Cytosine deaminase and DNA random mutation method assisted by cytosine deaminase

Abstract

The invention provides cytosine deaminase and a DNA random mutation method assisted by the cytosine deaminase, and belongs to the technical field of biology. The invention provides engineering cytosine deaminase and develops a novel deaminase-assisted DNA random mutation method based on the engineering cytosine deaminase. According to the invention, broad-spectrum mutations, including C-to-T, G-to-A, A-to-G and T-to-C, are introduced into DNA (Deoxyribonucleic Acid) by utilizing cytosine deaminase and adenine deaminase. The method disclosed by the invention shows higher DNA mutation frequency and can generate more DNA mutation types, and more comprehensive exploration on a protein coding sequence can be realized. Meanwhile, the method disclosed by the invention has relatively high DNA mutagenesis capability, can perform multi-type mutation on a protein coding sequence, assists in creating more types of engineering proteins, and greatly accelerates the protein evolution and screening process.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to a cytosine deaminase and a method for random DNA mutagenesis assisted by the same. Background Art

[0002] Proteins have been widely applied in various fields, such as scientific research, pharmaceutical development, and industrial production. However, natural proteins often cannot fully meet the requirements of each field, and the limitations of natural proteins have become increasingly obvious. In nature, protein evolution is the main source of proteins with new characteristics. This process is a complex dynamic process. Driven by genetic variation, mutation, and natural selection, protein sequences, structures, and functions change slowly over time, enabling proteins to adapt to new environments, acquire new functions, and gradually differentiate into different families with specific functions. A key step in protein evolution is the change in protein-coding DNA, which introduces genetic variation, thereby leading to changes in protein sequences, structures, and functions. However, the mutation frequency of DNA in nature is relatively low, restricting the speed of protein evolution.

[0003] To accelerate the speed of protein evolution, researchers have developed a variety of rapid DNA mutagenesis techniques, including radiation mutagenesis, chemical mutagenesis, and biological mutagenesis. These mutagenesis techniques have accelerated the speed of protein evolution and provided good ways to obtain more engineered proteins with different traits. However, there are still some defects in the existing DNA mutagenesis techniques. Radiation mutagenesis mainly uses high-energy radiation to break chemical bonds in DNA, thereby causing a series of mutations such as base substitution and deletion. This method is widely used in plant breeding and strain optimization. However, this method has obvious disadvantages, including the need for expensive equipment and potential health risks associated with exposure to high-energy radiation for humans. Chemical mutagenesis has been widely used in DNA mutagenesis. For example, chemical reagents such as ethyl methanesulfonate (EMS) and acridine orange are used to generate DNA mutations. EMS introduces alkyl groups into DNA bases, resulting in base substitution or frameshift during replication. At the same time, acridine orange can insert between DNA bases, resulting in base insertion or deletion. However, chemical mutagenesis also poses health risks to researchers and has a low mutation efficiency, requiring multiple rounds of treatment to obtain different types of mutations. The above limitations make radiation mutagenesis and chemical mutagenesis unable to meet the requirements of DNA mutagenesis in artificial protein evolution.

[0004] Currently, the most commonly used method for random DNA mutagenesis in artificial protein evolution is error-prone PCR (epPCR). This method utilizes the Taq DNA polymerase in the presence of manganese ions (Mn 2+The inherent error-prone property in the presence of [Mn] will reduce the fidelity of the enzyme and cause base mutations during the PCR amplification process. The frequency of base mutations usually increases with the increase in the concentration of Mn. 2+ However, excessive Mn 2+ will significantly hinder the PCR amplification efficiency, resulting in a decrease in the yield of PCR products, thus limiting the mutagenic ability of this method. Therefore, epPCR usually requires multiple rounds of mutagenesis to obtain a rich variety of mutant types, making this method time-consuming and laborious. Therefore, currently, there are certain limitations in the technology of DNA mutagenesis, and there is an urgent need for a new DNA mutagenesis technology that can effectively introduce various mutations into the target DNA sequence without affecting the PCR yield or posing health risks to researchers.

