Novel glycosyl transferase mutant and application thereof in synthesis of L-menthol-beta-glucoside

Abstract

The invention relates to the technical field of genetic engineering, in particular to a novel glycosyl transferase mutant and application thereof in synthesis of L-menthol-beta-glucoside. The novel glycosyl transferase mutant is subjected to the following mutations on an amino acid sequence as shown in SEQ ID NO.2: alanine at the 76th site is mutated into aspartic acid, and valine at the 108th site is mutated into leucine. According to the novel glycosyl transferase mutant provided by the invention, the catalytic rate and the conversion rate of catalytic synthesis of L-menthol-beta-glucoside can be greatly improved, and efficient production of L-menthol-beta-glucoside is realized after coupling reaction is subjected to condition optimization. Whole-cell catalysis is carried out in a 1L system under optimized reaction conditions, and the yield of the L-menthol-beta-glucoside can be up to 154.84 mM when the reaction is carried out for 96 hours. Furthermore, an L-menthol-beta-glucoside sample with the purity of 99% can be obtained through HPLC (High Performance Liquid Chromatography) and NMR (Nuclear Magnetic Resonance) verification by using the separation and purification method disclosed by the invention.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and specifically relates to a novel glycosyltransferase mutant and its application in the synthesis of L-menthol-β-glucoside. Background Art

[0002] Menthol is a monoterpenol widely present in various plants and has multiple stereoisomers. Among them, the naturally occurring one is mainly L-menthol. Due to its unique physical and chemical properties, L-menthol is widely used in the pharmaceutical field, food and beverage industries, cosmetics and daily necessities industries, and tobacco industry. However, L-menthol has problems such as low water solubility (0.44 g / L), easy volatility, and inherent odor, which limit its application in certain specific fields. In recent years, monoterpene glycoside compounds, as storage-stable, odorless pre-aromas and water-soluble molecules that decompose into their respective aromatic substances under controllable chemical reaction conditions, have attracted the attention of various researchers.

[0003] As a glycosylated derivative of L-menthol, the core advantages of L-menthol-β-glucoside are to improve water solubility (18.1 g / L), reduce volatilization loss, avoid odor interference, and achieve precise release through an environmental response mechanism, thereby breaking through the application bottleneck of traditional menthol and promoting the development of cross-field functional products. For example, in medicine, it can improve drug delivery and sustained-release effects; in the food industry, it can achieve high-temperature tolerance and flavor controlled release; in personal care products, it can design long-lasting cooling formulations or aqueous systems; in agriculture, it can develop long-lasting insect repellents; in industrial materials, it can embed heat-stable antibacterial components; and in emerging fields such as e-liquid stabilization and active packaging of electronic cigarettes.

[0004] The synthesis of natural glycosides and pilot-scale batch production mostly rely on uridine diphosphate glycosyltransferases. It has been reported that MpMUGT from Mentha piperita, UGT93Y1 from Camellia sinensis, and BlYjiC from Bacillus licheniformis can catalyze the β-glycosylation of L-menthol. The first two glycosyltransferases are of plant origin and face difficulties in heterologous expression in industrial applications, while the catalytic efficiency of BlYjiC is difficult to meet the requirements of industrial production. Uridine diphosphate glycosyltransferases catalyze glycosylation reactions that require the consumption of sugar nucleotides (such as UDPG) as glycosyl donors, and sugar nucleotides are usually expensive and not easily obtained in large quantities. Summary of the Invention

[0005] The present invention aims to overcome the defects in the prior art that the catalytic synthesis rate and conversion rate of L-menthol-β-glucoside are relatively low, and the production cost using sugar nucleotides as glycosyl donors is relatively high, and provides a novel glycosyltransferase mutant and its application in the synthesis of L-menthol-β-glucoside to overcome the above defects.

