Oncolytic virus receptor fragment sequence, gene modified CAR-T cell and application

By inserting the nucleotide sequence of the oncolytic virus receptor CR2 or CR3 into the chimeric antigen receptor of CAR-T cells, the problem of poor combined effect of CAR-T cells and oncolytic viruses is solved, the virus delivery efficiency and CAR-T cell function are improved, and the therapeutic effect on solid tumors is enhanced.

CN120366319APending Publication Date: 2025-07-25GUANGDONG GENERAL HOSPITAL
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510447007.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-10
Publication Date
2025-07-25

AI Technical Summary

Technical Problem

In the prior art, the combined effect of CAR-T cells and oncolytic viruses is limited in the treatment of solid tumors. Viral infection leads to depletion of CAR-T cells and reduced function, and the perfusion efficiency of oncolytic viruses reaching the tumor site intravenous injection is low.

Method used

The nucleotide sequence of the oncolytic virus receptor CR2 or CR3 is inserted into the chimeric antigen receptor structure of CAR-T cells to enhance the virus's mounting on the cell membrane surface, improve tumor perfusion efficiency and activate CAR-T cell function.

Benefits of technology

It improves the delivery efficiency of oncolytic viruses and the anti-tumor activity of CAR-T cells, reduces cell depletion, and significantly enhances the therapeutic effect on solid tumors.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120366319A_ABST
    Figure CN120366319A_ABST
Patent Text Reader

Abstract

The invention relates to an oncolytic virus receptor fragment sequence, a gene modified CAR-T cell and application. The invention belongs to the technical field of tumor treatment. According to the invention, a nucleotide sequence of an oncolytic virus receptor is inserted before or after a CAR sequence of a CAR-T cell; the oncolytic virus receptor is CR2 or / and CR3. The invention finds that the mounting amount of the oncolytic virus on the surface of a CAR-T cell membrane can be increased by inserting an oncolytic virus receptor fragment into a CAR structure, so that the CAR-T cell function and the secretion of cytotoxic factors are enhanced, the anti-tumor activity of the CAR-T is enhanced, and the depletion of the CAR-T cell can be reduced.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of tumor treatment, and particularly relates to an oncolytic virus receptor fragment sequence, a gene-modified CAR-T cell, and applications thereof. Background Art

[0002] CAR-T therapy is Chimeric Antigen Receptor T-Cell Immunotherapy. Both CAR-T therapy and oncolytic virus therapy are currently promising new strategies for anti-tumor immunotherapy. Although CAR-T shows significant therapeutic effects on lymphoma, its efficacy against solid tumors is very limited. Oncolytic viruses (OVs) have been evaluated as a method to improve the efficacy of chimeric antigen receptor (CAR)-T cell therapy for solid tumors.

[0003] In the prior art, oncolytic viruses and CAR-T cells are simply administered by intravenous injection separately in an independent manner or in a physically mixed manner. However, the therapeutic effect of the combined action of CAR-T cells and oncolytic viruses in the prior art is limited. On the one hand, virus infection can lead to the exhaustion and functional decline of CAR-T cells; on the other hand, the perfusion efficiency of oncolytic viruses reaching the tumor site by intravenous injection is low. Therefore, seeking a method to improve the combined therapeutic effect of CAR-T cells and oncolytic viruses has become an urgent technical problem for those skilled in the art. Summary of the Invention

[0004] The purpose of the present invention is to overcome the deficiencies of the prior art and provide an oncolytic virus receptor fragment sequence, a gene-modified CAR-T cell, and applications thereof.

[0005] To achieve the above purpose, the technical solutions adopted by the present invention are as follows:

[0006] In the first aspect, the present invention provides an oncolytic virus receptor fragment sequence. The oncolytic virus receptor fragment is a nucleotide sequence, and the nucleotide sequence is shown as any one of the following:

[0007] (a) As shown in SEQ ID NO:1;

[0008] (b) As shown in SEQ ID NO:2;

[0009] (c) As shown in SEQ ID NO:3.

