3D printed epidermal cell skin model as well as preparation method and application thereof

By combining photocuring 3D volume printing technology with modified bioinks, epidermal cell skin models were prepared, solving the problems of quality differences, high cost and complex supervision of existing 3D skin models, and achieving efficient and accurate cosmetic raw material screening and safety testing.

CN120366189APending Publication Date: 2025-07-25GUANGDONG MARUBI BIOLOGICAL TECH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510497971.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-18
Publication Date
2025-07-25

AI Technical Summary

Technical Problem

The existing 3D skin models have problems such as quality differences, high costs, shortage of professional talents and complex supervision in terms of technology, application and industrialization, making it difficult to achieve high-throughput screening and large-scale application in drug development and cosmetic testing.

Method used

The epidermal cell skin model was prepared by combining photocuring 3D volume printing technology with modified bioinks. By cross-linking liquid photopolymers through multi-directional light projection, skin model with complex structures was quickly constructed, modified gelatin and extracellular matrix were used to improve biocompatibility, and retinol, vitamin E and EGF were added to the culture medium to promote cell activity.

Benefits of technology

It achieves high resolution and rapid printing, improves cell survival and model stability, provides an efficient and accurate testing platform for cosmetic raw materials, reduces animal experiment dependence, and can simulate specific pathological processes and evaluate cosmetic safety.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120366189A_ABST
    Figure CN120366189A_ABST
Patent Text Reader

Abstract

The invention relates to a 3D printed epidermal cell skin model and a preparation method and application thereof, and the preparation method comprises the following steps: mixing bio-ink with a photoinitiator, then mixing with epidermal cells, and carrying out photocuring 3D volume printing to prepare the epidermal cell skin model. A traditional layer-by-layer printing mode is abandoned, the photocuring 3D volume printing technology is adopted, the liquid photopolymer is cross-linked at the deep position of the resin barrel through multidirectional light projection, rapid curing of the whole volume is achieved, the printing speed is remarkably increased, the high-resolution and smoother surface effect is further provided, and the 3D printing device is suitable for 3D printing. And a more accurate platform is provided for testing of cosmetic raw materials.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to a 3D printed epidermal cell skin model, its preparation method and application. Background Art

[0002] Skin is an organ that wraps the body surface, directly contacts the external environment, and has functions such as protection, excretion, body temperature regulation, and perception of external stimuli. It is the largest organ in the human body. The basic principle of 3D skin model construction technology is to isolate cells from tissues, culture and expand them in vitro, and then mix the expanded cells with biomaterials in a certain proportion so that the cells adhere and grow on the biomaterials to form a 3D skin model.

[0003] Currently, 3D skin models face many challenges and limitations in terms of technology, application, and industrialization. There are various construction methods for 3D skin models, lacking a unified standardized process, resulting in differences in the quality and performance of models produced by different laboratories or enterprises. Traditional construction methods are difficult to achieve high-throughput screening, limiting their large-scale application in drug development and cosmetic testing. In addition, although 3D skin models have made certain progress in simulating the in vivo environment, there are still significant differences compared with real skin, especially in aspects such as cell-cell interactions, immune responses, and drug metabolism.

[0004] In terms of industrialization, the production cost of 3D skin models is relatively high, especially in terms of biomaterials, cell culture, and equipment, which restricts their large-scale promotion. In addition, this field requires interdisciplinary professional knowledge, including biology, materials science, and engineering, and the shortage of relevant professional talents has become a major obstacle to the development of the industry. At the same time, the application of 3D skin models in drug and cosmetic testing needs to meet strict regulatory requirements, and the improvement of relevant regulations and the certification process are relatively complex.

[0005] Nevertheless, the development of 3D skin models still has broad prospects. Research and development of models containing multiple cell types and complex appendages, combination of bio-3D printing and high-throughput technologies, and utilization of artificial intelligence and machine learning for dynamic monitoring and data analysis will become important development directions. With the continuous progress of technology, these problems are expected to be gradually solved, thus promoting the wide application of 3D skin models in more fields.

[0006] In summary, providing a new type of 3D epidermal cell skin model has become one of the urgent problems to be solved in the current field. Summary of the Invention

[0007] To solve the above technical problems, the present invention provides a 3D printed epidermal cell skin model, its preparation method and application. By combining 3D volumetric printing technology and modified bioink, a skin model with complex structures can be rapidly constructed for high-throughput screening of cosmetic raw materials with functions such as whitening, anti-wrinkle, and moisturizing.

