all raised under standard housing conditions in the pathogen-free facilities of the Institute of Medicine of Wuhan University.
[0058] 3. Reagents related to the experiment
[0059] (1) Plasmids
[0060] The sgRNAs of sgControl and sgCdk10 were both constructed on the pLenti crispr V2 empty plasmid (purchased from Addgene) and were constructed by our laboratory itself.
[0061] The nucleotide sequence of the targeting sequence #1 of sgCDK10 is: gacaagggctgtgtaaagac, as shown in SEQ ID NO.1. The nucleotide sequence of the targeting sequence #2 of sgCDK10 is: tatgccaacacccttctcgg, as shown in SEQ ID NO.2.
[0062] (2) Antibodies
[0063] The antibody Anti-CDK10 (36106) against CDK10 was purchased from Cell Signaling Technology.
[0064] The antibodies anti-CDK2 (A0094), anti-CDK4 (A16813) and anti-CDK9 (A11145) against CDK2, CDK4 and CDK9 were all purchased from ABclonal.
[0065] The antibody anti-Vinculin (VIN-11-5) mouse mAb (V4505) against the mouse endogenous reference protein was purchased from Sigma-Aldrich.
[0066] anti-mouse NK1.1 (108732) was purchased from Biolegend.
[0067] Antibodies against mouse CD45, CD3, CD4, CD8, IFNγ and TNF, namely anti-mouse CD45 (557659), anti-mouse CD3 (562600), anti-mouse CD4 (563151), anti-mouse CD8 (566096), anti-mouse IFNγ (562303) and anti-mouse TNF (554419), were all purchased from BD Biosciences.
[0068] The antibody against mouse GzmB, anti-mouse GzmB (61-8898-82), was purchased from eBioscience.
[0069] (3)Chemical reagents, polypeptides and recombinant proteins
[0070] The compound library (containing 110 FDA-approved kinase inhibitors) and Ponatinib for screening CDK10 inhibitors by in vitro ADP-Glo kinase assay were purchased from MedChemExpress (MCE). The recombinant proteins CDK10 / CyclinM and CDK9 / CyclinT1 were purchased from Reaction Biology.
[0071] The CDK10 polypeptide substrate (amino acid sequence: GNRPGSPKRGG, as shown in SEQ ID NO.3) and the CDK9 polypeptide substrate (amino acid sequence: YSPTSPSYSPTSPSYSPTSPSKKKK, as shown in SEQ ID NO.4) were purchased from ABclonal.
[0072] The PD-1 antibody (BE0273) was purchased from Bioxcell.
[0073] II. Test methods
[0074] 1. Biochemical experiments and cell experiments
[0075] (1)Lentiviral infection of cancer cell lines
[0076] ① Lentivirus packaging
[0077] One day before transfection, HEK293T cells were seeded in 6-cm culture dishes and transfected when the cell density reached 70-80%; Take a 1.5 mL Ep tube, add 300 μL of Opti-MEM medium, and sequentially add 2 μg of the target plasmid, 2 μg of psPAX2, 1 μg of pMD2.G, and 15 μL of PEI. After mixing, let it stand for 15 minutes; Dropwise add the mixture into the HEK293T cell culture dish, gently mix, and place it in an incubator at 37°C for 7-8 hours, then replace it with fresh complete medium; Collect the virus supernatant 36 hours and 60 hours after transfection, combine them, and filter through a 0.45 μm filter.
[0078] ② Lentivirus infection: Seed the cancer cell lines (CT26, MC38, and B16-F10) in 6-well plates at a density of 30-40%; Add 1 mL of virus solution and 1 mL of fresh complete medium to each well. After culturing for 12 hours, replace it with fresh virus solution and medium, continue culturing for 12 hours, then replace it with fresh complete medium and continue culturing for 24 hours.
[0079] ③ Screening and detection: Use puromycin to screen the infected cells (CT26: 8 μg / ul puromycin, MC38: 4 μg / ul puromycin, B16-F10: 1 μg / ul puromycin); Detect the knockout effect of CDK10 by immunoblotting.
