3D printed dermal cell skin model as well as preparation method and application thereof

Abstract

The invention relates to a 3D printed dermal cell skin model and a preparation method and application thereof. The preparation method comprises the steps that bio-ink and a photoinitiator are mixed, then the mixture is mixed with dermal cells, photocuring 3D volume printing is conducted, and the dermal cell skin model is prepared. A traditional layer-by-layer printing mode is abandoned, the photocuring 3D volume printing technology is adopted, the liquid photopolymer is cross-linked at the deep position of the resin barrel through multidirectional light projection, rapid curing of the whole volume is achieved, the printing speed is remarkably increased, the high-resolution and smoother surface effect is further provided, and the 3D printing device is suitable for 3D printing. And a more accurate platform is provided for testing of cosmetic raw materials.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to a 3D printed dermal cell skin model, its preparation method and application. Background Art

[0002] The skin is an organ that wraps the body surface, directly contacts the external environment, and has functions such as protection, excretion, body temperature regulation, and sensing external stimuli. It is the largest organ in the human body. The basic principle of 3D skin model construction technology is to isolate cells from tissues, culture and expand them in vitro, and then mix the expanded cells with biomaterials in a certain proportion so that the cells adhere and grow on the biomaterials to form a 3D skin model.

[0003] Currently, 3D skin models face many challenges and limitations in terms of technology, application, and industrialization. There are various construction methods for 3D skin models, lacking a unified standardized process, resulting in differences in the quality and performance of models produced by different laboratories or enterprises. Traditional construction methods are difficult to achieve high-throughput screening, restricting their large-scale application in drug development and cosmetic testing. In addition, although 3D skin models have made certain progress in simulating the in vivo environment, there are still significant differences compared with real skin, especially in terms of cell-cell interactions, immune responses, and drug metabolism.

[0004] In terms of industrialization, the production cost of 3D skin models is relatively high, especially in terms of biomaterials, cell culture, and equipment, which restricts their large-scale promotion. In addition, this field requires interdisciplinary professional knowledge, including biology, materials science, and engineering, and the shortage of relevant professional talents has become a major obstacle to the development of the industry. At the same time, the application of 3D skin models in drug and cosmetic testing needs to meet strict regulatory requirements, and the improvement of relevant regulations and the certification process are relatively complex.

[0005] Nevertheless, the development of 3D skin models still has broad prospects. Research and development of models containing multiple cell types and complex appendages, combining bio-3D printing and high-throughput technologies, as well as using artificial intelligence and machine learning to achieve dynamic monitoring and data analysis, will become important development directions. With the continuous progress of technology, these problems are expected to be gradually solved, thus promoting the wide application of 3D skin models in more fields.

[0006] In summary, providing a new type of 3D dermal cell skin model has become one of the urgent problems to be solved in the current field. Summary of the Invention

[0007] To solve the above technical problems, the present invention provides a 3D-printed dermal cell skin model, its preparation method and application. By combining 3D volumetric printing technology and modified bioink, a skin model with complex structures can be rapidly constructed for high-throughput screening of cosmetic raw materials with functions such as whitening, anti-wrinkle, and moisturizing.

[0008] To achieve this purpose, the present invention adopts the following technical solutions:

[0009] In the first aspect, the present invention provides a preparation method of a 3D-printed dermal cell skin model. The preparation method includes: mixing a bioink with a photoinitiator, then mixing with dermal cells, and performing photocuring 3D volumetric printing to obtain the dermal cell skin model.

[0010] The photocuring 3D volumetric printing technology (deep vat photocuring printing) adopted by the present invention abandons the traditional layer-by-layer printing method. By multi-directional light projection to crosslink the liquid photopolymer deep in the resin vat, rapid curing of the entire volume is achieved. This method not only significantly improves the printing speed (which can be completed within a few seconds), but also provides high resolution and a smoother surface effect, providing a more accurate platform for the testing of cosmetic raw materials.

[0011] Preferably, the bioink contains modified gelatin and extracellular matrix.