[0010] The present invention constructs the nucleotide sequences of oncolytic virus receptors CR2 and CR3, and inserts them or their combinations into the CAR structure of CAR-T cells. On the one hand, it can increase the attachment of oncolytic virus on the surface of CAR-T cell membranes, improve the tumor perfusion efficiency of intravenously injected oncolytic virus, enhance the delivery efficiency of oncolytic virus, and prolong the retention time of oncolytic virus in tumors. On the other hand, the attached oncolytic virus glycoprotein interacts with the CAR structure, which can enhance the activation of CAR-T cell function and the secretion of cytotoxic factors, and improve the anti-tumor effect of CAR-T.

[0011] In a second aspect, the present invention provides the use of the oncolytic virus receptor fragment sequence as described in the first aspect in genetically modified CAR-T cells.

[0012] In a third aspect, the present invention provides a genetically modified CAR-T cell, which is prepared by inserting the nucleotide sequence of an oncolytic virus receptor before or after the CAR sequence of the CAR-T cell; the oncolytic virus receptor is CR2 or / and CR3.

[0013] The present invention discovers that inserting an oncolytic virus receptor fragment into the CAR structure obtains a genetically modified CAR-T cell, which can increase the amount of oncolytic virus attached to the surface of CAR-T cell membranes, not only enhance CAR-T cell function and the secretion of cytotoxic factors, enhance the anti-tumor activity of CAR-T, but also reduce the exhaustion of CAR-T cells.

[0014] As a preferred embodiment of the third aspect, the nucleotide sequence of CR2 is as shown in SEQ ID NO:1; the nucleotide sequence of CR3 is as shown in SEQ ID NO:2.

[0015] As a preferred embodiment of the third aspect, the oncolytic virus receptor CR2 is protein A encoded by the nucleotide sequence as shown in SEQ ID NO:1; or, the oncolytic virus receptor is protein B encoded by the nucleotide sequence as shown in SEQ ID NO:2; or, the oncolytic virus receptor is protein C formed by fusing protein A encoded by the nucleotide sequence as shown in SEQ ID NO:1 and protein B encoded by the nucleotide sequence as shown in SEQ ID NO:2, and the nucleotide sequence of the fusion protein C is as shown in SEQ ID NO:3. The present invention discovers that when the oncolytic virus CR2 and CR3 receptor fragments are jointly inserted into the CAR structure of CAR-T cells, the amount of oncolytic virus attached to the surface of CAR-T cell membranes can be maximally increased.

[0016] As a preferred embodiment of the third aspect, the CAR-T cell is a B7H3-CAR-T cell; the oncolytic virus is VSVΔ51.

[0017] In a fourth aspect, the present invention provides the use of the genetically modified CAR-T cells described in the third aspect in the preparation of a medicament for preventing or treating tumors.

[0018] As a preferred embodiment of the fourth aspect, an oncolytic virus is loaded onto the genetically modified CAR-T cells described in the first aspect.

[0019] As a preferred embodiment of the fourth aspect, the loading method is to co-incubate the oncolytic virus with the genetically modified CAR-T cells at 0°C. At 0°C, the oncolytic virus will only adsorb onto the surface of the CAR-T cells and will not infect the CAR-T cells.

[0020] As a preferred embodiment of the fourth aspect, the tumor is at least one of hematological tumors, gliomas, melanomas, breast cancers, head and neck cancers, lung cancers, colorectal cancers, pancreatic cancers, liver cancers, bladder cancers, ovarian cancers, sarcomas or cervical cancers; preferably a glioma.