[0008] To achieve this purpose, the present invention adopts the following technical solutions:

[0009] In the first aspect, the present invention provides a preparation method for a 3D printed epidermal cell skin model. The preparation method includes: mixing a bioink with a photoinitiator, then mixing with epidermal cells, and performing photocuring 3D volumetric printing to obtain the epidermal cell skin model.

[0010] The photocuring 3D volumetric printing technology (deep vat photocuring printing) adopted by the present invention abandons the traditional layer-by-layer printing method. By multi-directional light projection to crosslink liquid photopolymer deep in the resin vat, rapid curing of the entire volume is achieved. This method not only significantly improves the printing speed (which can be completed within a few seconds), but also provides high resolution and a smoother surface effect, providing a more accurate platform for the testing of cosmetic raw materials.

[0011] Preferably, the bioink contains modified gelatin and extracellular matrix.

[0012] The modified gelatin used in the present invention can enhance cell adhesion and proliferation ability, improving the biocompatibility of the skin model. When using 3D printing technology to construct a 3D skin model with gelatin and skin cells, adding extracellular matrix proteins can form a stable physical support framework and maintain the overall shape of the model, including collagen, which can endow the skin with elasticity and flexibility and intertwine with collagen to build a network with suitable mechanical properties, elastin, and fibronectin, which can connect cells to the extracellular matrix network to stabilize the model structure, provide adhesion sites for cells, guide cell migration, affect cell differentiation, bind growth factors to regulate their activity and release rate, and also affect cell metabolic activities. It plays a crucial role in model construction.

[0013] Preferably, the modified gelatin includes methacrylated gelatin and / or nanocellulose composite gelatin.

[0014] The methacrylated gelatin used in the present invention combines the characteristics of natural and synthetic biomaterials. It has a three-dimensional structure suitable for cell growth and differentiation, excellent biocompatibility and cell response characteristics, provides suitable cell adhesion sites and proteolytic degradability, and can replace artificial basement membranes. In addition, methacrylated gelatin hydrogel has good mechanical properties, and the 3D microscaffolds constructed by it have adjustable mechanical and chemical properties.

[0015] Preferably, the extracellular matrix contains recombinant collagen, recombinant elastin, and recombinant fibronectin.

[0016] Preferably, the extracellular matrix contains 0.1 - 1 mg / mL (such as 0.1 mg / mL, 0.3 mg / mL, 0.5 mg / mL, 0.7 mg / mL, 0.9 mg / mL, or 1 mg / mL, etc.) recombinant collagen, 0.1 - 1 mg / mL (such as 0.1 mg / mL, 0.3 mg / mL, 0.5 mg / mL, 0.7 mg / mL, 0.9 mg / mL, or 1 mg / mL, etc.) recombinant elastin, and 0.1 - 1 mg / mL (such as 0.1 mg / mL, 0.3 mg / mL, 0.5 mg / mL, 0.7 mg / mL, 0.9 mg / mL, or 1 mg / mL, etc.) recombinant fibronectin.

[0017] In the present invention, an extracellular matrix containing composite components such as recombinant collagen, recombinant elastin, and recombinant fibronectin is used to prepare the bioink. Compared with a single - protein component, multiple components simulate the cell growth environment and improve the survival rate of epidermal cells.

[0018] Preferably, the bioink contains 1% - 4% (such as 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, or 4%, etc.) w / v modified gelatin and 0.1% - 0.3% (such as 0.1%, 0.15%, 0.2%, 0.25%, or 0.3%, etc.) w / v extracellular matrix, and the balance is PBS buffer.

[0019] Preferably, the photoinitiator includes ruthenium initiator and / or sodium persulfate photoinitiator.

[0020] Preferably, after the bioink is mixed with the photoinitiator, the mixed solution contains 0.2 - 0.3 mM (such as 0.2 mM, 0.22 mM, 0.24 mM, 0.25 mM, 0.26 mM, 0.28 mM, or 0.3 mM, etc.) ruthenium initiator and 1 - 4 mM (such as 1 mM, 1.5 mM, 2 mM, 2.5 mM, 3 mM, 3.5 mM, or 4 mM, etc.) sodium persulfate photoinitiator.

[0021] Preferably, after mixing with epidermal cells, the concentration of epidermal cells is 1×10 6 ~3×10 6 cells / mL (such as 1×10 6 cells / mL, 1.5×10 6 cells / mL, 2×10 6 cells / mL, 2.5×10 6 cells / mL, or 3×10 6 cells / mL, etc.).