[0006] To achieve the object of the above invention, the present invention is realized through the following technical solutions: In a first aspect, the present invention discloses a novel glycosyltransferase mutant, which has the following mutations in the amino acid sequence shown in SEQ ID NO.2: alanine at position 76 is mutated to aspartic acid, and valine at position 108 is mutated to leucine; The amino acid sequence of the novel glycosyltransferase mutant is as shown in SEQ ID NO.6.

[0007] Based on the wild-type glycosyltransferase BsYjiC derived from Bacillus subtilis, the present invention carried out iterative mutations at two amino acid sites, and obtained the above novel glycosyltransferase mutant that can efficiently catalyze the glycosylation modification of L-menthol. The nucleotide sequence of the wild-type glycosyltransferase BsYjiC is as shown in SEQ ID NO.1, and the amino acid sequence is as shown in SEQ ID NO.2.

[0008] In a second aspect, the present invention also discloses a polynucleotide encoding the above novel glycosyltransferase mutant, and the nucleotide sequence of the polynucleotide is as shown in SEQ ID NO.5. In subsequent experiments of the present invention, first, alanine at position 76 of the amino acid sequence of the wild-type glycosyltransferase BsYjiC was mutated to aspartic acid to obtain BsYjiC-M1 (the nucleotide sequence is as shown in SEQ ID NO.3, and the amino acid sequence is as shown in SEQ ID NO.4), and then valine at position 108 of BsYjiC-M1 was mutated to leucine to obtain BsYjiC-M2 (the nucleotide sequence is as shown in SEQ ID NO.5, and the amino acid sequence is as shown in SEQ ID NO.6), which is the novel glycosyltransferase mutant of the present invention.

[0009] In a third aspect, the present invention also discloses a recombinant vector carrying the nucleotide sequence as claimed in claim 2.

[0010] In a fourth aspect, the present invention also discloses a genetically engineered bacterium containing the above nucleotide sequence or the above recombinant vector.

[0011] In a fifth aspect, the present invention also discloses the application of the above novel glycosyltransferase mutant in the biocatalytic glycosylation modification of L-menthol.

[0012] In a sixth aspect, the present invention also discloses the application of the above genetically engineered bacterium in the catalytic synthesis of L-menthol-β-glucoside.

[0013] In a seventh aspect, the present invention also discloses a method for synthesizing L-menthol-β-glucoside, comprising the following steps: using sucrose as a glycosyl donor, L-menthol as a substrate, and the novel glycosyltransferase mutant described in claim 1 or the genetically engineered bacterium described in claim 4 as a glycosyltransferase, which together with sucrose synthase plays a biocatalytic role to carry out a catalytic reaction to obtain L-menthol-β-glucoside.

[0014] Further, the amino acid sequence of the sucrose synthase is as shown in SEQ ID NO.8.

[0015] Furthermore, the addition ratio of the glycosyltransferase to the sucrose synthase is 1:3 to 5.

[0016] Further, the above method for synthesizing L-menthol-β-glucoside further comprises an operation for separating and purifying the catalytic product, comprising the following steps: S1. Centrifuge the catalytic product and collect the supernatant, concentrate it by rotary evaporation, cool it for crystallization to obtain solid crystals; S2. Wash the solid crystals with ice water, dry them, and extract them with ethyl acetate; S3. Combine the organic phases, remove the organic phases by rotary evaporation again, redissolve with water, cool for crystallization, and filter to obtain purified L-menthol-β-glucoside.