[0080] (2)Protein immunoblotting experiment (Western Blot)
[0081] ① Collect protein samples
[0082] Lyse the constructed CDK10-knockout tumor cell line with pre-cooled EBC lysis buffer at 4°C for 15 minutes; Centrifuge the lysed cells at 14,000 rpm for 10 minutes at 4°C and collect the supernatant; Use a BCA kit to measure the protein concentration in the supernatant. Add 3× Loading Buffer to the supernatant, boil for 5 minutes, load the sample, and perform SDS-PAGE.
[0083] ② SDS-PAGE and transfer
[0084] Perform protein electrophoresis for 70 minutes at a constant voltage of 128 V in the protein electrophoresis buffer; After electrophoresis, perform protein transfer for 2 hours at a constant current of 300 mA in the protein transfer buffer to transfer the protein from the gel to the PVDF membrane.
[0085] ③ Blocking and antibody incubation
[0086] After the transfer is completed, place the PVDF membrane in 5% skim milk and block it at room temperature for 1 hour. After the blocking is completed, place the PVDF membrane in the diluted primary antibody solution and incubate it overnight at 4°C.
[0087] ④ECL development
[0088] After the incubation with the primary antibody, wash the PVDF membrane three times with TBST buffer for 10 minutes each time.
[0089] Secondary antibody incubation: Place the PVDF membrane in the diluted secondary antibody solution and incubate it at room temperature for 1 hour.
[0090] Washing: After the incubation with the secondary antibody, wash the PVDF membrane three times with TBST buffer for 10 minutes each time.
[0091] Development: Use ECL developer to develop the PVDF membrane, observe and record the results.
[0092] 2. Animal experiments
[0093] (1) Mouse subcutaneous tumor-bearing experiment
[0094] ①Cell preparation
[0095] Take the constructed mouse Cdk10 knockout cell line, digest the cells with 0.05% trypsin, wash twice with PBS; then terminate the digestion with DMEM and centrifuge to remove the supernatant; resuspend the cells with DMEM, pipette the cells thoroughly, and perform cell counting to adjust the cell density (CT26: 5×10 6 cells / mL, MC38: 2×10 6 cells / mL, and B16-F10: 1×10 7 cells / mL). During the process of preparing the cells, to prevent the cells from being digested for too long and the cell growth density from being too high, control the maximum cell density within 80% to maintain the best state of cell growth.
[0096] ②Cell transplantation
[0097] Inject 100 μL of cell suspension (resuspended with serum-free MDEM) subcutaneously into 6-8-week-old mice at the intersection of the midline under the axilla and the 4th rib of the mice. After the injection is completed, closely observe the formation of tumors.
[0098] ③Tumor measurement and mouse sacrifice
[0099] Start observing and recording the tumor growth status on the 6th day after the injection of tumor cells. Measure the length and width of the tumors of the mice with a vernier caliper every two days, and use the formula: length × width 2 ×0.5 to calculate the volume of the tumors of the mice. According to the ethics of experimental animals, when the volume of the tumors of the mice reaches 1500 mm3 When the tumor ulceration diameter of the mouse exceeds 1 cm, the mouse is euthanized. Record and make the tumor growth curve of the mouse after cell injection.
[0100] (2)Analysis of tumor-infiltrating lymphocytes
[0101] ① Twenty days after subcutaneous injection of sgControl, sgCdk10 #1, and sgCdk10 #2 CT26 cells into BALB / c mice with normal immune systems, the mice are euthanized and the tumor tissues are isolated. Use scissors to finely chop the tumor and obtain a single-cell suspension through a 40-μm cell strainer.
[0102] ② Centrifuge the single-cell suspension at 250 × g for 5 minutes at 4 °C. After discarding the supernatant, resuspend the cell pellet in 1 mL of tumor digestion buffer and incubate at 37 °C for 30 minutes.
[0103] ③ After digestion, resuspend the cells and treat them with ACK lysis buffer (Cat. #A1049201, Thermo Fisher) at room temperature for 5 minutes to lyse red blood cells. Incubate the single-cell suspension after red blood cell lysis with the corresponding antibody at room temperature or in the dark at 4 °C for 10 minutes or 30 minutes. Finally, analyze the labeled cells by flow cytometry using a Cytoflex LX instrument.