[0012] The modified gelatin used in the present invention can enhance cell adhesion and proliferation ability, improving the biocompatibility of the skin model. When using 3D printing technology to construct a 3D skin model with gelatin and skin cells, adding extracellular matrix proteins additionally can form a stable physical support framework and maintain the overall shape of the model, such as collagen, elastin that endows the skin with elasticity and flexibility and interweaves with collagen to construct a network with appropriate mechanical properties, and fibronectin that can connect cells to the extracellular matrix network to stabilize the model structure, provide adhesion sites for cells, guide cell migration, affect cell differentiation, bind growth factors to regulate their activity and release rate, and also affect cell metabolic activities, which plays a crucial role in model construction.

[0013] Preferably, the modified gelatin includes methacrylated gelatin and / or nanocellulose composite gelatin.

[0014] The methacrylated gelatin used in the present invention combines the characteristics of natural and synthetic biomaterials. It has a three-dimensional structure suitable for cell growth and differentiation, excellent biocompatibility and cell response characteristics, provides suitable cell adhesion sites and proteolytic degradability, and can replace artificial basement membranes. In addition, methacrylated gelatin hydrogel has good mechanical properties, and the 3D microscaffolds constructed by it have adjustable mechanical and chemical properties.

[0015] Preferably, the extracellular matrix contains recombinant collagen, recombinant elastin, and recombinant fibronectin.

[0016] In the present invention, an extracellular matrix containing composite components such as recombinant collagen, recombinant elastin, and recombinant fibronectin is used to prepare the bioink. Compared with a single protein component, multiple components simulate the cell growth environment and improve the survival rate of dermal cells.

[0017] Preferably, the extracellular matrix contains 0.1 - 1 mg / mL (such as 0.1 mg / mL, 0.3 mg / mL, 0.5 mg / mL, 0.7 mg / mL, 0.9 mg / mL, or 1 mg / mL, etc.) of recombinant collagen, 0.1 - 1 mg / mL (such as 0.1 mg / mL, 0.3 mg / mL, 0.5 mg / mL, 0.7 mg / mL, 0.9 mg / mL, or 1 mg / mL, etc.) of recombinant elastin, and 0.1 - 1 mg / mL (such as 0.1 mg / mL, 0.3 mg / mL, 0.5 mg / mL, 0.7 mg / mL, 0.9 mg / mL, or 1 mg / mL, etc.) of recombinant fibronectin.

[0018] Preferably, the bioink contains 1% - 4% (such as 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, or 4%, etc.) w / v of modified gelatin and 0.1% - 0.3% (such as 0.1%, 0.15%, 0.2%, 0.25%, or 0.3%, etc.) w / v of extracellular matrix, and the balance is PBS buffer.

[0019] Preferably, the photoinitiator includes a ruthenium initiator and / or a sodium persulfate photoinitiator.

[0020] Preferably, after the bioink is mixed with the photoinitiator, the mixed solution contains 0.2 - 0.3 mM (such as 0.2 mM, 0.22 mM, 0.24 mM, 0.25 mM, 0.26 mM, 0.28 mM, or 0.3 mM, etc.) of ruthenium initiator and 1 - 4 mM (such as 1 mM, 1.5 mM, 2 mM, 2.5 mM, 3 mM, 3.5 mM, or 4 mM, etc.) of sodium persulfate photoinitiator.

[0021] Preferably, after being mixed with dermal cells, the concentration of dermal cells is 1×10 6 ~3×10 6 cells / mL (such as 1×10 6 cells / mL, 1.5×10 6 cells / mL, 2×10 6 cells / mL, 2.5×10 6 cells / mL, or 3×10 6 cells / mL, etc.).

[0022] Preferably, the dermal cells include human dermal fibroblasts (HDF cells).

[0023] Preferably, the printing time of the photocuring 3D volume printing is 50-70 s (for example, it can be 50 s, 55 s, 60 s, 65 s or 70 s, etc.), the printing light intensity is 1-2 (for example, it can be 1, 1.2, 1.4, 1.5, 1.6, 1.8 or 2, etc.), the green light intensity is 50-70 (for example, it can be 50, 55, 60, 65 or 70, etc.), and the model obtained by printing is a disc with a thickness of 1-2 cm (for example, it can be 1 cm, 1.2 cm, 1.4 cm, 1.5 cm, 1.6 cm, 1.8 cm or 2 cm, etc.) and a diameter of 7-9 cm (for example, it can be 7 cm, 7.5 cm, 8 cm, 8.5 cm or 9 cm, etc.).

[0024] Preferably, the preparation method further includes the step of culturing the dermal cell skin model.