[0022] Preferably, the epidermal cells include human immortalized epidermal cells (HaCaT cells).

[0023] Preferably, the printing time of the photocurable 3D volume printing is 50 - 70 s (such as 50 s, 55 s, 60 s, 65 s or 70 s, etc.), the printing light intensity is 1 - 2 (such as 1, 1.2, 1.4, 1.5, 1.6, 1.8 or 2, etc.), the green light intensity is 50 - 70 (such as 50, 55, 60, 65 or 70, etc.), and the model obtained by printing is a disc with a thickness of 1 - 2 cm (such as 1 cm, 1.2 cm, 1.4 cm, 1.5 cm, 1.6 cm, 1.8 cm or 2 cm, etc.) and a diameter of 7 - 9 cm (such as 7 cm, 7.5 cm, 8 cm, 8.5 cm or 9 cm, etc.).

[0024] Preferably, the preparation method further includes the step of culturing the epidermal cell skin model.

[0025] Preferably, the culturing method includes: culturing the epidermal cell skin model in an epidermal cell culture medium containing retinol, vitamin E and EGF.

[0026] Retinoic acid is a derivative of vitamin A. Retinol regulates gene expression by converting to retinoic acid-binding receptors, thereby promoting cell differentiation and proliferation, participating in intercellular signal transduction to enhance epidermal cell activity, and having the effect of regulating the expression of keratinocyte differentiation markers (such as keratin K1 / K10). Vitamin E has an antioxidant effect, can protect cell membranes from free radical damage, maintain cell integrity and stability, and can also regulate the cell signal transduction pathway to promote the proliferation and differentiation of epidermal cells. EGF (epidermal growth factor) can activate the EGFR receptor tyrosine kinase, promote the cell cycle to enter the S phase from the G1 phase through the RAS-MAPK pathway, activate the signal pathway by binding to the epidermal cell surface receptor, and promote cell proliferation, migration and inhibit cell apoptosis to enhance epidermal cell activity. Retinoic acid, vitamin E and EGF have a synergistic effect in promoting the growth of epidermal cells in the epidermal cell skin model and are all indispensable.

[0027] Preferably, the epidermal cell culture medium contains 0.1 - 10 μM (such as 0.1 μM, 0.5 μM, 1 μM, 2 μM, 5 μM, 7 μM or 10 μM, etc.) retinol, 40 - 60 μM (such as 40 μM, 45 μM, 50 μM, 55 μM or 60 μM, etc.) vitamin E and 10 - 30 ng / mL EGF (such as 10 ng / mL, 15 ng / mL, 20 ng / mL, 25 ng / mL or 30 ng / mL, etc.), and the balance is cell basal medium.

[0028] Preferably, the cell basal medium comprises DMEM complete medium.

[0029] In a second aspect, the present invention provides a 3D printed epidermal cell skin model, which is prepared by the preparation method described in the first aspect.

[0030] In a third aspect, the present invention provides the use of the epidermal cell skin model described in the second aspect in the research and development of skin-contact products.

[0031] Preferably, the skin-contact products include cosmetics or skin care products.

[0032] In a fourth aspect, the present invention provides a method for evaluating the efficacy of raw materials of skin-contact products, the evaluation method comprising: using the epidermal cell skin model described in the second aspect for evaluation and detection.

[0033] Preferably, the skin-contact products include cosmetics or skin care products.

[0034] Preferably, the evaluation and detection include any one or a combination of at least two of epidermal layer gene expression analysis, cell viability detection, or skin barrier function testing.

[0035] Other specific point values within the above numerical ranges can be selected and will not be elaborated one by one here.

[0036] Compared with the prior art, the present invention has the following beneficial effects:

[0037] The present invention uses a bioink with a unique formulation, improves 3D printing technology, and prepares an epidermal cell skin model for high-throughput screening of cosmetic raw materials with whitening, anti-wrinkle, moisturizing and other effects, providing an efficient, accurate and environmentally friendly innovative solution for the development of cosmetic raw materials. The present invention can use this skin model to construct disease-specific skin models (such as photoaging repair defect models), simulate specific pathological processes, and be used to screen and evaluate cosmetics or drugs with repair functions. It can also use this skin model for safety testing, more efficiently evaluate the cytotoxicity of cosmetic raw materials, and reduce the dependence on animal experiments. The present invention further optimizes the culture method of the epidermal cell skin model, uses retinol and vitamin E in combination, and synergistically improves the in vitro culture effect of the epidermal cell skin model. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 It is a microscopic observation result diagram of the epidermal cell skin model in Test Example 2.