[0021] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0022] The present invention discovers that inserting the receptor sequence of a virus into the chimeric antigen receptor structure (CAR) of CAR-T cells can, on the one hand, achieve the attachment of oncolytic virus on the surface of CAR-T cell membranes, so as to improve the tumor perfusion efficiency of intravenously injected oncolytic virus, improve the delivery efficiency of oncolytic virus and its anti-tumor effect; on the other hand, the attached oncolytic virus glycoprotein interacts with the CAR structure, activates the function of CAR-T cells and the secretion of cytotoxic factors, enhances the anti-tumor effect of CAR-T, and reduces the exhaustion of CAR-T cells. The present invention proves through zoological experiments that inserting the oncolytic virus receptor into chimeric antigen receptor T cells (CAR-T) can simultaneously increase the delivery efficiency of oncolytic virus and enhance the anti-tumor activity of CAR-T, thereby significantly enhancing the anti-tumor effects of both. Description of the Drawings

[0023] Figure 1Schematic diagram showing that chimeric expression of CR2 or / and CR3 domain in EGFR-CAR structure can significantly increase the load of VSVΔ51 virus (Figure A is a schematic diagram of designing and constructing CAR-T with oncolytic virus mounted on the membrane surface; Figure B is a schematic diagram of the modification strategies of 5 EGFR-CAR structures: CAR-CR2, CAR-CR3, CR2-CAR, CR3-CAR, and CR2-CR3-CAR (CR2 / 3-CAR); Figure C is the detection result of the expression level of the tag protein CD19 in the CAR structure; Figure D is the result of the expression level of VSV-G on the surface of EGFR-CAR-T cells; Figure E is the result of the proportion of VSV-G positive EGFR-CAR-T; Figure F is the result of the expression level of the viral nucleic acid VSV-G on EGFR-CAR-T cells);

[0024] Figure 2 Schematic diagram showing that CR2 / 3-B7H3-CAR-T significantly increases the membrane surface mounting of VSVΔ51 virus (Figure A is the detection result of the expression level of the tag protein CD19 in the B7H3-CAR structure, UTD represents the untransduced T cell group, CR2 / 3-B7H3VSV represents CR2 / 3-B7H3-CAR-T mounted with VSVΔ51, and B7H3VSV represents B7H3-CAR-T mounted with VSVΔ51; Figure B is the expression level of VSV-G protein on the surface of B7H3-CAR-T cells. The left figure is a representative picture of flow cytometry analysis, and the right figure is the quantitative analysis result of the proportion of VSV-G positive cells; Figure C is the schematic diagram of the distribution of the viral protein VSV-G on B7H3-CAR-T analyzed by immunofluorescence);

[0025] Figure 3 Schematic diagram showing that CR2 / 3-B7H3-CAR-T efficiently delivers VSVΔ51 virus to the intracranial tumor site (Figure A shows the recombinant modified VSVΔ51 virus expressing luciferase (VSV-luc); Figure B shows the monitoring of the distribution and delivery of VSV-luc virus in tumor-bearing mice by small animal bioluminescence imaging; Figure C are the pictures of small animal in vivo imaging detected by bioluminescence imaging at 48 and 72 hours after intravenous injection of the virus respectively; Figure D is the schematic diagram of the radiation quantitative analysis result of bioluminescence);

[0026] Figure 4 Schematic diagram showing that CR2 / 3-B7H3-CAR-TVSV significantly inhibits glioma growth and prolongs the survival period of tumor-bearing mice (Figure A is a schematic diagram of the animal experiment; Figure B is the survival analysis chart of each group; Figure C is the schematic diagram of the H&E staining result of mouse brain tissue sections);

[0027] Figure 5Schematic diagram of enhancing the tumor treatment function of CR2 / 3-B7H3-CAR-T by mounting on VSVΔ51 virus and reducing cell exhaustion (Figure A shows the results of flow cytometry detection of the expression levels of IFNγ, granzyme B, and TNFα in CAR-T cells; Figure B shows the results of flow cytometry detection of the expression levels of TMI-3 and PD-1 in CAR-T cells);

[0028] Figure 6 Schematic diagram of the plasmid map of pHR-CR2 / 3-B7H3CAR of the present invention. Detailed implementation manners

[0029] To better illustrate the purpose, technical solution, and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments.