[0005] DNA-modifying enzymes, especially deaminases, have become powerful tools for introducing base mutations into DNA. Engineered cytosine deaminase can deaminate cytosine (C) to uracil (U), resulting in the conversion of C to thymine (T) in DNA. After amplification, the corresponding position on the complementary strand will show the conversion of guanine (G) to adenine (A), ultimately achieving the introduction of "C to T" and "G to A" mutations in DNA. Engineered adenine deaminase can effectively deaminate A in DNA to inosine (I), and I will be recognized as G during replication, thus resulting in the A to G mutation. After amplification, the corresponding position on the complementary strand will show the conversion of T to C, ultimately achieving the introduction of "A to G" and "T to C" mutations in DNA. By jointly using cytosine deaminase A3A-RL and adenosine deaminase ABE8e, it is possible to introduce "C to T", "G to A", "A to G", and "T to C" mutations in the protein-coding strand, thereby achieving rapid mutagenesis of DNA and accelerating the process of obtaining different active engineered proteins. SUMMARY OF THE INVENTION

[0006] Aiming at the above deficiencies of the prior art, the present invention provides a cytosine deaminase and its assisted method for DNA random mutagenesis (DRM). The present invention utilizes the characteristics of deaminase to provide a new method for deaminase-driven random mutagenesis, which can generate multiple types of DNA mutations in a single round of mutagenesis.

[0007] To achieve the above object, the specific technical solutions of the present invention are as follows:

[0008] In the first aspect, the present invention provides a cytosine (C) deaminase A3A-RL, and the amino acid sequence of the cytosine deaminase A3A-RL includes the amino acid sequence shown in SEQ ID NO. 1, or an amino acid sequence obtained by substituting, deleting, and / or adding one or several amino acids to the amino acid sequence shown in SEQ ID NO. 1 and having the same function as the protein composed of the amino acid sequence shown in SEQ ID NO. 1.

[0009] Furthermore, the DNA sequence of the cytosine deaminase A3A-RL includes the DNA sequence shown in SEQ ID NO. 3, or a DNA sequence in which one or several nucleotides are substituted, deleted, and / or added to the DNA sequence shown in SEQ ID NO. 3, and which has the same function as the protein encoded by the DNA sequence shown in SEQ ID NO. 3.

[0010] Furthermore, the cytosine deaminase A3A-RL has good deaminase activity on C in different sequence backgrounds.

[0011] In a second aspect, the present invention provides the application of the cytosine deaminase A3A-RL in DNA random mutagenesis.

[0012] In a third aspect, the present invention provides a method for DNA random mutagenesis assisted by the cytosine deaminase A3A-RL, comprising the following steps:

[0013] (1) Denature the DNA to form single-stranded DNA;

[0014] (2) Perform deamination treatment on the single-stranded DNA with the cytosine deaminase A3A-RL or the adenine (A) deaminase ABE8e;

[0015] (3) Perform PCR amplification on the DNA fragment after deamination treatment and denature it into single-stranded DNA;

[0016] (4) Perform deamination treatment on the single-stranded DNA with the adenine deaminase ABE8e or the cytosine deaminase A3A-RL;

[0017] (5) Perform PCR amplification on the deaminated DNA fragment to obtain a rich variety of DNA mutants.

[0018] Furthermore, the method for DNA denaturation is as follows: Incubate the DNA at a high temperature of 90-95 °C for 10-15 min and then immediately transfer it to an ice bath for 5-10 min to denature the double-stranded DNA into single-stranded DNA.

[0019] Furthermore, in the reaction system (20 μL) for the deamination treatment of the single-stranded DNA with the cytosine deaminase A3A-RL, the final concentrations of each component are: 0.02-20 μM A3A-RL, 2 μL DMSO, 20-25 mM ethyl methanesulfonate, and 0.01-0.02% (v / v) Tween-20, and the pH is 6.0-6.5.

[0020] Further, the amino acid sequence of the adenine deaminase ABE8e is shown in SEQ ID NO. 2, and the DNA sequence is shown in SEQ ID NO. 4.