[0017] Therefore, the present invention has the following beneficial effects: (1) The present invention obtains a novel glycosyltransferase mutant through site-directed mutagenesis technology, couples it with sucrose synthase for the preparation of L-menthol-β-glucoside, and uses sucrose as a glycosyl donor, effectively reducing the production cost. (2) The novel glycosyltransferase mutant provided by the present invention can greatly improve the catalytic rate and conversion rate of catalytic synthesis of L-menthol-β-glucoside, and high-efficiency production of L-menthol-β-glucoside is achieved after optimization of the coupling reaction conditions. (3) Using the optimized reaction conditions, whole-cell catalysis is carried out in a 1L system. When the reaction is carried out for 96 h, the yield of L-menthol-β-glucoside can reach up to 154.84 mM at most. Further using the separation and purification method disclosed by the present invention and verifying through HPLC and NMR, it is proved that an L-menthol-β-glucoside sample with a purity of 99% can be obtained. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 It is a schematic diagram of the temperature stability of the novel glycosyltransferase mutant and sucrose synthase of the present invention.

[0019] Figure 2 It is a schematic diagram of the influence of different pH values on the activities of the novel glycosyltransferase mutant and sucrose synthase.

[0020] Figure 3 Schematic diagram of the influence of different pH values on the cascade reaction.

[0021] Figure 4 Schematic diagram of the influence of different ratios of glycosyltransferase to sucrose synthase on the cascade reaction.

[0022] Figure 5 Schematic diagram of the influence of different total amounts of added bacterial cells on the cascade reaction.

[0023] Schematic diagram of the synthesis of L-menthol-β-glucoside by cascade reaction in a 61 L system.

[0024] Figure 7 Actual photo of purified L-menthol-β-glucoside.

[0025] Figure 8 HPLC analysis chart of purified L-menthol-β-glucoside.

[0026] Figure 9 13C NMR spectrum of purified L-menthol-β-glucoside.

[0027] Figure 10 1H NMR spectrum of purified L-menthol-β-glucoside. Detailed implementation manners

[0028] The present invention will be further described below in conjunction with specific embodiments. Those of ordinary skill in the art will be able to implement the present invention based on these descriptions. In addition, the embodiments of the present invention referred to in the following description are generally only a part of the embodiments of the present invention, rather than all of the embodiments. Therefore, all other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the scope of protection of the present invention.

[0029] Example 1: Construction of a recombinant engineering bacterium expressing a novel glycosyltransferase mutant Referring to the amino acid sequence of the glycosyltransferase from Bacillus subtilis reported in the NCBI database (NCBI accession number: NP_389104.1), it was handed over to a gene synthesis company (Suzhou Genewiz Biotechnology Co., Ltd.). After codon optimization, the glycosyltransferase-encoding gene was artificially synthesized (the nucleotide sequence is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2), and cloned between Ndel / Xhol of the expression vector pET-28a(+), obtaining the recombinant plasmid pET-28a(+)-BsYjiC-WT. The recombinant plasmid pET-28a(+)-BsYjiC-WT was amplified by PCR using the primers shown in Table 1 to obtain the recombinant plasmid pET-28a(+)-BsYjiC-M1. The PCR reaction system was: 20 μL ddH2O, 25 μL 2×Phanta Flash Master Mix, 2 μL upstream primer, 2 μL downstream primer, and 1 μL template. Table 1 PCR primers for constructing BsYjiC-M1 Primer (5’-3’) pET-28a(+)-BsYjiC-M1-F <![CDATA[CGAAATGATGGAAAAAAACGAT GAC CCGCTGAGCCTG]]> pET-28a(+)-BsYjiC-M1-R ATCGTTTTTTTCCATCATTTCGCGAATCTGTTTC

[0030] The recombinant plasmid pET-28a(+)-BsYjiC-M1 was amplified by PCR using the primers shown in Table 2 to obtain the recombinant plasmid pET-28a(+)-BsYjiC-M2. The PCR reaction system was: 20 μL ddH2O, 25 μL 2×Phanta Flash MasterMix, 2 μL upstream primer, 2 μL downstream primer, and 1 μL template. Table 2 PCR primers for constructing BsYjiC-M2

[0031] The recombinant plasmid was transformed into the expression host E. coli BL21(DE3). The specific operation was as follows: Take 2 μL of the recombinant plasmid and add it to 100 μL of E. coli BL21(DE3) competent cells. Flick the tube wall several times to mix evenly, and place it in an ice-water bath for 30 min. Heat shock at 42 °C for 45 s and incubate in ice water for 3 min. Add 900 μL of LB medium without antibiotics and incubate at 37 °C for 60 min to recover its resistance. Centrifuge at 5000 rpm for 2 min to concentrate the bacteria to 100 μL, and evenly spread it on an LB plate containing 50 μg / mL kanamycin. Invert the plate and culture it overnight at 37 °C.