[0030] Example 1 Preparation method of oncolytic virus-mounted CR2 / 3-CAR-T cells

[0031] 1. Construction of oncolytic virus-mounted CR2 / 3-CAR-T cells

[0032] To construct CAR-T cells with oncolytic virus mounted on the cell membrane surface, we first chimerically expressed the CR2 and CR3 domains derived from the VSV virus receptor in the EGFR-CAR structure and detected the membrane surface loading of VSVΔ51 on EGFR-CAR-T cells ( Figure 1 A).

[0033] By expressing the CR2 and CR3 domains at different positions in the EGFR-CAR structure, we designed a total of 5 different modification strategies according to different tandem methods: CAR-CR2, CAR-CR3, CR2-CAR, CR3-CAR, CR2-CR3-CAR (CR2 / 3-CAR) ( Figure 1 B). The specific operation methods are as follows:

[0034] (1) Prepare oncolytic virus:

[0035] The oncolytic virus used in this example is vesicular stomatitis virus (VSV), preferably an engineered vesicular stomatitis virus VSVΔ51. The VSVΔ51 virus is derived from a genetically engineered vesicular stomatitis virus (which can be obtained by the method described in the literature Lawson ND, Stillman EA, Whitt MA, Rose JK. Recombinant vesicular stomatitis viruses from DNA. Proc Natl Acad Sci U S A. 1995 May 9;92(10):4477-81. doi:10.1073 / pnas.92.10.4477. Erratum in: Proc Natl Acad Sci U S A 1995 Sep 12;92(19):9009. PMID:7753828; PMCID:PMC41967.). This virus has had the methionine at the matrix protein 51 site removed to reduce its potential toxicity.

[0036] (2) Design the sequences of the oncolytic virus receptor fragments (CR2 and CR3 fragments) of VSVΔ51:

[0037] CR2 domain:

[0038] TGCAAATCCGGGGACTTCAGCTGTGGGGGCCGTGTCAACCGCTGCATTCCTCAGTTCTGGAGGTGCGATGGCCAAGTGGACTGCGACAACGGCTCAGACGAGCAAGGCTGT(SEQ ID No:1)

[0039] CR3 domain:

[0040] TGCTCCCAGGACGAGTTTCGCTGCCACGATGGGAAGTGCATCTCTCGGCAGTTCGTCTGTGACTCAGACCGGGACTGCTTGGACGGCTCAGACGAGGCCTCCTGC(SEQ ID No:2)

[0041] CR2+CR3 domain:

[0042] TGCAAATCCGGGGACTTCAGCTGTGGGGGCCGTGTCAACCGCTGCATTCCTCAGTTCTGGAGGTGCGATGGCCAAGTGGACTGCGACAACGGCTCAGACGAGCAAGGCTGTCCCCCCAAGACGTGCTCCCAGGACGAGTTTCGCTGCCACGATGGGAAGTGCATCTCTCGGCAGTTCGTCTGTGACTCAGACCGGGACTGCTTGGACGGCTCAGACGAGGCCTCCTGC(SEQ ID No:3)

[0043] The above-mentioned sequence was synthesized by Guangzhou Ruibo Company and inserted into the CAR structure. The specific insertion position is between the single-chain antibody region (scFV) and the signal peptide region, and they are named CR2-CAR, CAR-CR2, CR3-CAR, CAR-CR3, and CR2 / 3-CAR respectively.

[0044] (3) Construction of CR2 / 3-CAR-T cells

[0045] a: Lentivirus packaging: Co-transfect HEK293T cells with the pHR core plasmid (such as the pHR-CR2 / 3-B7H3CAR plasmid as Figure 6 shown), the packaging plasmid psPAX2, and the envelope plasmid pMD2. Replace the medium 8 hours after transfection. After 48 hours of transfection, collect the cell supernatant containing lentivirus and pass it through a 0.45 μm filter to obtain the lentivirus solution.