[0021] Further, in the reaction system (10 μL) for deaminating single-stranded DNA by the adenine deaminase ABE8e, the final concentrations of each component are: 0.08 - 8 μM ABE8e, 2 μL DMSO, 50 mM tris(hydroxymethyl)aminomethane hydrochloride, and 10 mM dithiothreitol, with a pH of 7.0 - 7.5.

[0022] Further, the temperature for deaminating the single-stranded DNA is 37 °C, and the time is 1 - 4 h (the mutation rate can be controlled according to the reaction time).

[0023] Further, after deaminating the single-stranded DNA, the deaminase is inactivated by high temperature. The conditions for the high-temperature inactivation treatment are: incubating at 90 - 95 °C for 10 - 15 min; waiting for the reaction temperature to cool to room temperature before proceeding to the next step.

[0024] The method for DNA random mutagenesis based on deaminase in the present invention has the following technical principle: The cytosine deaminase A3A-RL randomly removes cytosine in DNA, resulting in the conversion of C to U in both strands. After PCR amplification, these mutations lead to "C to T" and "G to A" mutations in DNA. At the same time, the adenine deaminase ABE8e randomly removes adenine in DNA, resulting in the conversion of A to I in both strands. After PCR amplification, these mutations lead to "A to G" and "T to C" mutations in DNA. Therefore, the combined use of the cytosine deaminase A3A-RL and the adenine deaminase ABE8e in the present invention can generate "C to T", "G to A", "A to G", and "T to C" mutations in the protein-coding strand, providing a general tool for introducing different types of DNA mutations and accelerating the acquisition of engineered proteins with new traits. The method for DNA random mutagenesis provided by the present invention can greatly shorten the time required to obtain engineered proteins with new traits, thereby accelerating the acquisition of new proteins with improved or novel functions; at the same time, this method provides a powerful tool for protein engineering, enabling researchers to effectively obtain novel proteins with different sequence compositions and releasing their application potential in fields such as biotechnology, medical research and development, and industrial production.

[0025] Compared with the prior art, the advantages of the present invention are as follows:

[0026] The new method (DRM) for DNA random mutagenesis assisted by engineered deaminase provided by the present invention exhibits a high DNA mutation frequency, and a variety of DNA mutation types can be obtained in a single mutagenesis. Specifically manifested as:

[0027] 1. In the present invention, the method is simple to operate and does not require cumbersome sample pretreatment. After deamination treatment, PCR amplification reaction can be directly carried out.

[0028] 2. The present invention does not require metal ions to reduce the activity of PCR amplification enzymes and will not lead to a reduction in PCR products.

[0029] 3. The present invention uses two deaminases in combination, which can introduce mutations of "C to T", "G to A", "A to G" and "T to C", and realizes random mutations of four bases (A, G, C and T).

[0030] 4. The present invention shows significantly higher DNA mutagenesis ability and a higher mutation frequency.

[0031] 5. The present invention generates a wider range of mutations, enabling the generation of a variety of DNA mutation types in a single round of mutagenesis.

[0032] 6. The present invention provides a general and effective method for DNA mutagenesis in protein evolution. It can accelerate the process of protein evolution and promote the application of engineered proteins in the fields of biotechnology, pharmaceutical research and development, and industrial production. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 It is a schematic diagram of the deamination structure of cytosine and adenine by cytosine A3A-RL and adenine ABE8e in the present invention;

[0034] Figure 2 It is a schematic diagram of randomly mutating DNA by combining cytosine A3A-RL and adenine ABE8e in the present invention;

[0035] Figure 3 It is a percentage diagram of the mutation rate obtained by high-throughput sequencing of the PCR products after randomly mutating the designed 321 bp MT-DNA by combining cytosine A3A-RL and adenine ABE8e in the present invention and analyzing the high-throughput sequencing data;

[0036] Figure 4 It is a percentage diagram of the mutation types obtained by analyzing the high-throughput sequencing data in the present invention. DETAILED DESCRIPTION OF THE INVENTION

[0037] In order to further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below in conjunction with embodiments, but they cannot be understood as limiting the protection scope of the present invention.

