Application of overexpressed bell AlbHLH175 gene in increasing tropane alkaloid and precursor content of tropane alkaloid
By overexpressing the AlbHLH175 gene of bells, the relevant biosynthetic genes are regulated, and the content of tropine alkaloids and their precursors in bells is significantly improved, and the problem of unresolved biosynthetic pathway of bells TAs is solved, and the gene resources of high-yield TAs are provided.
Patent Information
- Application Number
- CN202510589501.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-08
- Publication Date
- 2025-07-25
AI Technical Summary
In the prior art, the biosynthesis pathway of bell TAs has not been systematically analyzed, and the TAs content is low, making it difficult to increase the yield of tropine alkaloids and their precursors through biological breeding and metabolic engineering.
The bell AlbHLH175 gene is overexpressed, and the content of tropine alkaloids and its precursors is increased by positively regulating the biosynthetic genes of AlODC, AlPMT, AlMPO, AlPYKS, AlCYP82M3, AlPPAR and AlHDH.
The content of putrescine, N-methylputrescine, tropine, tropine, conchine, hopolamine and scopolamine has been significantly increased, providing a genetic resource for the bell seed new germplasm of high-yield TAs.
Smart Images

Figure CN120366371A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and specifically relates to the application of overexpressing the Anisodus luridus AlbHLH175 gene in increasing the content of tropane alkaloids and their precursors. Background Art
[0002] As anticholinergic drugs, TAs are included in the World Health Organization (WHO) Model List of Essential Medicines (WHO 2019) and are widely used clinically for preventing motion sickness, anesthesia analgesia, treating organophosphorus poisoning, and alleviating Alzheimer's disease, etc., with a large market demand. Generally speaking, the content of TAs in solanaceous plants producing TAs is generally low. Taking Atropa belladonna at the cultivation and harvest stage as an example, its hyoscyamine content is 0.25 - 0.33% (dry weight of leaves), and its scopolamine content is 0.03 - 0.06% (dry weight of leaves). Although de novo synthesis of hyoscyamine and scopolamine has been achieved in engineered yeast, their yields are extremely low, with the highest yields of hyoscyamine and scopolamine being 80 and 30 μg / L respectively, far from the industrial requirement of not less than 5 g / L. Therefore, commercial production of TAs will depend on plant materials not only currently but also for a long time in the future.
[0003] As a precious Tibetan medicinal material, Anisodus luridus has a long history of medicinal use. Due to its large biomass and high TAs content, it has become an important plant source for commercial production of TAs. Since high-throughput sequencing at the whole-genome level has not been completed, only 4 TAs biosynthetic genes, PMT, TRI, CYP80F1, and H6H, have been cloned and reported in Anisodus luridus so far, and the complete biosynthetic pathway of TAs has not been systematically and comprehensively elucidated, severely restricting the metabolic engineering research and breeding research of Anisodus luridus.
[0004] Therefore, it is urgent to obtain a high-quality Anisodus luridus genome, initially analyze the TAs biosynthetic pathway of Anisodus luridus at the whole-genome level, screen out the key transcription factors involved in TAs biosynthesis, which is of great significance for clarifying the molecular mechanism regulating TAs biosynthesis. Summary of the Invention
[0005] In view of this, one of the purposes of the present invention is to provide an application of overexpressing the Anisodus luridus AlbHLH175 gene in increasing the content of tropane alkaloids and their precursors. Another purpose of the present invention is to provide a plant cell with increased yields of tropane alkaloids and their precursors. The third purpose of the present invention is to provide a method for increasing the yields of tropane alkaloids and their precursors in plants.
[0006] To achieve the above purposes, the present invention provides the following technical solutions:
[0007] 1. Application of overexpressing Anisodus luridus AlbHLH175 gene in increasing the content of tropane alkaloids and their precursors, wherein the nucleic acid sequence of the Anisodus luridus AlbHLH175 gene is as shown in SEQ ID NO.3.
[0008] Preferably, the tropane alkaloids and their precursors are putrescine, N-methylputrescine, tropinone, tropine, conessine, hyoscyamine, anisodamine or scopolamine.