[0046] b: Infection: Isolate PBMC cells from human peripheral blood, then use the CD3+ T lymphocyte positive selection kit from Stemcell Company (STEMCELL TECHNOLOGIES, catalog number 17851) to sort out CD3+ T lymphocytes, and then use CD3 and CD28 activators (STEMCELL TECHNOLOGIES, catalog number 10971) to stimulate and activate the T cells. The activated human CD3 + T lymphocytes are infected with the above lentivirus solution, centrifuged at 500 g for 60 min, and incubated at 37 °C. After 12 hours of infection, remove the lentivirus, and amplify CD3 + T cells in serum-free lymphocyte medium (Lonza, catalog number 04-418Q) to obtain gene-modified CD3 +T cells, namely CR2 / 3-CAR-T cells. The CR2 / 3-CAR-T cells were passaged and cultured in serum-free lymphocyte medium (Lonza, catalog number 04-418Q) containing IL-2 (fresh medium was replaced twice a week, 10 ng / ml), and functional assays were performed 14 days after transduction.

[0047] (4) Mounting VSVΔ51 oncolytic virus on the surface of CR-2 / CR3-CAR-T cells

[0048] The VSVΔ51 oncolytic virus was co-incubated with the above-mentioned different CR-2 / CR3-CAR-T cells constructed on an ice-water mixture at 0 °C for 1 hour, and the ratio of virus to cells was 10:1, that is, 10 virus particles were co-incubated with 1 CAR-T cell. At 0 °C, the VSVΔ51 oncolytic virus will only adsorb on the surface of CAR-T cells and will not infect CAR-T cells.

[0049] 2. Detection and results

[0050] The CAR transduction and expression efficiency of EGFR-CAR-T cells were evaluated by measuring the expression level of the tag protein CD19 in the CAR structure. The results are as Figure 1 shown in C. None of the above five strategies affected the CAR transduction and expression efficiency on T cells, and the CAR expression efficiency was above 60% ( Figure 1 C).

[0051] The virus loading amount was detected by flow cytometry analyzing the expression level of the VSV-G gene of the VSVΔ51 virus on the surface of EGFR-CAR-T cells. The results are as Figure 1 shown in D. It was found that the VSVΔ51 virus loading amount of CR2 / 3-EGFR-CAR-T was the highest, and compared with the EGFR-CAR-T control group, the virus load was increased by about 10 times ( Figure 1 D).

[0052] According to the quantitative analysis of the flow cytometry results, the proportion of EGFR-CAR-T positive for the VSV-G gene was statistically analyzed. The results are as Figure 1 shown in E. It was found that the proportion of the virus gene VSV-G positive in CR2 / 3-EGFR-CAR-T was the highest ( Figure 1 E).

[0053] These above results indicate that the incorporation of the CR2 or CR3 domain of the viral receptor into the CAR structure can increase the loading amount of VSVΔ51 on the surface of EGFR-CAR-T cell membrane, especially the simultaneous incorporation of the CR2 and CR3 domains of the viral receptor can maximize the loading amount of VSVΔ51 on the surface of EGFR-CAR-T cell membrane.

[0054] Preparation method of oncolytic virus - loaded CR2 / 3 - B7H3 - CAR - T cells in Example 2

[0055] In view of B7H3 - CAR, we further inserted into the CR2 and CR3 domains of the B7H3 - CAR chimeric virus receptor and detected changes in virus loading ability. Since the CR2 and CR3 domain sequences were inserted into the CAR structure, specifically at the position between the single - chain antibody region (scFV) and the signal peptide region, we named it CR2 / 3 - B7H3 - CAR. The specific operation method is as follows:

[0056] (1) Preparation of oncolytic virus:

[0057] The oncolytic virus used in this example is vesicular stomatitis virus (VSV), and preferably an engineered vesicular stomatitis virus VSVΔ51, which has removed the methionine at the matrix protein 51 site to reduce its potential toxicity.