[0038] The present invention provides a cytosine (C) deaminase A3A-RL, and the amino acid sequence of the cytosine deaminase A3A-RL includes the amino acid sequence shown in SEQ ID NO. 1, or an amino acid sequence in which the amino acid sequence shown in SEQ ID NO. 1 is substituted, deleted, and / or added with one or several amino acids, and has the same function as the protein composed of the amino acid sequence shown in SEQ ID NO. 1.

[0039] The DNA sequence of the cytosine deaminase A3A-RL includes the DNA sequence shown in SEQ ID NO. 3, or a DNA sequence in which the DNA sequence shown in SEQ ID NO. 3 is substituted, deleted, and / or added with one or several nucleotides, and has the same function as the protein encoded by the DNA sequence shown in SEQ ID NO. 3.

[0040] The method for random DNA mutagenesis assisted by the cytosine deaminase A3A-RL includes the following steps:

[0041] (1) Denature the DNA to form single-stranded DNA;

[0042] (2) Perform deamination treatment on the single-stranded DNA with cytosine deaminase A3A-RL or adenine (A) deaminase ABE8e; the amino acid sequence of the adenine deaminase ABE8e is shown in SEQ ID NO. 2, and the DNA sequence is shown in SEQ ID NO. 4;

[0043] (3) Perform PCR amplification on the DNA fragment after deamination treatment and denature it into single-stranded DNA;

[0044] (4) Perform deamination treatment on the single-stranded DNA with adenine deaminase ABE8e or cytosine deaminase A3A-RL;

[0045] (5) Perform PCR amplification on the deaminated DNA fragment to obtain a rich variety of DNA mutants.

[0046] In some examples, the method for DNA denaturation is as follows: Incubate the DNA at a high temperature of 90-95 °C for 10-15 min and then immediately transfer it to an ice bath for 5-10 min to denature the double-stranded DNA into single-stranded DNA.

[0047] In some examples, in the reaction system for the deamination treatment of single-stranded DNA with cytosine deaminase A3A-RL, the final concentrations of each component are: 0.02-20 μM A3A-RL, 2 μL DMSO, 20-25 mM ethyl methanesulfonate, and 0.01-0.02% (v / v) Tween-20, and the pH is 6.0-6.5.

[0048] In some examples, in the reaction system for the deamination treatment of single-stranded DNA by the adenine deaminase ABE8e, the final concentrations of each component are as follows: 0.08 - 8 μM ABE8e, 2 μL DMSO, 50 mM tris(hydroxymethyl)aminomethane hydrochloride, and 10 mM dithiothreitol, with a pH of 7.0 - 7.5.

[0049] In some examples, the temperature for the deamination treatment of the single-stranded DNA is 37 °C, and the time is 1 - 4 h (the mutation rate can be controlled according to the reaction time).

[0050] In some examples, after the deamination treatment of the single-stranded DNA, the deaminase is inactivated by high temperature. The conditions for the high-temperature inactivation treatment are: incubation at 90 - 95 °C for 10 - 15 min; after the reaction temperature cools to room temperature, the next operation can be carried out.

[0051] The method for random DNA mutagenesis based on deaminase in the present invention has the following technical principle as Figure 2 shown: The cytosine deaminase A3A-RL randomly removes cytosine in DNA, resulting in the conversion of C to U in both strands. After PCR amplification, these mutations lead to the appearance of "C to T" and "G to A" mutations in DNA. At the same time, the adenine deaminase ABE8e randomly removes adenine in DNA, resulting in the conversion of A to I in both strands. After PCR amplification, these mutations lead to the appearance of "A to G" and "T to C" mutations in DNA. Therefore, the combined use of the cytosine deaminase A3A-RL and the adenine deaminase ABE8e can generate "C to T", "G to A", "A to G", and "T to C" mutations in the protein-coding strand, providing a general tool for introducing different types of DNA mutations and accelerating the acquisition of engineered proteins with new traits. The method for random DNA mutagenesis provided by the present invention can greatly shorten the time required to obtain engineered proteins with new traits, thereby accelerating the acquisition of new proteins with improved or new functions; at the same time, this method provides a powerful tool for protein engineering, enabling researchers to effectively obtain novel proteins with different sequence compositions and releasing their application potential in the fields of biotechnology, medical research and development, and industrial production.