[0039] Figure 2 It is a gene transcription expression result diagram in Test Example 3. Detailed implementation manners

[0040] To further elaborate on the technical means and effects adopted by the present invention, the present invention will be further described below in conjunction with embodiments and the accompanying drawings. It can be understood that the specific implementation manners described herein are only used to explain the present invention, rather than limiting the present invention.

[0041] For those without specific technologies or conditions indicated in the embodiments, they shall be in accordance with the technologies or conditions described in the literature in this field or in accordance with the product specifications. For reagents or instruments without the manufacturer indicated, they are all conventional products that can be obtained through regular channels.

[0042] The instruments and reagents used in the following embodiments:

[0043] Light-curing 3D volume printer: purchased from Green Key Biotechnology Co., Ltd., with the product number VBP-T200.

[0044] ECM (extracellular matrix): purchased from Best Pharmaceutical (Guangzhou) Co., Ltd., and its main components include 0.5 mg / mL recombinant collagen, 0.5 mg / mL recombinant elastin, and 0.5 mg / mL recombinant fibronectin.

[0045] GelMA (methacrylated gelatin): purchased from Green Key Biotechnology Co., Ltd., with the product number GK-GM-01.

[0046] Ruthenium initiator and sodium persulfate photoinitiator: purchased from Green Key Biotechnology Co., Ltd., with the product number GK-PI-01.

[0047] DMEM complete culture medium: purchased from Gibco.

[0048] Example 1

[0049] This example provides a preparation method for a 3D printed epidermal cell skin model, including the following steps:

[0050] (1) Prepare the bioink. The bioink contains 2.5% w / v GelMA and 0.2% w / v ECM, and the balance is PBS buffer. Add ruthenium initiator and sodium persulfate photoinitiator. The final concentration of ruthenium initiator is 0.25 mM, and the final concentration of sodium persulfate photoinitiator is 2.5 mM. After thorough mixing, filter and sterilize with a 10 mL syringe and a 0.22 μm filter membrane.

[0051] (2) Prepare the HaCaT cell solution.

[0052] (3) Pipette 1.5 mL of the filtered bioink to resuspend the HaCaT cells, and adjust the concentration of HaCaT cells to 2×10 6per mL. After thorough mixing, transfer it to a sterilized printing bottle, cover the lid, place the printing bottle on ice, and condense for 15 min.

[0053] (4) Set the printing parameters of the stereolithography 3D volumetric printer, with a printing time of 60 s, a printing light intensity of 1.5, and a green light intensity of 60. Take out the printing bottle from the ice, wipe the bottle body with an alcohol cotton pad and place it on the turntable, and start printing. Then, melt it at 37 °C, and use sterile PBS to wash away the uncrosslinked bioink and clean the printed model to obtain a disc model with a thickness of 1.5 cm and a diameter of 8 cm.

[0054] (5) Place the disc model in a 6-well plate for culture. The culture medium contains 5 μM retinol, 50 μM vitamin E, and 20 ng / mL EGF, and the balance is DMEM complete medium.

[0055] Example 2

[0056] This example provides a method for preparing a 3D printed epidermal cell skin model, which includes the following steps:

[0057] (1) Prepare the bioink, which contains 1% w / v GelMA and 0.3% w / v ECM, and the balance is PBS buffer. Add ruthenium initiator and sodium persulfate photoinitiator. The final concentration of ruthenium initiator is 0.2 mM, and the final concentration of sodium persulfate photoinitiator is 4 mM. After thorough mixing, filter and sterilize it using a 10 mL syringe and a 0.22 μm filter membrane.

[0058] (2) Prepare the HaCaT cell solution.

[0059] (3) Pipette 1.5 mL of the filtered bioink to resuspend the HaCaT cells, and adjust the concentration of HaCaT cells to 1×10 6 per mL. After thorough mixing, transfer it to a sterilized printing bottle, cover the lid, place the printing bottle on ice, and condense for 15 min.

[0060] (4) Set the printing parameters of the stereolithography 3D volumetric printer, with a printing time of 60 s, a printing light intensity of 1.5, and a green light intensity of 60. Take out the printing bottle from the ice, wipe the bottle body with an alcohol cotton pad and place it on the turntable, and start printing. Then, melt it at 37 °C, and use sterile PBS to wash away the uncrosslinked bioink and clean the printed model to obtain a disc model with a thickness of 1.5 cm and a diameter of 8 cm.