[0104] (3)Experimental study on subcutaneous tumor-bearing sgControl and sgCdk10 #1 CT26 cells in mice combined with PD-1 antibody treatment
[0105] ① Cell preparation
[0106] Take the constructed sgControl, sgCdk10 #1, and CT26 cells, digest the cells with 0.05% trypsin, and wash them twice with PBS; then terminate the digestion with DMEM and centrifuge to remove the supernatant; resuspend the cells with DMEM, fully pipette the cells, and adjust the cell density to 5×10 6 cells / mL by cell counting. During the process of preparing cells, to prevent over-digestion of cells and excessive cell growth density, control the maximum cell density within 80% to maintain the optimal cell growth state.
[0107] ② Cell transplantation
[0108] Inject 100 μL of cell suspension (resuspended in serum-free MDEM) subcutaneously into 6-8-week-old mice at the intersection of the midline of the axilla and the 4th rib under the skin of the mice; after injection, closely observe tumor formation.
[0109] ③ Medication strategy
[0110] The tumor-bearing mice were divided into 4 groups: sgControl + IgG group, sgControl + anti-PD-1 group, sgCdk10 + IgG group, and sgCdk10 + anti-PD-1 group. When the volume of the mice's tumors reached 50 mm 3 , administration of the drugs was started. The dosage of the PD-1 antibody was 100 μg / mouse or 200 μg / mouse; it was administered intraperitoneally once every three days for a total of four times.
[0111] ④ Tumor measurement and mouse sacrifice
[0112] Observation and recording of tumor growth were started on the 6th day after injection of the tumor cells. The length and width of the mice's tumors were measured every two days using a vernier caliper, and the volume of the mice's tumors was calculated using the formula: length × width 2 × 0.5. According to the ethics of experimental animals, when the volume of the mice's tumors reached 1500 mm 3 , or when the ulcerated diameter of the mice's tumors exceeded 1 cm, the mice were considered dead. The tumor growth curve and survival curve of the mice after cell injection were recorded and made.
[0113] (4) Experimental treatment of CT26 cells subcutaneously implanted in mice with Ponatinib alone, PD-1 antibody alone, and the combination of Ponatinib and PD-1 antibody
[0114] ① Cell preparation
[0115] CT26 WT cells were taken, digested with 0.05% trypsin, and washed twice with PBS; then digestion was terminated with DMEM and the supernatant was removed by centrifugation; the cells were resuspended with DMEM, thoroughly pipetted, and the cell density was adjusted to 5×10 cells 6 / mL. During the process of preparing the cells, to prevent over-digestion time and excessive cell growth density of the cells, the maximum density of the cells was controlled within 80% to maintain the best state of cell growth.
[0116] ② Cell transplantation
[0117] 100 μL of the cell suspension (resuspended with serum-free MDEM) was injected subcutaneously into 6-8-week-old mice at the intersection of the midline under the axilla and the 4th rib of the mice. After injection, tumor formation was closely observed.
[0118] ③ Medication strategy
[0119] The tumor-bearing mice were divided into 4 groups: Control group, Ponatinib single-use group, PD-1 antibody single-use group, and Ponatinib and PD-1 antibody combination group. When the volume of the mice's tumors reached 50 mm 3 , drug administration began. The dosage of the PD-1 antibody was 100 μg / mouse, and it was intraperitoneally injected once every three days for a total of four times; the dosage of Ponatinib was 15 mg / kg per mouse, and it was administered by gavage once a day for a total of 16 times.
[0120] ④ Tumor measurement and mouse euthanasia
[0121] Observation and recording of tumor growth status began on the 6th day after tumor cell injection. The length and width of the mice's tumors were measured every two days using a vernier caliper, and the formula: length × width 2 × 0.5 was used to calculate the volume of the mice's tumors. According to laboratory animal ethics, when the volume of the mice's tumors reached 1500 mm 3 , or when the ulceration diameter of the mice's tumors exceeded 1 cm, the mice were euthanized. The tumor growth curve of the mice after cell injection was recorded and made.