[0052] The technical solutions of the present invention will be described clearly and completely below. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the scope of protection of the present invention.

[0053] Example 1 Artificial modification of cytosine deaminase A3A-RL

[0054] The amino acid sequence of the wild-type cytosine deaminase wtA3A used in the present invention refers to the National Center for Biotechnology Information (NCBI Gene ID: 200315), and it is modified to obtain the engineered deaminase A3A-RL that has good deaminase activity for C in different sequence backgrounds.

[0055] The amino acid sequence of cytosine deaminase A3A-RL is as follows: MEASPASGPRHLMDPHIFTSNFNNEPWVRGRHKTYLCYEVERLDNGTSVKMDQHRGFLHNQAKNLLCGFYGRHAELRFLDLVPSLQLDPAQIYRVTWFISWSPCFSWGCAGEVRAFLQENTHVRLRIFAARIYDYDPLYKEALQMLRDAGAQVSIMTYDEFKHCWDTFVDHQGCPFQPWDGLDEHSQALSGRLRAILQNQGN (SEQ ID NO. 1).

[0056] The DNA sequence of cytosine deaminase A3A-RL is as follows: ATGGAAGCCAGCCCAGCATCCGGGCCCAGACACTTGATGGATCCACACATCTTCACTTCCAACTTTAACAATGAACCTTGGGTCCGCGGACGTCATAAGACCTACCTGTGCTACGAAGTGGAGCGCCTGGACAATGGCACCTCGGTCAAGATGGACCAGCACCGTGGCTTTCTCCACAACCAGGCTAAGAATCTTCTCTGTGGCTTTTACGGCCGCCATGCGGAGCTGCGCTTCTTGGACCTGGTTCCTTCTTTGCAGTTGGACCCGGCCCAGATCTACAGGGTCACTTGGTTCATCTCCTGGAGCCCCTGCTTCTCCTGGGGCTGTGCCGGGGAAGTGCGTGCGTTCCTTCAGGAGAACACACACGTGAGACTGCGTATCTTCGCTGCCCGCATCTATGATTACGACCCCCTATATAAGGAGGCACTGCAAATGCTGCGGGATGCTGGGGCCCAAGTCTCCATCATGACCTACGATGAATTTAAGCACTGCTGGGACACCTTTGTGGACCACCAGGGATGTCCCTTCCAGCCCTGGGATGGACTAGATGAGCACAGCCAAGCCCTGAGTGGGAGGCTGCGGGCCATTCTCCAGAATCAGGGAAAC (SEQ ID NO. 3).

[0057] Example 2. Mutation rate study of the new method for deaminase-assisted random DNA mutagenesis

[0058] The new method for deaminase-assisted random DNA mutagenesis (DRM) comprises the following steps:

[0059] (1) Denature 40 ng of MT-1 dsDNA into ssDNA by heating at 95 °C for 10 min in a 20% DMSO solution, and then cool it in ice water.

[0060] (2) The deamination reaction was carried out using 2 μM A3A-RL at 37 °C in a 20 μL solution (final concentrations of each component in the solution: 2 μM A3A-RL, 2 μL DMSO, 20 mM ethyl methanesulfonate, and 0.01% (v / v) Tween-20, and its pH was adjusted to 6.5, and deionized water was added to make the reaction system 20 μL). The reaction was incubated in a 37 °C water bath for 3 h. The deamination reaction was terminated by incubating at 95 °C for 10 min.

[0061] (3) 5 ng of deaminase-treated DNA was used as a template for PCR amplification.