[0061] (5) Place the disc model in a 6-well plate for culture. The culture medium contains 1 μM retinol, 60 μM vitamin E, and 10 ng / mL EGF, and the balance is DMEM complete medium.

[0062] Example 3

[0063] This embodiment provides a method for preparing a 3D printed epidermal cell skin model, comprising the following steps:

[0064] (1) Prepare a bioink, which contains 4% w / v GelMA and 0.1% w / v ECM, and the balance is PBS buffer. Add a ruthenium initiator and a sodium persulfate photoinitiator. The final concentration of the ruthenium initiator is 0.3 mM, and the final concentration of the sodium persulfate photoinitiator is 1 mM. After thorough mixing, filter and sterilize using a 10 mL syringe and a 0.22 μm filter membrane.

[0065] (2) Prepare a HaCaT cell solution.

[0066] (3) Pipette 1.5 mL of the filtered bioink to resuspend the HaCaT cells, adjust the HaCaT cell concentration to 3×10 6 cells / mL. After thorough mixing, transfer to a sterilized printing bottle, cover the lid, and place the printing bottle on ice for 15 min of condensation.

[0067] (4) Set the printing parameters of the photocuring 3D volumetric printer, with a printing time of 60 s, a printing light intensity of 1.5, and a green light intensity of 60. Take out the printing bottle from the ice, wipe the bottle body with an alcohol cotton sheet and place it on the turntable, and start printing. Then, heat and melt at 37°C, and rinse with sterile PBS to remove the uncrosslinked bioink and wash the printed model to obtain a disc model with a thickness of 1.5 cm and a diameter of 8 cm.

[0068] (5) Place the disc model in a 6-well plate for culturing. The culture medium contains 10 μM retinol, 40 μM vitamin E, and 30 ng / mL EGF, and the balance is DMEM complete medium.

[0069] Example 4

[0070] This embodiment provides a method for preparing a 3D printed epidermal cell skin model, which is different from Example 1 only in that GelMA in the bioink is replaced with an equal amount of gelatin.

[0071] Example 5

[0072] This embodiment provides a method for preparing a 3D printed epidermal cell skin model, which is different from Example 1 only in that GelMA in the bioink is replaced with an equal amount of nanocellulose composite gelatin.

[0073] Example 6

[0074] This embodiment provides a method for preparing a 3D printed epidermal cell skin model, which is different from Example 1 only in that ECM in the bioink is replaced with an equal amount of collagen.

[0075] Example 7

[0076] This example provides a method for preparing a 3D printed epidermal cell skin model, which is only different from Example 1 in that retinol is not added to the culture medium, and the proportion of retinol is distributed to vitamin E and EGF proportionally.

[0077] Example 8

[0078] This example provides a method for preparing a 3D printed epidermal cell skin model, which is only different from Example 1 in that vitamin E is not added to the culture medium, and the proportion of vitamin E is distributed to retinol and EGF proportionally.

[0079] Example 9

[0080] This example provides a method for preparing a 3D printed epidermal cell skin model, which is only different from Example 1 in that EGF is not added to the culture medium, and the proportion of EGF is distributed to retinol and vitamin E proportionally.

[0081] Example 10

[0082] This example provides a method for preparing a 3D printed epidermal cell skin model, which is only different from Example 1 in that retinol, vitamin E and EGF are not added to the culture medium.

[0083] Comparative Example 1

[0084] This comparative example provides a method for preparing a 3D printed epidermal cell skin model, which is only different from Example 1 in that the 3D printing method is layer-by-layer 3D printing, and specifically includes the following steps:

[0085] Use a Stratasys J35 Pro bio-printer, set the printing speed to 3 - 8 mm / s to ensure smooth extrusion and model accuracy; adjust the extrusion pressure between 10 - 50 kPa according to the viscosity of the bio-ink, with higher viscosity corresponding to higher pressure; set the layer thickness to 80 - 150 μm to form a tightly fitting and structurally stable layered model; set the row spacing to 0.8 - 1.2 times the layer thickness to ensure good fusion of each layer.

[0086] Import the three-dimensional structure design file of the skin model into the printer software, and the software will parse the model into a layer-by-layer printing path. Start the printing program, and the printer nozzle moves along the preset path, extruding the cell-bio-ink composite layer by layer. During the printing process, monitor the printing status in real time to observe whether the nozzle is clogged, whether the extrusion of the bio-ink is stable, and whether the model has deformation or displacement.