[0032] Identification of positive clone transformants: On the plate with recombinants, directly pick 6 single colonies into the LB liquid medium containing 50 μg / mL kanamycin, and culture overnight at 37°C. Use the SanPrep column plasmid extraction kit of Sangon Biotech (Shanghai) Co., Ltd. to extract the plasmid, and verify by enzyme digestion and sequencing. Finally, obtain the positive clone containing the recombinant plasmid.

[0033] Example 2: Construction of a recombinant engineering bacterium expressing sucrose synthase Refer to the mutant (V148S / K769H) of sucrose synthase NmSuSy (NCBI accession number: WP_011381564.1) from Nitrosospira multiformis reported by Zhao et al. It was handed over to a gene synthesis company (Genewiz Suzhou Co., Ltd.). After codon optimization, the coding gene was artificially synthesized (the nucleotide sequence is shown in SEQ ID NO.7, and the amino acid sequence is shown in SEQ ID NO.8), and cloned between NdeI / XhoI of the expression vector pET-28a(+), obtaining the recombinant plasmid pET-28a(+)-NmSuSy. The recombinant plasmid was transformed into the expression host E. coli BL21(DE3).

[0034] Example 3: Fermentation preparation of glycosyltransferase and sucrose synthase Inoculate the glycosyltransferase or sucrose synthase recombinant engineering bacteria described in Examples 1 and 2 on the LB liquid medium containing 50 μg / mL kanamycin for resuscitation. After culturing overnight for 10 h in a shaker at 37°C and 200 rpm, transfer to the LB liquid medium containing 50 μg / mL kanamycin at an inoculation amount of 5% (v / v), and culture in a shaker at 37°C and 200 rpm for 3 h; inoculate at an inoculation amount of 5% (v / v) into the fermentation medium containing 50 mg / L kanamycin, culture at 37°C for 5 h, then lower the fermentation temperature (24°C for glycosyltransferase and 16°C for sucrose synthase), and supplement glycerol (containing 2% MgSO4·7H2O, w / v) at a rate of 4.5 g / h of the starting fermentation medium. The total amount of glycerol supplemented during the whole fermentation cycle is about 70 g. Maintain the pH at 6.8 - 7.0 by automatically adding ammonia water. After 1 h of supplementing glycerol, lower the temperature to the induction required temperature (24°C for UGT and 16°C for SuSy), and supplement lactose at a constant speed of 6 g / h to induce enzyme production. The total amount of lactose supplemented is about 60 g. The fermentation cycle is 21 h, and finally obtain the glycosyltransferase fermentation broth or sucrose synthase fermentation broth.

[0035] Example 4: Comparison of catalytic efficiency between the novel glycosyltransferase mutant and the wild type Furthermore, the cells in the fermentation broth were disrupted by high-pressure homogenization. After centrifuging the disrupted broth, the supernatant was taken, and nickel column was used to separate and purify the glycosyltransferase or sucrose synthase in the supernatant. The purification steps were as follows: After fully suspending the nickel column and placing it at room temperature, it was washed with 10 column volumes of equilibration buffer and set aside; the supernatant of the disrupted broth was loaded at a volume of 5 column volumes. After loading, the column was slowly rotated in an environment at 4°C for 1 h for adsorption; after completion, the column was placed vertically until the gel completely settled, and then the loading waste liquid was drained into a clean collection tube. First, the column was washed with 10 column volumes of washing buffer, and then the target protein was eluted with 10 column volumes of elution buffer. A part of it was collected and detected by SDS-PAGE for the target protein; the eluted protein was dialyzed against phosphate buffer solution to remove salts.