[0058] (2) Design of the inserted VSVΔ51 oncolytic virus receptor fragment (CR2 and CR3 fragments) sequence:

[0059] CR2+CR3 domain:

[0060] TGCAAATCCGGGGACTTCAGCTGTGGGGGCCGTGTCAACCGCTGCATTCCTCAGTTCTGGAGGTGCGATGGCCAAGTGGACTGCGACAACGGCTCAGACGAGCAAGGCTGTCCCCCCAAGACGTGCTCCCAGGACGAGTTTCGCTGCCACGATGGGAAGTGCATCTCTCGGCAGTTCGTCTGTGACTCAGACCGGGACTGCTTGGACGGCTCAGACGAGGCCTCCTGC(SEQ ID No:3).

[0061] The above - mentioned sequence was synthesized by Guangzhou Ruibo Company and inserted into the structure of B7H3 - CAR, and named CR2 / 3 - B7H3 - CAR.

[0062] (3) Construction of CR2 / 3 - B7H3 - CAR - T cells

[0063] a: Packaging of lentivirus: The pHR-CR2 / 3-B7H3 core plasmid (which contains a signal peptide region, a CR2 / 3 domain, a single-chain antibody region, a transmembrane region, an intracellular co-stimulatory domain, and a signal transduction domain), the packaging plasmid psPAX2, and the envelope plasmid pMD2 were co-transfected into HEK293T cells. The culture medium was changed 8 hours after transfection. 48 hours after transfection, the cell supernatant containing lentivirus was collected and passed through a 0.45 μm filter.

[0064] b: Transfection: PBMC cells were isolated from human peripheral blood, and then CD3+ T lymphocytes were sorted using the CD3+ T Lymphocyte Positive Selection Kit (STEMCELL TECHNOLOGIES, catalog number 17851). Subsequently, the T cells were stimulated and activated using CD3 and CD28 activators (STEMCELL TECHNOLOGIES, catalog number 10971). The activated human CD3 + T lymphocytes were infected with the above lentivirus solution, centrifuged at 500g for 60 min, and incubated at 37 °C. After 12 hours of infection, the lentivirus was removed, and the CD3 + T cells were amplified in serum-free lymphocyte medium (Lonza, catalog number 04-418Q) to obtain gene-modified CD3 + T cells, which are CR2 / 3-B7H3-CAR-T cells. The CR2 / 3-B7H3-CAR-T cells were stored in serum-free lymphocyte medium (Lonza, catalog number 04-418Q) containing IL-2 for subculture (the medium was changed twice a week, 10 ng / ml), and functional assays were performed 14 days after transduction.

[0065] (4) Mounting VSVΔ51 oncolytic virus on the surface of CR2 / 3-B7H3-CAR-T cells

[0066] The VSVΔ51 oncolytic virus and the above-constructed CR2 / 3-B7H3-CAR-T cells were co-incubated on an ice-water mixture at 0 °C for 1 hour, and the ratio of virus to cells was 10:1, that is, 10 virus particles were co-incubated with 1 CR2 / 3-B7H3-CAR-T cell. At 0 °C, the VSVΔ51 oncolytic virus will only adsorb on the surface of CR2 / 3-B7H3-CAR-T cells and will not infect CR2 / 3-B7H3-CAR-T cells.

[0067] 2. Detection and results

[0068] The CAR transduction and expression efficiency of B7H3-CAR-T cells were evaluated by measuring the expression level of the tag protein CD19 in the B7H3-CAR structure. The results are as Figure 2As shown in A, it was found that the insertion of CR-2 / CR3 did not affect the transduction and expression efficiency of CAR on B7H3-CAR-T cells, and the CAR expression efficiency was above 70%( Figure 2 A).

[0069] Through the quantitative analysis of the flow cytometry results, the proportion of B7H3-CAR-T cells positive for the VSV-G gene was statistically analyzed. The results are as Figure 2 shown in B. It was found that the proportion of VSV-G positive cells in CR2 / 3-B7H3-CAR-T was significantly higher than that of the B7H3-CAR-T control cells, with approximately 6 times more virus-positive cells( Figure 2 B).