[0087] After printing, carefully remove the printing platform from the printer. In the ultra-clean bench, use sterile forceps and a blade to completely separate the support material with the skin model from the platform and transfer it to a cell culture dish.

[0088] Test Example 1

[0089] The epidermal cell skin models prepared in the examples and comparative examples were cultured until the third day, and the RNA of the cells in the models was extracted. The transcriptional expression of key genes in the cells of the models was detected by qRT-PCR method, which specifically included the following steps:

[0090] (1) Sample preparation

[0091] 1. Take out the 3D printed skin model from the culture environment and gently rinse it 2 - 3 times with pre-cooled PBS buffer to remove the residual culture medium and other impurities on the surface.

[0092] 2. Transfer the rinsed model to a 1.5 mL RNase-free centrifuge tube containing 1 mL of TRIzol reagent. To ensure the lysis effect, the model can be cut into small pieces as much as possible before putting it into the centrifuge tube. Subsequently, add an appropriate amount of stainless steel beads treated with DEPC water to the centrifuge tube (determined according to the size of the centrifuge tube and the sample volume, generally 2 - 3 beads).

[0093] 3. Put the centrifuge tube containing the sample, TRIzol reagent and stainless steel beads into the tissue disruptor. Set the parameters of the tissue disruptor, generally the frequency is 30 - 35 Hz, and the running time is 2 - 3 minutes. The stainless steel beads hit the sample through high-speed vibration to quickly break the 3D printed skin model and mix it fully with TRIzol reagent to achieve cell lysis. If the lysis effect is not good once, the number of disruptions can be appropriately increased, but it is necessary to pay attention to controlling the total time to avoid overheating of the sample.

[0094] (2) RNA extraction (using the TRIzol method)

[0095] 1. After disruption, take out the centrifuge tube and let it stand at room temperature for 5 minutes to ensure complete cell lysis and complete dissociation of the nucleic acid-protein complex.

[0096] 2. Add 200 μL of chloroform to the centrifuge tube, tighten the tube cap, shake vigorously for 15 seconds, and let it stand at room temperature for 2 - 3 minutes.

[0097] 3. Centrifuge at 12000 rpm for 15 minutes at 4°C. At this time, the mixture will be divided into three layers. The upper layer is a colorless and transparent aqueous phase (containing RNA), the middle layer is a white protein layer, and the lower layer is a red organic phase.

[0098] 4. Transfer the upper aqueous phase to a new 1.5 mL RNase-free centrifuge tube, being careful not to aspirate the middle and lower layers of liquid. Add an equal volume (about 500 μL) of isopropanol, gently invert and mix well, and let it stand at room temperature for 10 minutes to precipitate the RNA.

[0099] 5. Centrifuge at 4°C and 12,000 rpm for 10 minutes. A white RNA pellet will appear at the bottom of the centrifuge tube. Discard the supernatant, add 1 mL of 75% ethanol (prepared with DEPC water), and gently invert the tube to wash the RNA pellet 2 - 3 times.

[0100] 6. Centrifuge at 4°C and 7,500 rpm for 5 minutes. Discard the supernatant, invert the centrifuge tube onto a clean filter paper, and air-dry at room temperature for 5 - 10 minutes. Note that the RNA pellet should not be allowed to dry out completely, as this may affect subsequent dissolution.

[0101] 7. Add an appropriate amount of DEPC water to the centrifuge tube (usually 20 - 50 μL, determined according to the amount of pellet and subsequent experimental requirements), gently pipette to dissolve the RNA pellet, and heat in a water bath at 55 - 60°C for 10 minutes to promote RNA dissolution.

[0102] 8. Use a spectrophotometer or Nanodrop nucleic acid quantifier to measure the concentration and purity of the RNA. The A260 / A280 ratio should be between 1.8 - 2.0. If the ratio deviates from this range, the RNA needs to be further purified. At the same time, take a small amount of the RNA sample for agarose gel electrophoresis to detect the integrity of the RNA, and observe whether there are obvious 28S and 18S rRNA bands, and the brightness of the 28S band is approximately twice that of the 18S band.

[0103] (3) Reverse Transcription

[0104] According to the reverse transcription kit instructions, prepare the reverse transcription reaction system in a 0.2 mL RNase-free centrifuge tube as shown in Table 1 (taking a 20 μL system as an example). Gently mix the reaction system and briefly centrifuge to collect the liquid at the bottom of the tube. Place the centrifuge tube in a PCR instrument and perform the reverse transcription reaction according to the program recommended by the reverse transcription kit. The reaction program is shown in Table 2. After the reaction is completed, store the cDNA product on ice or at -20°C for later use.