[0009] 2. A plant cell with increased production of tropane alkaloids and their precursors, wherein the plant cell contains the coding sequence of Anisodus luridus AlbHLH175 gene, and the AlbHLH175 gene is as shown in SEQ ID NO.3; the tropane alkaloids and their precursors are putrescine, N-methylputrescine, tropinone, tropine, conessine, hyoscyamine, anisodamine or scopolamine.
[0010] Preferably, the plant cell is Anisodus luridus cell.
[0011] Preferably, the AlbHLH175 gene increases the content of alkaloids and their precursors by positively regulating the biosynthesis genes of AlODC, AlPMT, AlMPO, AlPYKS, AlCYP82M3, AlPPAR and / or AlHDH.
[0012] 3. A method for increasing the production of tropane alkaloids and their precursors in plants, which comprises overexpressing Anisodus luridus AlbHLH175 gene in plants having a tropane alkaloid biosynthesis pathway, and the AlbHLH175 gene is as shown in SEQ ID NO.3.
[0013] Preferably, the plant is Anisodus luridus.
[0014] The beneficial effects of the present invention are as follows: The present invention obtained transgenic hairy root lines with overexpression and suppressed expression of the AlbHLH175 gene AlbHLH175, and analyzed the expression levels of AlbHLH175 and TAs biosynthetic genes, as well as the contents of TAs and important intermediates in the transgenic lines. The results showed that in the transgenic lines overexpressing AlbHLH175, the expression level of AlbHLH175 was significantly increased. The expression level of AlODC increased by 5.6 - 13.5 times, the expression level of AlPMT increased by 6.3 - 12.3 times, the expression level of AlMPO increased by 3.6 - 6.5 times, the expression level of AlPYKS increased by 5.1 - 9.7 times, the expression level of AlCYP82M3 increased by 2.8 - 5.3 times, the expression level of AlPPAR increased by 2.9 - 5.9 times, and the expression level of AlHDH increased by 2.1 - 6.3 times; the content of putrescine increased by 1.5 - 1.81 times, the content of N-methylputrescine increased by 1.37 - 2.13 times, the content of tropinone increased by 1.46 - 2.08 times, the content of tropine increased by 1.82 - 2.47 times, the content of hyoscyamine increased by 1.49 - 2.07 times, the content of scopolamine increased by 2.46 - 3.43 times, the content of anisodamine increased by 1.77 - 2.93 times, and the content of scopolamine increased by 1.91 - 2.5 times; it provides new excellent gene resources for creating new germplasms of Anisodus luridus with stable and high-yield TAs through biological breeding and molecular design. BRIEF DESCRIPTION OF THE DRAWINGS
[0015] In order to make the objectives, technical solutions, and beneficial effects of the present invention clearer, the present invention provides the following drawings for illustration:
[0016] Figure 1 Cloning results of the AlbHLH175 gene of Anisodus luridus (A: PCR electrophoresis map of AlbHLH175; B: CDS sequence);
[0017] Figure 2 Analysis of the conserved domain of AlbHLH175;
[0018] Figure 3 Tissue expression profile of AlbHLH175;
[0019] Figure 4Creation and positive identification of AlbHLH175 transgenic Hyoscyamus niger hairy roots (A: Resistance screening culture; B: Hairy root induction; C: Subculture; D: Scale-up culture; E: Detection of overexpressed AlbHLH175 gene in hairy roots; F: Detection of resistance screening gene NPTII in overexpressed hairy roots; G: Detection results of specific genes rol B and rolC in overexpressed hairy roots; H: Detection of AlbHLH175 gene in interference lines; I: Resistance screening gene NPTII in interference lines; J: Detection results of specific genes rol B and rolC in interference lines);
[0020] Figure 5 Analysis of the expression level of AlbHLH175 gene in overexpressed transgenic hairy roots;
[0021] Figure 6 Analysis of the expression levels of TAs biosynthetic genes in overexpressed AlbHLH175 transgenic hairy roots (A: AlODC; B: AlPMT; C: AlMPO; D: AlPYKS; E: AlCYP82M3; F: AlTRI; G: AlAT4; H: AlPPAR; I: AlUGT1; J: AlLS; K: AlCYP80F1; L: AlHDH; M: AlH6H);