[0070] Through immunofluorescence analysis of the distribution of virus particles on B7H3-CAR-T cells, the results are as Figure 2 shown in C. It was found that the VSV-G fluorescence signal of the virus protein particles in CR2 / 3-B7H3-CAR-T was located on the cell membrane surface, and the VSV-G fluorescence signal was stronger than that in the B7H3-CAR-T group( Figure 2 C).

[0071] These above results suggest that the chimeric expression of the CR2 / 3 domain can also enhance the membrane surface attachment of VSVΔ51 virus to B7H3-CAR-T cells.

[0072] Example 3 CR2 / 3-B7H3-CAR-T can be used as a cell delivery vector for oncolytic virus

[0073] An orthotopic model of U87 glioma was constructed in severely immunodeficient NSG mice, and the virus distribution and delivery efficiency were detected by small animal in vivo imaging( Figure 3 A and 3B). The small animal imaging results showed that only a small amount of virus reached the intracranial tumor after intravenous injection of VSV-luc (vesicular stomatitis virus virus labeled with luciferase), and it was basically cleared within 72 hours, while CR2 / 3-B7H3-CAR-T efficiently delivered VSV-luc to the intracranial tumor and prolonged the retention time of VSV-luc in the tumor( Figure 3 C and 3D).

[0074] Example 4 Tumor treatment effect of CR2 / 3-B7H3-CAR-T loaded with oncolytic virus

[0075] An orthotopic intracranial model of glioma was constructed using severely immunodeficient NCG mice: U87 tumor cells were inoculated intracranially in mice on day 0, and tumors formed on day 5; divided into 6 groups for treatment: intravenously injected with ① PBS, ② VSVΔ51 (10 7 PFU / ml), ③ B7H3-CAR-T (10 6(④ B7H3-CAR-T adsorbed with VSVΔ51, abbreviated as B7H3-CAR-T (10 cells / ml)) VSV Δ51 (10 6 (⑤ CR2 / 3-B7H3-CAR-T (10 cells / ml)) 6 (⑥ CR2 / 3-B7H3-CAR-T specifically loaded with VSVΔ51, abbreviated as CR2 / 3-B7H3-CAR-T (10 cells / ml)) VSVΔ51 (10 6 (cells / ml) ( Figure 4 A); On the 14th day after 2 weeks of administration, H&E staining was performed on brain tissue sections of mice, and the size of intracranial tumors was analyzed (scale bar = 1 cm), and the survival time of tumor-bearing NCG mice was recorded (n = 7).

[0076] It was found that CR2 / 3-B7H3-CAR-T VSVΔ51 treatment significantly reduced the volume of intracranial tumors and inhibited the growth of intracranial tumors ( Figure 4 C). Survival analysis showed that compared with other treatment methods, CR2 / 3-B7H3-CAR-T VSVΔ51 could significantly prolong the survival time of tumor-bearing mice ( Figure 4 B). The in vivo experimental results showed that compared with other treatment groups, CR2 / 3-B7H3-CAR-T VSVΔ51 had a stronger anti-glioma effect, indicating that CR2 / 3-B7H3-CAR-T VSVΔ51 showed the most significant anti-tumor effect.

[0077] Example 5 Verification of the enhanced killing function of oncolytic virus VSVΔ51 loaded on CR2 / 3-B7H3-CAR-T and the reduction of CAR-T cell exhaustion