[0105] Table 1

[0106]

[0107]

[0108] Table 2

[0109] Procedure Temperature Time Primer annealing 25℃ 5 minutes Reverse transcription reaction 37℃ 60 minutes Inactivate reverse transcriptase 85℃ 5 minutes

[0110] (4) Real-Time Fluorescent Quantitative PCR (qPCR)

[0111] According to the SYBR Green PCR Master Mix instructions, prepare the qPCR reaction system in a 96-well PCR plate or an eight-strip tube. The reaction system is shown in Table 3 (taking a 20 μL system as an example).

[0112] Table 3

[0113] Reagent name Dosage SYBR Green PCR Master Mix 10 μL Forward primer (10 μM) 0.5 μL Reverse primer (10 μM) 0.5 μL cDNA template X μL (Adjust the dilution factor according to the pre-experiment results, generally 1 - 5 μL) ROX Reference Dye 0.4 μL (If required by the qPCR instrument) <![CDATA[ddH2O]]> Make up to 20 μL

[0114] Reaction wells are set up, including standard curve wells (usually 5 - 6 standard products with different concentration gradients), sample wells (at least 3 replicates are set for each sample), and negative control wells (ddH2O is used to replace the cDNA template).

[0115] Add the prepared reaction system into the corresponding reaction wells, seal the PCR plate or octuplets with a sealing film, and gently centrifuge to make the liquid gather at the bottom of the tube to avoid generating bubbles.

[0116] Put the PCR plate or octuplets into a real - time fluorescence quantitative PCR instrument, and perform amplification according to the program in Table 4 for a total of 40 cycles.

[0117] Table 4

[0118]

[0119] After the reaction is completed, analyze the qPCR results, calculate the relative expression level of the target gene in the sample through the standard curve, use the 2^(-ΔΔCt) method for data processing, detect the transcriptional expression of TP63, ABCA12, and KLF4, and use housekeeping genes such as GAPDH as internal reference genes to correct the difference in the loading amount between different samples. TP63 is used to regulate tight junction proteins (such as Claudin - 1), ABCA12 is used to affect the epidermal barrier function and maintain the epithelial layer structure, and KLF4 is used to promote the maturation and differentiation of epidermal cells. The primer sequences are shown in Table 5, and the relative transcriptional expression levels of TP63, ABCA12, and KLF4 are shown in Table 6.

[0120] Table 5

[0121] SEQ ID NO. Primer name Primer sequence 1 GAPDH-F CAGGAGGCATTGCTGATGAT 2 GAPDH-R GAAGGCTGGGGCTCATTT 3 TP63-F ATGCTGACCGTACGATCGTA 4 TP63-R TCGATCGTACGATCGTACGA 5 ABCA12-F CGATCGTACGATCGTACGTA 6 ABCA12-R ATCGTACGATCGTACGATCG 7 KLF4-F TACGATCGTACGATCGTACG 8 KLF4-R CGTACGATCGTACGATCGTA

[0122] Table 6

[0123]

[0124]

[0125] It can be seen from Table 6 that:

[0126] (1) By comparing Example 1 with Comparative Example 1, it can be seen that the cell survival rate of the photocuring 3D volume printing technology used in the present invention is high, and the effect is significantly better than that of the ordinary 3D layer - by - layer printing method.

[0127] (2) Comparing Example 1 with Examples 4 - 5 shows that the modified gelatin GelMA has a three-dimensional structure more suitable for cell growth and differentiation, with better effects than unmodified gelatin and other types of modified gelatin.

[0128] (3) Comparing Example 1 with Example 6 shows that the ECM contains various components, providing a good growth environment for epidermal cells, with better effects than adding a single component.

[0129] (4) Comparing Example 1 with Examples 7 - 10 shows that by adding retinol, vitamin E, and EGF to the culture medium when culturing the epidermal cell model in the present invention, the transcriptional expression levels of the TP63, ABCA12, and KLF4 genes of the cells are all increased, and retinol, vitamin E, and EGF have a synergistic effect.

[0130] Test Example 2

[0131] In this test example, for the epidermal cell skin models prepared in Example 1 and Example 10, the cell morphology was observed under a microscope on the third day of culture, as Figure 1 shown. Most of the cells in Example 1 were normally spread out, while very few cells in Example 10 without retinol, vitamin E, and EGF were spread out, indicating that under the culture conditions of Example 1, the cell state of the skin model is better and the skin model is more stable.