[0036] The kinetic parameters of catalyzing the glycosylation of L-menthol were determined using the purified glycosyltransferase. The specific method was as follows: The reaction system included 0.25 μM enzyme, 50 mM L-menthol, 50 mM phosphate (pH 6.5), and the UDPG concentration ranged from 0.3125 mM to 10 mM. The reaction was carried out at 35°C for 10 min, and then quenched by adding one volume of methanol. The product analysis was performed by a refractive index detector (RID-20A) in a Shimadzu high-performance liquid chromatography system. The reaction solution was centrifuged at 12,000 rpm for 5 min, filtered through a 0.22 μm organic membrane, a C18 chromatographic column was used, the mobile phase was 70% methanol, the flow rate was 1 mL / min, the injection volume was 10 μL, and the column temperature was maintained at 40°C. The Michaelis-Menten equation was used to fit the data to calculate K M and k cat . The measurement results are shown in Table 3, indicating that the catalytic efficiency of the novel glycosyltransferase mutant is significantly improved compared with that of the wild type. Table 3 Kinetic parameters of wild type and mutant of glycosyltransferase <![CDATA[K M (mM)]]> <![CDATA[k cat (min -1 )]]> <![CDATA[k cat / K M (min -1 ·mM -1 )]]> BsYjiC-WT 1.39 43.67 31.52 BsYjiC-M1 1.15 175.08 152.71 BsYjiC-M2 1.27 332.17 261.85

[0037] Example 5: Optimization of cascade reaction temperature The temperature stability of purified BsYjiC-M2 and NmSuSy was investigated. The selected incubation temperatures included 30 °C, 35 °C, 40 °C, and 45 °C. The residual enzyme activity of the proteins at different incubation times was measured. The glycosyltransferase enzyme activity assay system was as follows: The 1 mL reaction system contained 50 mM L-menthol, 5 mM UDPG, and 0.5 μM pure enzyme. The reaction was carried out at 35 °C and pH 6.5 in a thermostatic metal bath for 10 min, and then quenched by adding an equal volume of methanol. The concentration of L-menthol-β-glucoside was detected by HPLC. The sucrose synthase enzyme activity assay system was as follows: The 1 mL reaction system contained 50 mM sucrose, 5 mM UDP, and 0.5 μM pure enzyme. The reaction was carried out at 35 °C and pH 6.5 in a thermostatic metal bath for 10 min, and then quenched by adding an equal volume of methanol. The concentration of UDPG was detected by HPLC (HPLC method: The reaction solution was centrifuged at 12,000 rpm for 5 min, filtered through a 0.22 μm organic membrane, and then quantitatively analyzed by the ultraviolet detector in the Agilent high-performance liquid chromatography system. A C18 chromatographic column was used, the mobile phase was phosphate buffer containing 0.1% methanol, the flow rate was 1 mL / min, the injection volume was 10 μL, and the column temperature was maintained at 40 °C). Three parallel experiments were carried out, and the results are as Figure 1 shown, where Figure 1 a is the temperature stability of BsYjiC-M2, Figure 1 b is the temperature stability of sucrose synthase NmSuSy. Therefore, 35 °C was preferably selected as the temperature for the cascade reaction.