[0078] An orthotopic intracranial model of glioma was established using severely immunodeficient NCG mice: U87 tumor cells were inoculated intracranially in mice on day 0, and tumors formed on day 5; divided into 6 groups for treatment: intravenous injection of ① PBS, ② VSVΔ51 (10 7 PFU), ③ B7H3-CAR-T (10 6 (cells), ④ B7H3-CAR-T adsorbed with VSVΔ51, abbreviated as B7H3-CAR-T VSVΔ51 (10 6 (cells), ⑤ CR2 / 3-B7H3-CAR-T (10 6 (cells) and ⑥ CR2 / 3-B7H3-CAR-T specifically loaded with VSVΔ51, abbreviated as CR2 / 3-B7H3-CAR-T VSVΔ51 (106 cells) Figure 4 A); On the 9th day after 2 weeks of administration, the intracranial tumors were dissociated into single cells, and the tumor-infiltrating CAR-T cells were stained with flow antibodies and analyzed by flow cytometry, including the detection indexes of cell killing function interferon γ (IFNγ), granzyme B, tumor necrosis factor α (TNFα), and the detection indexes of cell exhaustion including TMI-3 and PD-1.

[0079] The results were as Figure 5 shown, and it was found that the expression levels of IFNγ, granzyme B, and TNFα in the CR2 / 3-B7H3-CAR-T VSVΔ51 group were significantly increased ( Figure 5 A), compared with other groups, indicating that the tumor killing function of CR2 / 3-B7H3-CAR-T VSVΔ51 was greatly improved. At the same time, it was found that the expression levels of the exhaustion markers TIM-3 and PD-1 in the CR2 / 3-B7H3-CAR-T VSVΔ51 cells were significantly decreased ( Figure 5 B), indicating a significant reduction in the exhaustion state of intratumoral CAR-T cells.

[0080] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the protection scope of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. An oncolytic virus receptor fragment, characterized in that, The oncolytic virus receptor fragment is a nucleotide sequence, and the nucleotide sequence of the oncolytic virus receptor fragment sequence is shown as any one of the following: (a) As shown in SEQ ID NO:1; (b) As shown in SEQ ID NO:2; (c) As shown in SEQ ID NO:

3.

2. The application of the oncolytic virus receptor fragment according to claim 1 in genetically modified CAR-T cells.

3. A genetically modified CAR-T cell, characterized in that, The genetically modified CAR-T cells are prepared by inserting the nucleotide sequence of the oncolytic virus receptor before or after the CAR sequence of the CAR-T cells; the oncolytic virus receptor is CR2 or / and CR3.

4. The genetically modified CAR-T cell according to claim 3, wherein, The nucleotide sequence of the oncolytic virus receptor CR2 is as shown in SEQ ID NO:1; the nucleotide sequence of the oncolytic virus receptor CR3 is as shown in SEQ ID NO:

2.

5. The genetically modified CAR-T cell according to claim 4, wherein The oncolytic virus receptor CR2 is protein A encoded by the nucleotide sequence shown in SEQ ID NO:1; or, The oncolytic virus receptor is protein B encoded by the nucleotide sequence shown in SEQ ID NO:2; or, The oncolytic virus receptor is protein C formed by fusing protein A encoded by the nucleotide sequence shown in SEQ ID NO:1 and protein B encoded by the nucleotide sequence shown in SEQ ID NO:2, and the nucleotide sequence of the fusion protein C is as shown in SEQ ID NO:

3.

6. The genetically modified CAR-T cell according to any one of claims 3-5, characterized in that, The CAR-T cells are B7H3-CAR-T cells; the oncolytic virus is VSVΔ51.

7. The application of the genetically modified CAR-T cells according to any one of claims 3-6 in the preparation of drugs for preventing or treating tumors.

8. The application according to claim 7, characterized in that, Load the oncolytic virus onto the genetically modified CAR-T cells according to any one of claims 3-6.

9. The application according to claim 8, characterized in that, The loading method is to co-incubate the oncolytic virus with the genetically modified CAR-T cells at 0°C.

10. The application according to claim 7, characterized in that The tumor is at least one of hematological tumors, gliomas, melanomas, breast cancers, head and neck cancers, lung cancers, colorectal cancers, pancreatic cancers, liver cancers, bladder cancers, ovarian cancers, sarcomas or cervical cancers; preferably gliomas.