[0062] (4) 40 ng of PCR product (amplified from A3A-RL-treated MT-1 DNA) was used for the ABE8e deamination reaction (final concentrations of each component in the reaction system: 8 μM ABE8e, 2 μL DMSO, 50 mM Tris-HCl, and 10 mM dithiothreitol, pH 7.5, and deionized water was added to make the reaction system 10 μL). The reaction mixture was incubated at 37 °C for 3 h, and then the enzyme activity was quenched by heating at 95 °C for 10 min.

[0063] (5) 5 ng of ABE8e-treated DNA was amplified by PCR to obtain a rich variety of DNA mutants.

[0064] epPCR was used to mutate the DNA for comparison with the method of the present invention: 50 μL of reaction mixture was prepared, containing 40 ng of MT-1 dsDNA, 5 μL of 10× buffer, 0.5 mM MgCl2, 0.07 mM MnCl2, 0.4 mM dATP and dGTP, 0.2 mM dCTP and dTTP, 1 U of Accurate Taq DNA polymerase, 0.4 μM of MT-F primer, and 0.4 μM of MT-R primer. The PCR amplification program included an initial denaturation at 95 °C for 10 min, followed by 30 cycles of 95 °C for 30 s, 65 °C for 30 s, and 72 °C for 30 s, and a final extension at 72 °C for 10 min.

[0065] The PCR products obtained from epPCR and the DRM of the present invention were respectively subjected to end repair and adenylation using the Hieff NGS Ultima Endprep Mix Kit (Yeasen Biotech Co., Ltd., Shanghai). Then, pre-T5 and pre-T7 were ligated to both ends of the repaired DNA using the NGS Ultima DNA Ligation Module Kit (Yeasen), and the resulting DNA was purified using 0.9×KAPA magnetic beads. Then, the DNA product was amplified by PCR for 10 cycles using P5-index and P7-index. The PCR amplification was carried out in a 50 μL solution containing 25 μL of Q5 High-Fidelity PCR Mix, and 2 μL each of P5-index and P7-index (10 μM). The PCR amplification program included an initial denaturation at 95 °C for 10 min, followed by 10 cycles of 95 °C for 30 s, 65 °C for 30 s, 68 °C for 30 s, and finally an extension at 68 °C for 10 min. The PCR product was purified using 0.8×KAPA magnetic beads and detected by 1.5% agarose gel electrophoresis. The library quality was evaluated on an Agilent Bioanalyzer 2100 system. Finally, the library was sequenced on an Illumina NovaSeq 6000 platform (Gene Co., Ltd., Jiangsu, China).

[0066] The sequences of the DNA strands and primer sequences used in this example are shown in the following table:

[0067]

[0068] The experimental results are shown in Figure 3 . As can be seen from the figure, the novel method for DNA random mutagenesis assisted by deaminase (DRM) of the present invention showed a high mutation rate. Approximately 73.12% of the 2 million PCR products contained mutations, that is, about 1.46 million DNA mutants were generated. The mutation rate of epPCR was only 5.00%, that is, only about 100,000 DNA mutants were generated. This result indicates that the novel method for DNA random mutagenesis assisted by deaminase of the present invention has a higher DNA mutation ability compared to the epPCR method and can generate a higher DNA mutation rate.

[0069] Example 3 Study on the Mutation Types of the Novel Method for DNA Random Mutagenesis Assisted by Deaminase

[0070] The sample treatment was the same as in Example 2. After treatment, high-throughput sequencing was used to analyze the DNA mutation types obtained by different methods. The experimental results are shown in Figure 4. As can be seen from the figure, the new method of deaminase-assisted random DNA mutagenesis (DRM) of the present invention has obtained a relatively rich variety of DNA mutation types, with a total of approximately 17,211 different DNA mutation types generated; while epPCR only generated 631 DNA mutation types. This result indicates that the new method of deaminase-assisted random DNA mutagenesis of the present invention has a higher mutagenic ability compared to the epPCR method and can obtain more DNA mutation types.