[0025] Preferably, the culturing method includes: placing the dermal cell skin model in a dermal cell culture medium containing bFGF and TGF-β for culturing.

[0026] The bFGF (basic fibroblast growth factor) used in the present invention has the function of activating the MAPK signaling pathway and promoting the proliferation and migration of fibroblasts, and TGF-β (transforming growth factor-β) has the function of promoting the synthesis of collagen (type I / III), elastin and fibronectin and inhibiting the activity of matrix metalloproteinases (MMPs). bFGF and TGF-β synergistically promote the growth of dermal cells in the dermal cell skin model.

[0027] Preferably, the dermal cell culture medium contains 5-20 ng / mL (for example, it can be 5 ng / mL, 7 ng / mL, 9 ng / mL, 10 ng / mL, 13 ng / mL, 15 ng / mL or 20 ng / mL, etc.) bFGF and 1-10 ng / mL (for example, it can be 1 ng / mL, 3 ng / mL, 5 ng / mL, 7 ng / mL, 9 ng / mL, 10 ng / mL, etc.) TGF-β, and the balance is the cell basal medium.

[0028] Preferably, the cell basal medium includes DMEM complete medium.

[0029] In a second aspect, the present invention provides a 3D printed dermal cell skin model, which is prepared by the preparation method described in the first aspect.

[0030] In a third aspect, the present invention provides the use of the dermal cell skin model as described in the second aspect in the research and development of skin-contact products.

[0031] Preferably, the skin-contact products include cosmetics or skin care products.

[0032] In a fourth aspect, the present invention provides a method for evaluating the efficacy of raw materials of skin-contact products, the evaluation method comprising: using the dermal cell skin model as described in the second aspect for evaluation and detection.

[0033] The present invention comprehensively evaluates the efficacy of cosmetic raw materials through multi-dimensional methods such as collagen gene expression analysis and cell viability detection. For example, the mild and non-irritating properties of the cosmetic raw material hyaluronic acid are detected using this dermal model.

[0034] Preferably, the skin-contact products include cosmetics or skin care products.

[0035] Preferably, the evaluation and detection include collagen gene expression analysis and / or cell viability detection.

[0036] Other specific point values within the above numerical ranges can be selected and will not be elaborated one by one here.

[0037] Compared with the prior art, the present invention has the following beneficial effects:

[0038] The present invention uses a bioink with a unique formulation to improve 3D printing technology and prepares a dermal cell skin model for high-throughput screening of cosmetic raw materials with whitening, anti-wrinkle, moisturizing and other effects, providing an efficient, accurate and environmentally friendly innovative solution for the development of cosmetic raw materials. The present invention can use this skin model to construct disease-specific skin models (such as photo-damage repair defect models), simulate specific pathological processes, and be used to screen and evaluate cosmetics or drugs with repair functions. It can also use this skin model for safety testing, more efficiently evaluate the cytotoxicity of cosmetic raw materials, and reduce the dependence on animal experiments. The present invention further optimizes the culture method of the dermal cell skin model, uses a combination of two cytokines, bFGF and TGF-β, and synergistically improves the in vitro culture effect of the dermal cell skin model. Description of the Drawings

[0039] Figure 1 It is a microscopic observation result diagram of the dermal cell skin model for Test Example 2.

[0040] Figure 2 It is a tissue fluorescence staining diagram for Test Example 3.

[0041] Figure 3 It is a tissue activity statistical diagram for Test Example 3. Detailed Embodiments

[0042] To further illustrate the technical means and effects of the present invention, the present invention is further described below in conjunction with the embodiments and drawings. It should be understood that the specific implementation methods described herein are only used to explain the present invention, rather than to limit the present invention.

[0043] If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the field or the product instructions are used. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.

[0044] The instruments and reagents used in the following examples are:

[0045] Light-curing 3D volume printer: purchased from Green Key Biotechnology Co., Ltd., product number is VBP-T200.

[0046] ECM (extracellular matrix): purchased from Best Pharmaceuticals (Guangzhou) Co., Ltd., its main components include 0.5 mg / mL recombinant collagen, 0.5 mg / mL recombinant elastin and 0.5 mg / mL recombinant fibronectin.

[0047] GelMA (methacryloyl gelatin): purchased from Green Key Biotech, product number GK-GM-01.