[0122] 3. Immunohistochemistry (IHC) test
[0123] (1) Sample preparation: Fix the colorectal cancer tissue of colorectal cancer patients with a fixative such as 4% paraformaldehyde to prevent degradation; embed the tissue in paraffin; use a microtome to cut the tissue into 4-6 μm thick sections and attach them to glass slides.
[0124] (2) Deparaffinization and hydration: Remove the paraffin with xylene; gradually hydrate through gradient ethanol (100%, 95%, 80%, 70%).
[0125] (3) Antigen retrieval: Heat-mediated antigen retrieval was performed by heating the sections in Tris-EDTA antigen retrieval solution (pH 9.0) in a microwave oven for 15 min.
[0126] (4) Blocking endogenous peroxidase: Incubate the sections with 3% hydrogen peroxide at room temperature for 15 min to quench the activity of endogenous peroxidase.
[0127] (5) Blocking non-specific binding: Incubate in 10% normal goat serum for 1 h to block non-specific binding. Then the sections were incubated with the primary antibody overnight at 4°C; washed three times with PBS, 5 min each time.
[0128] (6) Primary antibody incubation: Incubate the sections with the primary antibody overnight at 4°C; wash three times with PBS, 5 min each time.
[0129] (7)Secondary antibody incubation: Incubate the sections with goat secondary antibody solution for 1 h. Wash three times with PBS, 5 min for each wash.
[0130] (8)Color development: Specific detection was performed using the Servicebio detection kit peroxidase / diaminobenzidine (DAB) (Cat. #G1212-200T, Servicebio); counterstain with Mayer's hematoxylin.
[0131] (9)Dehydration, clearing and mounting: Dehydrate through gradient ethanol; clear with xylene; mount with neutral balsam.
[0132] (10)Microscopic examination and analysis: Immunohistochemical staining was scanned using a Leica Aperio VERSA 8 (v12.3.2.8013) multifunctional scanner, and the DAB staining intensity was measured and quantified.
[0133] 4. Screening of CDK10 inhibitors and assay of CDK10 activity
[0134] Screening of CDK10 inhibitors using the in vitro ADP-Glo kinase assay was performed using the ADP-Glo™ Kinase Assay Kit (Cat.# V6930, Promega). The kinase reaction detection was carried out in a white opaque, flat-bottom 384-well microplate (Optiplate, PerkinElmer) with a total volume of 6 µL.
[0135] The reaction mixture contained kinase buffer (final concentration: 25 mM Tris-HCl, pH 7.5; 10 mM MgCl2; 1 mM EGTA; 1 mM DTT; 50 µg / mL heparin; 3 µg / mL BSA), 1% DMSO (or FDA-approved kinase inhibitor dissolved in 1% DMSO), CDK10 / Cyclin M kinase (50 nM), peptide substrate (amino acid sequence GNRPGSPKRGG, as shown in SEQ ID NO.3) (150 µM), and ATP (10 µM).
[0136] Compounds were screened at a working concentration of 100 nM. Incubate the plate at 30 °C for 30 minutes, and measure the kinase activity using the ADP-Glo TM detection kit. After adding 6 µL of ADP-Glo reagent, incubate the plate at room temperature for 50 minutes. Then add 12 µL of kinase detection reagent and gently shake and incubate at room temperature for 60 - 90 minutes.
[0137] Measure the luminescence signal using an EnVision plate reader (PerkinElmer), and determine the IC of the screened compounds according to the inhibition rate at different concentrations.50 Value
[0138] 5. Analysis of test results
[0139] (1)In multiple tumor models, knocking out the Cdk10 gene significantly inhibited the growth of subcutaneous xenografts in mice.
[0140] Figures 1 - 3 This demonstrated the effect of knocking out the Cdk10 gene on the growth of subcutaneous tumors in mice. We constructed a Cdk10 gene knockout cell line in mouse colorectal cancer cells CT26 and confirmed the knockout effect of the Cdk10 gene by Western blot. The results showed that the expression of CDK10 protein was significantly reduced.