[0071] In summary, the present invention uses cytosine deaminase and adenine deaminase to introduce broad-spectrum mutations in DNA, including C-to-T, G-to-A, A-to-G, and T-to-C. The method of the present invention exhibits a high DNA mutation frequency and can generate a large number of DNA mutation types, enabling a more comprehensive exploration of protein-coding sequences. At the same time, the method of the present invention has a high DNA mutagenesis ability, can perform various types of mutations on protein-coding sequences, and assist in creating more types of engineered proteins, greatly accelerating the protein evolution and screening process.

[0072] The above specific embodiments have described the implementation of the present invention in detail. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the claims and technical concept of the present invention, various simple modifications and changes can be made to the technical solutions of the present invention, and these simple variations all fall within the protection scope of the present invention.

Claims

1. A cytosine deaminase, characterized in that, The amino acid sequence of the cytosine deaminase includes the amino acid sequence shown in SEQ ID NO. 1, or the amino acid sequence shown in SEQ ID NO. 1 with one or several amino acids substituted, deleted, and / or added, and having the same function as the protein composed of the amino acid sequence shown in SEQ ID NO.

1.

2. The cytosine deaminase according to claim 1, wherein, The DNA sequence of the cytosine deaminase includes the DNA sequence shown in SEQ ID NO. 3, or the DNA sequence shown in SEQ ID NO. 3 with one or several nucleotides substituted, deleted, and / or added, and having the same function as the protein encoded by the DNA sequence shown in SEQ ID NO.

3.

3. Use of the cytosine deaminase according to claim 1 or 2 in DNA random mutagenesis.

4. The method for random DNA mutagenesis assisted by cytosine deaminase according to claim 1 or 2, characterized in that, Comprising the following steps: (1) Denature the DNA to form single-stranded DNA; (2) Perform deamination treatment on the single-stranded DNA with cytosine deaminase or adenine deaminase; (3) Perform PCR amplification on the DNA fragment after deamination treatment and denature it into single-stranded DNA; (4) Perform deamination treatment on the single-stranded DNA with adenine deaminase or cytosine deaminase; (5) Perform PCR amplification on the deaminated DNA fragment to obtain a rich variety of DNA mutants.

5. The method for random DNA mutagenesis assisted by cytosine deaminase according to claim 4, wherein The method for DNA denaturation is as follows: Incubate the DNA at a high temperature of 90-95 °C for 10-15 min and then immediately transfer it to an ice bath for 5-10 min to denature the double-stranded DNA into single-stranded DNA.

6. The method for random DNA mutagenesis assisted by cytosine deaminase according to claim 4, characterized in that, In the reaction system for deamination treatment of single-stranded DNA with cytosine deaminase, the final concentrations of each component are: 0.02-20 μM cytosine deaminase, 2 μL DMSO, 20-25 mM ethyl methanesulfonate, and 0.01-0.02% (v / v) Tween-20, with a pH of 6.0-6.

5.

7. The method for random DNA mutagenesis assisted by cytosine deaminase according to claim 4, wherein The amino acid sequence of the adenine deaminase is as shown in SEQ ID NO. 2, and the DNA sequence is as shown in SEQ ID NO.

4.

8. The method for random DNA mutagenesis assisted by cytosine deaminase according to claim 4, characterized in that, In the reaction system for deamination treatment of single-stranded DNA with adenine deaminase, the final concentrations of each component are: 0.08-8 μM adenine deaminase, 2 μL DMSO, 50 mM tris(hydroxymethyl)aminomethane hydrochloride, and 10 mM dithiothreitol, with a pH of 7.0-7.

5.

9. The method for random DNA mutagenesis assisted by cytosine deaminase according to claim 4, wherein, The temperature for deamination treatment of the single-stranded DNA is 37 °C, and the time is 1-4 h.

10. The method for random DNA mutagenesis assisted by cytosine deaminase according to claim 4, wherein After deamination treatment of the single-stranded DNA, perform high-temperature inactivation treatment on the deaminase and then proceed to the next step.

Images