[0132] Test Example 3

[0133] In this test example, the moisturizing effect of the cosmetic raw material nicotinamide was detected using the epidermal skin model provided in Example 1. The model was treated with 2% nicotinamide, and after 24 h, the transcriptional expression of the hyaluronic acid synthase (HAS2) and aquaporin (AQP3) genes in the model was detected by qRT-PCR. The specific steps refer to Test Example 1. HAS2 is used to regulate the production of hyaluronic acid, and AQP3 is used to promote the transmembrane transport of water. The primer sequences are shown in Table 7, and the relative transcriptional expression levels of HAS2 and AQP3 are as Figure 2 shown.

[0134] Table 7

[0135] SEQ ID NO. Primer name Primer sequence 1 GAPDH-F CAGGAGGCATTGCTGATGAT 2 GAPDH-R GAAGGCTGGGGCTCATTT 9 HAS2-F TGACGTACGATCGTACGAT 10 HAS2-R CGTACGATCGTACGATCGT 11 AQP3-F ATCGTACGATCGTACGATC 12 AQP3-R TACGATCGTACGATCGTAC

[0136] The results show that, compared with the control group, the transcriptional expression levels of the HAS2 and AQP3 genes of the cells in the skin model treated with 2% nicotinamide are both increased, indicating that the skin model can well detect the strong moisturizing ability of nicotinamide.

[0137] In summary, the present invention uses a bioink with a unique formulation, improves 3D printing technology, and prepares an epidermal cell skin model, providing an efficient, precise, and environmentally friendly innovative solution for the development of cosmetic raw materials.

[0138] The applicant declares that the above description is only a specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed by the present invention fall within the protection scope and the disclosure scope of the present invention.

Claims

1. A method for preparing a 3D printed epidermal cell skin model, characterized in that, The preparation method includes: mixing the bioink with a photoinitiator, then mixing with epidermal cells, and performing photocuring 3D volumetric printing to obtain the epidermal cell skin model.

2. The preparation method according to claim 1, characterized in that, The bioink contains modified gelatin and extracellular matrix; Preferably, the modified gelatin includes methacrylated gelatin and / or nanocellulose composite gelatin; Preferably, the extracellular matrix contains recombinant collagen, recombinant elastin, and recombinant fibronectin; Preferably, the extracellular matrix contains 0.1 - 1 mg / mL recombinant collagen, 0.1 - 1 mg / mL recombinant elastin, and 0.1 - 1 mg / mL recombinant fibronectin.

3. The preparation method according to claim 1 or 2, characterized in that, The bioink contains 1% - 4% w / v modified gelatin and 0.1% - 0.3% w / v extracellular matrix, and the balance is PBS buffer.

4. The preparation method according to any one of claims 1 to 3, characterized in that, The photoinitiator includes ruthenium initiator and / or sodium persulfate photoinitiator; Preferably, after the bioink is mixed with the photoinitiator, the mixed solution contains 0.2 - 0.3 mM ruthenium initiator and 1 - 4 mM sodium persulfate photoinitiator.

5. The preparation method according to any one of claims 1 to 4, characterized in that, After being mixed with epidermal cells, the concentration of epidermal cells is 1×10 6 ~3×10 6 cells / mL; Preferably, the epidermal cells include human immortalized epidermal cells.

6. The preparation method according to any one of claims 1 to 5, characterized in that, The preparation method further includes the step of culturing the epidermal cell skin model; Preferably, the culturing method includes: culturing the epidermal cell skin model in an epidermal cell culture medium containing retinol, vitamin E, and EGF.

7. The preparation method according to claim 6, characterized in that, The epidermal cell culture medium contains 0.1 - 10 μM retinol, 40 - 60 μM vitamin E, and 10 - 30 ng / mL EGF, and the balance is cell basal medium; Preferably, the cell basal medium includes DMEM complete medium.

8. A 3D printed epidermal cell skin model, characterized in that, The epidermal cell skin model is prepared by the preparation method according to any one of claims 1 - 7.

9. Use of the epidermal cell skin model according to claim 8 in the research and development of skin-contact products; Preferably, the skin-contact products include cosmetics or skin care products.

10. An evaluation method for the efficacy of raw materials of skin-contact products, characterized in that, The evaluation method includes: performing evaluation and detection using the epidermal cell skin model according to claim 8; Preferably, the evaluation and detection include any one or a combination of at least two of epidermal layer gene expression analysis, cell viability detection, or skin barrier function testing.