[0048] Ruthenium initiator and sodium persulfate photoinitiator: purchased from Green Key Biotechnology Company, product number is GK-PI-01.

[0049] DMEM complete medium: purchased from Gibco.

[0050] Example 1

[0051] This embodiment provides a method for preparing a 3D printed dermal cell skin model, comprising the following steps:

[0052] (1) Prepare a bio-ink, wherein the bio-ink contains 2.5% w / v GelMA and 0.2% w / v ECM, and the remainder is PBS buffer. Add a ruthenium initiator and a sodium persulfate photoinitiator, wherein the final concentration of the ruthenium initiator is 0.25 mM, and the final concentration of the sodium persulfate photoinitiator is 2.5 mM. After being fully mixed, the bio-ink is sterilized by filtering using a 10 mL syringe and a 0.22 μm filter membrane.

[0053] (2) Prepare HDF cell solution.

[0054] (3) Pipette 1.5 mL of filtered bio-ink and resuspend the HDF cells to adjust the HDF cell concentration to 2×10 6 / mL, mix thoroughly, transfer to a sterilized printing bottle, cover the bottle with a lid, and place it on ice to condense for 15 minutes.

[0055] (4) Set the printing parameters of the stereolithography 3D volumetric printer, with a printing time of 60 s, a printing light intensity of 1.5, and a green light intensity of 60. Take out the printing bottle from the ice, wipe the bottle body with an alcohol cotton pad, and place it on the turntable to start printing. Then, heat and melt it at 37 °C, and use sterile PBS to rinse away the uncrosslinked bioink and clean the printed model to obtain a disc model with a thickness of 1.5 cm and a diameter of 8 cm.

[0056] (5) Place the disc model in a 6-well plate for culture. The culture medium contains 10 ng / mL bFGF and 5 ng / mL TGF-β, and the balance is DMEM complete medium.

[0057] Example 2

[0058] This example provides a method for preparing a 3D printed dermal cell skin model, which includes the following steps:

[0059] (1) Prepare the bioink. The bioink contains 1% w / v GelMA and 0.3% w / v ECM, and the balance is PBS buffer. Add ruthenium initiator and sodium persulfate photoinitiator. The final concentration of the ruthenium initiator is 0.2 mM, and the final concentration of the sodium persulfate photoinitiator is 4 mM. After thorough mixing, filter and sterilize it using a 10 mL syringe and a 0.22 μm filter membrane.

[0060] (2) Prepare the HDF cell solution.

[0061] (3) Pipette 1.5 mL of the filtered bioink to resuspend the HDF cells, adjust the HDF cell concentration to 1×10 6 cells / mL. After thorough mixing, transfer it to a sterilized printing bottle, cover the lid, and place the printing bottle on ice for 15 min of condensation.

[0062] (4) Set the printing parameters of the stereolithography 3D volumetric printer, with a printing time of 60 s, a printing light intensity of 1.5, and a green light intensity of 60. Take out the printing bottle from the ice, wipe the bottle body with an alcohol cotton pad, and place it on the turntable to start printing. Then, heat and melt it at 37 °C, and use sterile PBS to rinse away the uncrosslinked bioink and clean the printed model to obtain a disc model with a thickness of 1.5 cm and a diameter of 8 cm.

[0063] (5) Place the disc model in a 6-well plate for culture. The culture medium contains 5 ng / mL bFGF and 10 ng / mL TGF-β, and the balance is DMEM complete medium.

[0064] Example 3

[0065] This example provides a method for preparing a 3D printed dermal cell skin model, which includes the following steps:

[0066] (1) Prepare the bioink. The bioink contains 4% w / v GelMA and 0.1% w / v ECM, with the balance being PBS buffer. Add ruthenium initiator and sodium persulfate photoinitiator. The final concentration of ruthenium initiator is 0.3 mM, and the final concentration of sodium persulfate photoinitiator is 1 mM. After thorough mixing, filter and sterilize using a 10 mL syringe and a 0.22 μm filter membrane.

[0067] (2) Prepare the HDF cell solution.

[0068] (3) Pipette 1.5 mL of the filtered bioink to resuspend the HDF cells, adjust the HDF cell concentration to 3×10 6 cells / mL. After thorough mixing, transfer it to a sterilized printing bottle, cover the lid, place the printing bottle on ice, and condense for 15 min.