[0141] Figure 1 Figure Figure 1 As can be seen, knocking out the Cdk10 gene did not affect the expression of other CDK family members (including CDK2, CDK4, CDK6, and CDK9), indicating the specificity of its knockout.
[0142] CT26 cells with the Cdk10 gene knocked out (experimental group) and control group cells were respectively inoculated subcutaneously into BALB / c mice with normal immune systems to establish a tumor transplantation model, and the tumor volume was monitored regularly. The results are as Figure 2 shown. Figure 2 Figures 2A and 2B are the tumor growth curve and tumor weight statistical results of sgControl, sgCdk10 #1, and sgCdk10 #2 CT26 cells transplanted subcutaneously into BALB / c mice with normal immune systems, respectively. It can be seen that the tumor growth of the experimental group mice was significantly slowed down, and the tumor volume and weight were significantly reduced.
[0143] Figure 3 in Figure 3 Figure 3A is the Western blot result of knocking out Cdk10 in MC38 cells. Among them, Figure 3 Figures 3B and Figure 3 3C are the tumor growth curve and tumor weight statistical results of sgControl, sgCdk10 #1, and sgCdk10 #2 MC38 cells transplanted subcutaneously into C57BL / 6J mice with normal immune systems; Figure 3 Figure 3D is the Western blot result of knocking out Cdk10 in B16-F10 cells; Figure 3 Figures 3E and Figure 3Figure showing the tumor growth curve and statistical results of tumor weight after subcutaneous transplantation of sgControl, sgCdk10 #1, and sgCdk10 #2 B16-F10 cells into normal immune system C57BL / 6J mice. It can be seen that in the MC38 colorectal cancer and B16-F10 melanoma mouse models, knocking out the Cdk10 gene also significantly inhibits tumor growth.
[0144] The above experimental results indicate that the Cdk10 gene plays a key role in various tumor types. Knocking out the Cdk10 gene has a broad-spectrum anti-tumor effect, providing a solid experimental basis and theoretical support for the development of anti-tumor drugs targeting CDK10.
[0145] (2) Knocking out the Cdk10 gene significantly enhances the activity of infiltrating CD8 + T cells in tumors.
[0146] Figure 4 Flow cytometry was used to analyze the effect of knocking out the Cdk10 gene on the function of CD8 + T cells in the tumor microenvironment. Among them, Figure 4 A is the statistical result chart of flow cytometry analysis of infiltrating CD8 + T cells in subcutaneous tumors of mice after knocking out Cdk10 in CT26 cells; Figure 4 B-4D are the flow cytometry result statistical charts of the proportions of IFNγ + , TNF + , and GzmB + in infiltrating CD8 + T cells in subcutaneous tumors of mice after knocking out Cdk10 in CT26 cells.
[0147] From Figure 4 A, it can be seen that in the experimental group with the Cdk10 gene knocked out, the proportion of CD8 + T cells in CD3 + T cells increased significantly, indicating that knocking out the Cdk10 gene promoted the infiltration of CD8 + T cells. From Figure 4 B-4D, it can be seen that the proportions of IFNγ + , TNF + , and GzmB + in CD8 + T cells in the experimental group all increased significantly, indicating that knocking out Cdk10 significantly enhanced the effector function of CD8 + T cells.
[0148] The above experimental results indicate that knocking out the Cdk10 gene not only increases the infiltration of CD8 +The proportion of T cells was also significantly enhanced, as was its anti-tumor immune function. In this experiment, by revealing the enhancing effect of Cdk10 gene knockout on CD8 + T cell function, it provides important experimental evidence and theoretical support for tumor immunotherapy based on the Cdk10 target, and has significant clinical application potential.