[0038] Example 6: Optimization of the pH of the cascade reaction The optimal pH of purified BsYjiC-M2 was determined. The 1 mL reaction system contained 50 mM L-menthol, 5 mM UDPG, and 0.5 μM pure enzyme. The selected pH range included 6.0, 6.5, 7.0, 7.5, 8.0, and 8.5. The reaction was carried out at 35 °C in a thermostatic metal bath for 10 min, and then quenched by adding an equal volume of methanol. The concentration of L-menthol-β-glucoside was detected by HPLC. The optimal pH of purified NmSuSy was determined. The 1 mL reaction system contained 50 mM sucrose, 5 mM UDP, and 0.5 μM pure enzyme. The selected pH range included 5.5, 6.0, 6.5, 7.0, 7.5, and 8.0. The reaction was carried out at 35 °C in a thermostatic metal bath for 10 min, and then quenched by adding an equal volume of methanol. The concentration of UDPG was detected by HPLC. The results are as Figure 2 shown, Figure 2 a is the effect of different pH values on the activity of BsYjiC-M2, Figure 2b shows the effect of different pH values on the activity of NmSuSy. Whole-cell BsYjiC-M2 and NmSuSy were used to explore the effect of pH on the cascade reaction. According to the results of the effects of pH on UGT and SuSy, the pH values selected for exploring the cascade reaction were 6.5, 7.0, and 7.5. The 4 mL reaction system contained 500 mM sucrose, 200 mM L-menthol, and the addition ratio of whole-cell UGT and SuSy cells was 1:4, with a total cell addition amount of 50. The reaction was carried out in a thermostatic metal bath at 35 °C for 48 h. Samples were taken at different times by adding one volume of methanol for quenching, and the concentration of L-menthol-β-glucoside was detected by HPLC. The results are as Figure 3 , and 6.5 is preferably used as the pH for the cascade reaction.

[0039] Example 7: Optimization of the addition ratio of cells in the cascade reaction Whole-cell BsYjiC-M2 and NmSuSy were used to explore the effect of the addition ratio of cells (glycosyltransferase:sucrose synthase) on the cascade reaction. The addition ratio of cells was calculated based on the cell density SCD (System cell density, SCD, unitless) in the reaction system defined by formula (1). When adding cells, the cells were collected by centrifugation at 5000 rpm and 4 °C for 15 min. The addition ratios of cells selected were 1:1, 1:2, 1:3, 1:4, and 1:5. The 4 mL reaction system contained 500 mM sucrose, 200 mM L-menthol, and 2 mM UDP. The UGT cell density in the system was fixed at 10, and the addition amount of SuSy cells was changed according to the ratio. The reaction was carried out in a thermostatic metal bath at 35 °C and pH 6.5 for 96 h. Samples were taken at different times by adding one volume of methanol for quenching, and the concentration of L-menthol-β-glucoside was detected by HPLC. The results are as Figure 4 shown, and 1:4 is preferably used as the addition ratio of glycosyltransferase:sucrose synthase in the cascade reaction.

[0040] Example 8: Optimization of the total addition amount of cells in the cascade reaction The total cell mass addition amount on the cascade reaction was investigated using whole-cell BsYjiC-M2 and NmSuSy. The total cell mass addition amount was calculated based on the total cell density defined by formula (2) (Total system cell density, TSCD, unitless). The cells were collected by centrifugation at 5000 rpm and 4 °C for 15 min when adding the cells. The selected total cell mass addition amounts included 25, 50, 75, 100, and 125. The 4 mL reaction system contained 500 mM sucrose, 200 mM L-menthol, and 2 mM UDP. The ratio of the addition amounts of UGT and SuSy cells was fixed at 1:4. The reaction was carried out in a thermostatic metal bath at 35 °C and pH 6.5 for 96 h. Samples at different times were quenched by adding an equal volume of methanol, and the concentration of L-menthol-β-glucoside was detected by HPLC. TSCD = SCD UGT +SCD SuSy The results were as Figure 5 shown, and the preferred TSCD was 50 as the total cell mass addition amount in the cascade reaction.