[0069] (4) Set the printing parameters of the photocuring 3D volumetric printer. The printing time is 60 s, the printing light intensity is 1.5, and the green light intensity is 60. Take out the printing bottle from the ice, wipe the bottle body with an alcohol cotton pad, and place it on the turntable to start printing. Then, heat and melt at 37°C, and use sterile PBS to rinse off the uncrosslinked bioink and clean the printed model to obtain a disc model with a thickness of 1.5 cm and a diameter of 8 cm.

[0070] (5) Place the disc model in a 6-well plate for culture. The culture medium contains 20 ng / mL bFGF and 1 ng / mL TGF-β, with the balance being DMEM complete medium.

[0071] Example 4

[0072] This example provides a method for preparing a 3D printed dermal cell skin model, which is different from Example 1 only in that GelMA in the bioink is replaced with an equal amount of gelatin.

[0073] Example 5

[0074] This example provides a method for preparing a 3D printed dermal cell skin model, which is different from Example 1 only in that GelMA in the bioink is replaced with an equal amount of nanocellulose composite gelatin.

[0075] Example 6

[0076] This example provides a method for preparing a 3D printed dermal cell skin model, which is different from Example 1 only in that ECM in the bioink is replaced with an equal amount of collagen.

[0077] Example 7

[0078] This example provides a method for preparing a 3D printed dermal cell skin model, which is only different from Example 1 in that bFGF in the culture medium is replaced with an equal amount of TGF-β.

[0079] Example 8

[0080] This example provides a method for preparing a 3D printed dermal cell skin model, which is only different from Example 1 in that TGF-β in the culture medium is replaced with an equal amount of bFGF.

[0081] Example 9

[0082] This example provides a method for preparing a 3D printed dermal cell skin model, which is only different from Example 1 in that neither bFGF nor TGF-β is added to the culture medium.

[0083] Comparative Example 1

[0084] This comparative example provides a method for preparing a 3D printed dermal cell skin model, which is only different from Example 1 in that the 3D printing method is layer-by-layer 3D printing, and specifically includes the following steps:

[0085] Use a Stratasys J35 Pro bio-printer, set the printing speed to 3 - 8 mm / s to ensure smooth extrusion and model accuracy; adjust the extrusion pressure between 10 - 50 kPa according to the viscosity of the bio-ink, with higher viscosity corresponding to higher pressure; set the layer thickness to 80 - 150 μm to form a tightly fitting and structurally stable layered model; set the row spacing to 0.8 - 1.2 times the layer thickness to ensure good fusion of each layer.

[0086] Import the three-dimensional structure design file of the skin model into the printer software, and the software will parse the model into a layer-by-layer printing path. Start the printing program, and the printer nozzle moves along the preset path, extruding the cell-bio-ink composite layer by layer. During the printing process, monitor the printing status in real time to observe whether the nozzle is blocked, whether the extrusion of the bio-ink is stable, and whether the model has deformation or displacement.

[0087] After printing is completed, carefully remove the printing platform from the printer. In a laminar flow hood, use sterile forceps and a scalpel to completely separate the support material with the skin model from the platform and transfer it to a cell culture dish.

[0088] Test Example 1

[0089] Cultivate the dermal cell skin models prepared in the examples and comparative examples until the third day, extract the RNA of the cells in the models, and use the qRT-PCR method to detect the transcriptional expression of key genes in the cells in the models. Specifically, it includes the following steps:

[0090] (1) Sample preparation

[0091] 1. Take out the 3D printed skin model from the culture environment and gently rinse it 2 - 3 times with pre - cooled PBS buffer to remove residual culture medium and other impurities on the surface.

[0092] 2. Transfer the rinsed model to a 1.5 mL RNase - free centrifuge tube containing 1 mL of TRIzol reagent. To ensure the lysis effect, the model can be cut into small pieces as much as possible before putting it into the centrifuge tube. Subsequently, add an appropriate amount of stainless steel beads treated with DEPC water (determined according to the size of the centrifuge tube and the sample volume, generally 2 - 3 beads) to the centrifuge tube.