[0149] (3)Low expression of the CDK10 gene in tumors can enhance the response of tumors to PD-1 / PD-L1 antibodies
[0150] Considering that the knockout of the Cdk10 gene can significantly enhance the function of CD8 + T cells, which may be beneficial for immune checkpoint blockade therapy. To verify this hypothesis, we performed immunohistochemistry (IHC) staining of CDK10 on specimens from 17 patients with colorectal cancer (CRC). Figure 5 For the expression of CDK10 in tumor tissue specimens of colorectal cancer patients who responded or did not respond to PD-1 antibodies. Among them, Figure 5 A shows the IHC results of human colorectal cancer samples, detecting the expression of CDK10 in tumor tissue specimens of colorectal cancer patients who responded or did not respond to PD-1 antibodies; Figure 5 B shows the proportion of patients with low or high CDK10 expression who responded to PD-1 antibodies. It can be seen that compared with non-responders, the expression of CDK10 was significantly lower in most responders.
[0151] We subcutaneously inoculated sgControl and sgCdk10 #1 CT26 cells into BALB / c mice with normal immune systems, and then treated the inoculated mice with PD-1 antibodies or control IgG respectively. As Figure 6 shown by the research results, the tumor growth of mice in the sgCdk10 #1 combined with PD-1 antibody treatment group was significantly inhibited, and its inhibitory effect was significantly better than that of the sgControl combined with PD-1 antibody treatment group, and this advantage was clearly reflected by the inhibition of tumor growth.
[0152] Figure 7 and Figure 8 are the survival statistical chart and tumor volume statistical chart of mice after subcutaneous transplantation of sgControl and sgCdk10 #1 CT26 cells in mice and combined with PD-1 antibody treatment respectively. It can be seen that the survival period of mice in the sgCdk10 #1 combined with PD-1 antibody treatment group was significantly longer than that of the sgControl combined with PD-1 antibody treatment group, further confirming the synergistic effect of the combined treatment. This synergistic effect reveals the important role of Cdk10 knockout in enhancing the efficacy of immune checkpoint inhibitors, and provides important experimental evidence for the development of combined immunotherapy strategies based on the Cdk10 target.
[0153] (4)High-throughput screening identified Ponatinib as a selective inhibitor of CDK10, which can enhance the efficacy of immunotherapy
[0154] Given the above experimental results indicating that targeting CDK10 may enhance anti-tumor immunity. CDK10 is still a kinase with relatively little research, and there is no selective inhibitor for it. Although the detection techniques for screening and identifying such inhibitors have developed in recent years, specific inhibitors for CDK10 have not been discovered yet.
[0155] Therefore, we used the ADP-Glo kinase assay to screen and identify potential CDK10 inhibitors. We screened 110 FDA-approved kinase inhibitors to identify compounds with inhibitory activity against CDK10, as Figure 9 shown. Specifically, the screening experiment used the ADP-Glo kinase assay, and the known CDK9 / CDK10 inhibitor SNS-032 was used as a positive control. We tested at a compound concentration of 100 nM and screened out 12 candidate compounds that could reduce CDK10 activity to less than 50% of the control group, as Figure 10 shown.
[0156] Subsequently, we calculated the IC 50 value of the candidate compounds based on the inhibition rate at different concentrations. Among them, Ponatinib showed the strongest inhibitory effect on CDK10, as Figure 11 shown. Previous studies have shown that Ponatinib can target the leukemia-related BCR::ABL1 mutant and has been approved by the FDA for the clinical treatment of chronic myeloid leukemia (CML).
[0157] In further tests, as Figure 12 shown, we used the ADP-Glo kinase assay to detect that the IC 50 value of Ponatinib for CDK10 was 9.9 nM, while the IC 50 value for CDK9 was 721.2 nM, showing that its selectivity ratio was less than 7-fold. This result indicates that Ponatinib has a strong inhibitory effect on CDK10 and a weak inhibitory effect on CDK9, with a certain degree of selectivity.
[0158] Given that knocking out CDK10 can enhance the sensitivity to PD-1 / PD-L1 antibodies, we further evaluated whether Ponatinib could enhance the efficacy of PD-1 antibody immunotherapy in a homologous mouse tumor model. The experimental results are as Figure 13As shown in A-13C, it can be seen that the treatment with Ponatinib alone can effectively inhibit tumor growth. More importantly, the combined treatment of Ponatinib and PD-1 antibody significantly enhanced the tumor inhibitory effect, and the combined treatment group showed stronger anti-tumor activity compared to any single-agent treatment.