[0041] Example 9: Cascade reaction in a 1 L system for the production of L-menthol-β-glucoside The whole-cell BsYjiC-M2 and NmSuSy were used for the scale-up production of L-menthol-β-glucoside. The 1 L reaction system contained 500 mM sucrose, 200 mM L-menthol, and the ratio of the addition amounts of glycosyltransferase and sucrose synthase cells was 1:4. The total cell mass addition amount TSCD was 50. The reaction was carried out at 35 °C and pH 6.5 for 96 h, and the reaction was stopped by heating at 60 °C for 30 min. The results were as Figure 6 , and the concentration reached 154.84 mM at 96 h.

[0042] Example 10: Isolation and purification of L-menthol-β-glucoside The catalytic solution was centrifuged at 4200 rpm for 20 min at room temperature, and the supernatant was collected. The precipitate was washed with an appropriate amount of water at 50 °C and then centrifuged to collect the supernatant until the residual glycoside product in the solid was less than 1%. The supernatants were combined and rotary evaporated at 50 °C until the liquid became turbid, and then slowly cooled to 4 °C for crystallization. The liquid was removed by suction filtration. The solid crystals were washed with a small amount of ice water and then dried at 50 °C. The liquid was further concentrated, crystallized, and filtered until the liquid volume was less than 10% of the initial volume. It was extracted 3 times with an equal volume of ethyl acetate. The organic phases were combined, rotary evaporated at 40 °C to remove the organic phase, and then redissolved in an appropriate amount of water. After cooling crystallization and filtration, a white solid as Figure 7 shown was obtained. The purity and structure were determined by HPLC and NMR respectively. The results were as Figures 8 - 10 shown, and L-menthol-β-glucoside solid with a purity of over 99% was obtained by isolation and purification.

[0043] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements for some or all of the technical features; and these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A novel glycosyltransferase mutant, characterized in that, It has the following mutations in the amino acid sequence shown in SEQ ID NO.2: alanine at position 76 is mutated to aspartic acid, and valine at position 108 is mutated to leucine; The amino acid sequence of the novel glycosyltransferase mutant is as shown in SEQ ID NO.

6.

2. A polynucleotide encoding a novel glycosyltransferase mutant as claimed in claim 1, characterized in that: The nucleotide sequence of the polynucleotide is as shown in SEQ ID NO.

5.

3. A recombinant vector carrying the nucleotide sequence as claimed in claim 2.

4. A genetically engineered bacterium comprising the nucleotide sequence as claimed in claim 2 or the recombinant vector as claimed in claim 3.

5. Use of the novel glycosyltransferase mutant as claimed in claim 1 in the biocatalytic glycosylation modification of L-menthol.

6. Use of the genetically engineered bacterium as claimed in claim 4 in the catalytic synthesis of L-menthol-β-glucoside.

7. A method for synthesizing L-menthol-β-glucoside, characterized in that, Comprising the following steps: using sucrose as a glycosyl donor, L-menthol as a substrate, the novel glycosyltransferase mutant as claimed in claim 1 or the genetically engineered bacterium as claimed in claim 4 as a glycosyltransferase, and acting together with sucrose synthase to carry out biocatalysis, and performing a catalytic reaction to obtain L-menthol-β-glucoside.

8. A method for synthesizing L-menthol-β-glucoside according to claim 7, characterized in that: The amino acid sequence of the sucrose synthase is as shown in SEQ ID NO.

8.

9. The synthesis method of L-menthol-β-glucoside according to claim 8, characterized in that: The addition ratio of the glycosyltransferase to the sucrose synthase is 1:3 to 5.

10. The synthesis method of L-menthol-β-glucoside according to claim 8, characterized in that: It further comprises an operation for separation and purification of the catalytic product, comprising the following steps: S1. Centrifuge the catalytic product and collect the supernatant, concentrate it by rotary evaporation, cool it to crystallize, and obtain solid crystals; S2. Rinse the solid crystals with ice water, dry them, and extract them with ethyl acetate; S3. Combine the organic phases, evaporate the organic phases again by rotary evaporation, redissolve with water, cool to crystallize, and filter to obtain purified L-menthol-β-glucoside.

Images