[0093] 3. Put the centrifuge tube containing the sample, TRIzol reagent and stainless steel beads into a tissue disruptor. Set the parameters of the tissue disruptor. Generally, the frequency is 30 - 35 Hz and the running time is 2 - 3 minutes. Through high - speed vibration, the stainless steel beads impact the sample to quickly break the 3D printed skin model and fully mix it with TRIzol reagent to achieve cell lysis. If the lysis effect is not good in one time, the number of disruptions can be appropriately increased, but attention should be paid to controlling the total time to avoid overheating of the sample.

[0094] (2) RNA extraction (using the TRIzol method)

[0095] 1. After disruption, take out the centrifuge tube and let it stand at room temperature for 5 minutes to ensure complete cell lysis and complete dissociation of nucleic acid - protein complexes.

[0096] 2. Add 200 μL of chloroform to the centrifuge tube, tighten the tube cap, shake vigorously for 15 seconds, and let it stand at room temperature for 2 - 3 minutes.

[0097] 3. Centrifuge at 12000 rpm for 15 minutes at 4 °C. At this time, the mixture will be divided into three layers: the upper layer is a colorless and transparent aqueous phase (containing RNA), the middle layer is a white protein layer, and the lower layer is a red organic phase.

[0098] 4. Transfer the upper aqueous phase to a new 1.5 mL RNase - free centrifuge tube. Be careful not to aspirate the middle and lower layers of liquid. Add an equal volume (about 500 μL) of isopropanol, gently invert and mix well, and let it stand at room temperature for 10 minutes to precipitate RNA.

[0099] 5. Centrifuge at 12000 rpm for 10 minutes at 4 °C. A white RNA precipitate will appear at the bottom of the centrifuge tube. Discard the supernatant, add 1 mL of 75% ethanol (prepared with DEPC water), and gently invert to wash the RNA precipitate 2 - 3 times.

[0100] 6. Centrifuge at 7500 rpm for 5 minutes at 4 °C, discard the supernatant, invert the centrifuge tube on a clean filter paper, and air - dry at room temperature for 5 - 10 minutes. Note that the RNA precipitate should not be dried too much to avoid affecting subsequent dissolution.

[0101] 7. Add an appropriate amount of DEPC water to the centrifuge tube (usually 20 - 50 μL, determined according to the amount of precipitate and subsequent experimental requirements), gently pipette to dissolve the RNA precipitate, and heat in a water bath at 55 - 60 °C for 10 minutes to promote RNA dissolution.

[0102] 8. Use a spectrophotometer or Nanodrop nucleic acid quantifier to measure the concentration and purity of RNA. The A260 / A280 ratio should be between 1.8 - 2.0. If the ratio deviates from this range, RNA needs to be further purified. Meanwhile, take a small amount of RNA sample for agarose gel electrophoresis to detect the integrity of RNA, and observe whether there are obvious 28S and 18S rRNA bands, and the brightness of the 28S band is about twice that of the 18S band.

[0103] (3) Reverse transcription

[0104] According to the reverse transcription kit instructions, prepare the reverse transcription reaction system in a 0.2 mL RNase - free centrifuge tube as shown in Table 1 (taking a 20 μL system as an example). Gently mix the reaction system and briefly centrifuge to collect the liquid at the bottom of the tube. Place the centrifuge tube in a PCR instrument and perform the reverse transcription reaction according to the program recommended by the reverse transcription kit. The reaction program is shown in Table 2. After the reaction, store the cDNA product on ice or at - 20 °C for later use.

[0105] Table 1

[0106] Reagent Name Dosage 5× Reverse Transcription Buffer 4 μL dNTPs 2 μL Reverse Transcriptase 1 μL RNase Inhibitor 1 μL RNA Template X μL (Adjust the volume according to RNA concentration, generally 1 - 2 μg RNA) DEPC Water Make up to 20 μL

[0107] Table 2

[0108] Procedure Temperature Time Primer Annealing 25℃ 5 minutes Reverse Transcription Reaction 37℃ 60 minutes Inactivate Reverse Transcriptase 85℃ 5 minutes

[0109] (4) Real - time fluorescence quantitative PCR (qPCR)

[0110] According to the SYBR Green PCR Master Mix instructions, prepare the qPCR reaction system in a 96 - well PCR plate or an eight - strip tube. The reaction system is shown in Table 3 (taking a 20 μL system as an example).