[0159] As Figure 14 shown in A-14D, in the combined treatment group, the proportion of CD8 + T cells in CD3 + T cells, as well as the proportions of IFNγ + and TNF + and GzmB + in CD8 + T cells were significantly higher than those in other treatment groups.
[0160] These results indicate that the CDK10 inhibitor Ponatinib can enhance the immune activity of T cells and, as a sensitizer for immune checkpoint blockade therapy, further improve the clinical efficacy of immunotherapy.
[0161] In summary, the experimental results of the present invention prove that the combined application of Ponatinib and PD-1 / PD-L1 antibody significantly inhibits the growth of mouse colon cancer cells. In contrast, the effects of using PD-1 / PD-L1 antibody or CDK10 inhibitor alone in inhibiting tumor growth are inferior to the combined treatment regimen. The above research results indicate that the combined treatment strategy provided by the present invention has significant advantages in the field of tumor immunotherapy and provides new ideas and directions for improving the anti-tumor efficacy of immune checkpoint inhibitors.
[0162] The above specific embodiments have described the implementation of the present invention in detail. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the claims and technical concept of the present invention, various simple modifications and changes can be made to the technical solutions of the present invention, and these simple variations all belong to the protection scope of the present invention.
Claims
1. Use of a combination of a CDK10 inhibitor and a PD-1 / PD-L1 inhibitor in enhancing anti-tumor immune response, characterized in that, The CDK10 inhibitor is used to enhance the anti-tumor immune response of the PD-1 / PD-L1 inhibitor.
2. Use of the combination of the CDK10 inhibitor and the PD-1 / PD-L1 inhibitor according to claim 1 in enhancing the anti-tumor immune response, characterized in that, The CDK10 inhibitor is a compound or biological material that inhibits the expression of the CDK10 gene in tumor cells or inhibits the activity of the CDK10 protein in tumor cells.
3. Use of the combination of the CDK10 inhibitor and the PD-1 / PD-L1 inhibitor according to claim 2 in enhancing the anti-tumor immune response, characterized in that, The CDK10 inhibitor is a nucleic acid molecule, nucleic acid construct, lentivirus, antibody or small molecule compound.
4. Use of the combination of the CDK10 inhibitor and the PD-1 / PD-L1 inhibitor according to claim 3 in enhancing the anti-tumor immune response, characterized in that, The CDK10 inhibitor is Ponatinib.
5. Use of the combination of the CDK10 inhibitor and the PD-1 / PD-L1 inhibitor according to claim 3 in enhancing the anti-tumor immune response, characterized in that, The CDK10 inhibitor is any one or more of siRNA, shRNA, sgRNA that knockdown the expression of the CDK10 gene.
6. Use of the combination of the CDK10 inhibitor and the PD-1 / PD-L1 inhibitor according to claim 5 in enhancing the anti-tumor immune response, characterized in that, The target sequence of the sgRNA is as shown in SEQ ID NO.1 or SEQ ID NO.
2.
7. Use of the combination of the CDK10 inhibitor and the PD-1 / PD-L1 inhibitor according to claim 1 in enhancing the anti-tumor immune response, characterized in that, The tumor is colon cancer, rectal cancer, melanoma.
8. An anti-tumor preparation, characterized in that, The anti-tumor preparation consists of a CDK10 inhibitor and a PD-1 / PD-L1 antibody.
9. Use of a CDK10 detection reagent in the preparation of a tumor immunotherapy prediction reagent, characterized in that, The CDK10 detection reagent is used to detect the expression level of the CDK10 gene or the activity of the CDK10 protein in tumor / cancer tissues without the purpose of disease diagnosis and treatment, so as to predict the sensitivity of tumor / cancer tissues to the PD-1 / PD-L1 antibody.
10. A method for predicting the sensitivity of tumor / cancer tissues to PD-1 / PD-L1 antibodies without the purpose of disease diagnosis and treatment, characterized in that, Prediction is carried out by detecting the expression level of the CDK10 gene or the activity of the CDK10 protein in tumor / cancer tissues.