[0111] Table 3

[0112] Reagent Name Dosage SYBR Green PCR Master Mix 10 μL Forward Primer (10 μM) 0.5 μL Reverse Primer (10 μM) 0.5 μL cDNA Template X μL (Adjust the dilution factor according to the pre - experiment results, generally 1 - 5 μL) ROX Reference Dye 0.4 μL (if required by the qPCR instrument) <![CDATA[ddH2O]]> Make up to 20 μL

[0113] Set up the reaction wells, including standard curve wells (usually set 5 - 6 standard products with different concentration gradients), sample wells (set at least 3 replicates for each sample), and negative control wells (using ddH2O instead of cDNA template).

[0114] Add the prepared reaction system to the corresponding reaction wells, seal the PCR plate or eight - strip tube with a sealing film, and gently centrifuge to collect the liquid at the bottom of the tube, avoiding the generation of bubbles.

[0115] Place the PCR plate or eight-well strip tube into a real-time fluorescence quantitative PCR instrument and perform amplification according to the procedure in Table 4 for a total of 40 cycles.

[0116] Table 4

[0117] Procedure Temperature Time Pre - denaturation 95℃ 30 seconds Denaturation 95℃ 5 seconds Annealing Extension and Collect Fluorescence Signal 60℃ 30 seconds

[0118] After the reaction is completed, analyze the qPCR results, calculate the relative expression levels of the target genes in the samples through the standard curve, perform data processing using the 2^(-ΔΔCt) method, detect the transcriptional expression of LAMB3, BMP4, and WNT5A, and use housekeeping genes such as GAPDH as internal reference genes to correct the differences in the loading amounts between different samples. LAMB3 is used to maintain the adhesion of dermal cells, BMP4 is used to regulate the activity of dermal fibroblasts and collagen synthesis, and WNT5A is used to participate in the development and homeostasis maintenance of the dermis. The primer sequences are shown in Table 5, and the relative transcriptional expression levels of LAMB3, BMP4, and WNT5A are shown in Table 6.

[0119] Table 5

[0120] SEQ ID NO. Primer Name Primer Sequence 1 GAPDH - F CAGGAGGCATTGCTGATGAT 2 GAPDH - R GAAGGCTGGGGCTCATTT 3 LAMB3 - F TCGGGTAGAGGAGGTGCG 4 LAMB3 - R AGTAGCGGAAGGTACACTGGAG 5 BMP4 - F AGTTTGTGCTCGGTGATACCTT 6 BMP4 - R ATCGGGGATGTCTGAGGG 7 WNT5A - F GCTTTGATAGCGAGCGTACC 8 WNT5A - R CTGCTTCTTCCTCCCTCGAG

[0121] Table 6

[0122]

[0123] It can be seen from Table 6 that:

[0124] (1) By comparing Example 1 with Comparative Example 1, it can be seen that the cell viability of the photocurable 3D volumetric printing technology used in the present invention is high, and the effect is significantly better than that of the ordinary 3D layer-by-layer printing method.

[0125] (2) By comparing Example 1 with Examples 4-5, it can be seen that the modified gelatin GelMA has a three-dimensional structure more suitable for cell growth and differentiation, and the effect is better than that of unmodified gelatin and other types of modified gelatin.

[0126] (3) By comparing Example 1 with Example 6, it can be seen that the ECM contains multiple components, providing a good growth environment for dermal cells, and its effect is better than adding a single component.

[0127] (4) By comparing Example 1 with Examples 7-9, it can be seen that by adding bFGF and TGF-β to the culture medium when culturing the dermal cell model, the transcriptional expression levels of the LAMB3, BMP4, and WNT5A genes of the cells are all increased, and bFGF and TGF-β have a synergistic effect.

[0128] Test Example 2

[0129] In this test example, the dermocyte skin models prepared in Example 1 and Example 9 were observed under a microscope on the third day of culture for cell morphology. As Figure 1 shown, most of the cells in Example 1 were normally unfolded, while only some cells in Example 9 without cytokines were unfolded, indicating that under the culture conditions of Example 1, the cell state of the skin model was better.

[0130] Test Example 3

[0131] This test example uses this dermis skin model to detect whether cosmetic raw materials are irritating. In the research and development process of cosmetics, skin care products and other products that come into contact with the skin, the mild and non-irritating characteristics of raw materials are crucial. Using the skin model for tissue viability detection can simulate the reaction of human skin to raw materials in vitro and provide an important basis for evaluating the safety of raw materials. Using the skin model to detect the mild and non-irritating efficacy of specific raw materials can accurately evaluate the impact of the raw material to be detected on the tissue viability of the skin model and determine whether it has mild and non-irritating characteristics.

[0132] Experimental method: Use the dermis skin model provided in Example 1 to detect whether hyaluronic acid is mild and non-irritating. The experimental group was treated with 10 μg / mL of hyaluronic acid, the positive control group was treated with 5 mM of salicylic acid, and the blank control group was not treated. After culturing for two days, the Calcein-AM / PI double staining kit (Yeasen Biotech, product number 40747ES76) was used to detect tissue activity, and a high-throughput fluorescence microscope was used to take pictures and record the fluorescence staining of the entire model. Calculate the tissue activity of each group = OD 490 / (OD 490 +OD 545 ), and draw a bar chart.

[0133] The results of tissue fluorescence staining are as Figure 2 shown, and the bar chart of tissue activity of each group is as Figure 3 shown. The results show that the tissue activity of the model in the positive control group was significantly lower than that in the blank control group, and there was no significant difference in the tissue activity of the model in the experimental group and the blank control group, indicating that 10 μg / mL of hyaluronic acid has mild and non-irritating characteristics.

[0134] In summary, the present invention uses a bioink with a unique formula to improve 3D printing technology and prepares a dermocyte skin model, providing an efficient, accurate and environmentally friendly innovative solution for the development of cosmetic raw materials.

[0135] The applicant declares that the above is only the specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed by the present invention fall within the protection scope and the disclosure scope of the present invention.

Claims

1. A method for preparing a 3D printed dermal cell skin model, characterized in that, The preparation method includes: mixing the bioink with a photoinitiator, then mixing with dermal cells, and performing photocuring 3D volumetric printing to obtain the dermal cell skin model.

2. The preparation method according to claim 1, characterized in that, The bioink contains modified gelatin and extracellular matrix; Preferably, the modified gelatin includes methacrylated gelatin and / or nanocellulose composite gelatin; Preferably, the extracellular matrix contains recombinant collagen, recombinant elastin, and recombinant fibronectin; Preferably, the extracellular matrix contains 0.1 - 1 mg / mL recombinant collagen, 0.1 - 1 mg / mL recombinant elastin, and 0.1 - 1 mg / mL recombinant fibronectin.

3. The preparation method according to claim 1 or 2, characterized in that, The bioink contains 1% - 4% w / v modified gelatin and 0.1% - 0.3% w / v extracellular matrix, with the balance being PBS buffer.

4. The preparation method according to any one of claims 1 to 3, characterized in that, The photoinitiator includes ruthenium initiator and / or sodium persulfate photoinitiator; Preferably, after the bioink is mixed with the photoinitiator, the mixed solution contains 0.2 - 0.3 mM ruthenium initiator and 1 - 4 mM sodium persulfate photoinitiator.

5. The preparation method according to any one of claims 1 to 4, characterized in that After being mixed with dermal cells, the concentration of dermal cells is 1×10 6 ~3×10 6 cells / mL; Preferably, the dermal cells include human dermal fibroblasts.

6. The preparation method according to any one of claims 1 to 5, characterized in that, The preparation method further includes the step of culturing the dermal cell skin model; Preferably, the culturing method includes: culturing the dermal cell skin model in a dermal cell culture medium containing bFGF and TGF-β.

7. The preparation method according to claim 6, wherein The dermal cell culture medium contains 5 - 20 ng / mL bFGF and 1 - 10 ng / mL TGF-β, with the balance being a cell basal medium; Preferably, the cell basal medium includes DMEM complete medium.

8. A 3D printed dermal cell skin model, characterized in that, The dermal cell skin model is prepared by the preparation method according to any one of claims 1 - 7.

9. Use of the dermal cell skin model according to claim 8 in the research and development of skin-contact products; Preferably, the skin-contact products include cosmetics or skin care products.

10. An evaluation method for the efficacy of raw materials of skin-contact products, characterized in that, The evaluation method includes: using the dermal cell skin model according to claim 8 for evaluation and detection; Preferably, the evaluation and detection include collagen gene expression analysis and / or cell viability detection.

Images