[0022] Figure 7 Detection of the contents of TAs and intermediates in overexpressed AlbHLH175 transgenic hairy roots (A: Putrescine; B: N-Methylputrescine; C: Tropinone; D: Tropine; E: Conessine; F: Hyoscyamine; G: Anisodamine; H: Scopolamine. Error bars represent the standard errors of biological replicates (n≥3). Significance analysis was performed using a t-test, * indicates P<0.05, ** indicates P 0.01);
[0023] Figure 8 Analysis of the expression level of AlbHLH175 gene in RNAi-interfered transgenic hairy roots (Error bars represent the standard errors of biological replicates (n≥3); Significance analysis was performed using a t-test, ** indicates P<0.01);
[0024] Figure 9 Detection of the contents of TAs and intermediates in AlbHLH175 transgenic hairy roots with interference (A: Putrescine; B: N-Methylputrescine; C: Tropinone; D: Tropine; E: Conessine; F: Hyoscyamine; G: Anisodamine; H: Scopolamine. Error bars represent the standard errors of biological replicates (n≥3); Significance analysis was performed using a t-test, * indicates P<0.05, ** indicates P 0.01). Detailed implementation methods
[0025] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments, so that those skilled in the art can better understand the present invention and be able to implement it, but the embodiments cited do not limit the present invention.
[0026] Example 1: Cloning of the AlbHLH175 gene of Anisodus luridus
[0027] Based on the AlbHLH175 CDS sequence as a template, specific primers AlbHLH175-F and AlbHLH175-R were designed, and the specific sequences are as follows:
[0028] AlbHLH175-F: 5’-gcTCTAGAatggatgaacttgtctcctcct-3’ (SEQ ID NO.1);
[0029] AlbHLH175-R: 5’-gcGAGCTCctactgctgctctaagcttcta-3’ (SEQ ID NO.2).
[0030] Using the secondary root cDNA as a template, and SEQ ID NO.1 and SEQ ID NO.2 as primers for PCR amplification, the sequencing results of the PCR amplification products are as Figure 1 shown. The sequencing results show that the full length of the AlbHLH175 coding sequence (coding DNA sequences, CDS) is 1452 bp (SEQ ID NO.10), encoding 483 amino acids. It can be predicted by using the Expasy online web page that the isoelectric point of the AlbHLH175 protein is 5.43, and the molecular weight is 53.34 kDa. Phylogenetic analysis shows that AlbHLH175 is a member of the subfamily III of the bHLH family.
[0031] Analysis of the conserved domain of AlbHLH175: In order to verify that the cloned AlbHLH175 is a typical member of the bHLH family, the amino acid sequence of AlbHLH175 was input into the NCBI online web page to predict the conserved domain in this experiment. The results are as Figure 2 shown. The results show that AlbHLH175 has a basic / Helix-Loop-Helix (bHLH) domain composed of 60 amino acid residues. This conserved domain is composed of a basic domain that mediates DNA binding and a helix-loop-helix (HLH) domain that mediates the formation of dimers of transcription factors, and it is a typical bHLH family transcription factor.
[0032] Using the cDNA of the primary root (PR), secondary root (SR), stem, leaf, flower, and fruit of Anisodus luridus as templates for qPCR, the qPCR primers are as follows:
[0033] AlbHLH175-QF: 5’-TGCTTCAACATATTCTCAAT-3’ (SEQ ID NO.3);
[0034] AlbHLH175-QR: 5’-CGACCATCATCATCATTC-3’ (SEQ ID NO.4).
[0035] The tissue expression pattern of AlbHLH175 is as Figure 3 shown. The results show that the expression level of AlbHLH175 is the highest in the secondary roots, followed by the primary roots and flowers, and the lowest in the fruits.
[0036] Example 2: Construction of recombinant expression vector and genetic transformation
[0037] The cloned AlbHLH175 gene was digested with Xba I and Sac I, and then ligated to the expression vector pBI121 digested with Xba I and Sac I by T4 DNA ligase to obtain the target vector pBI121-AlbHLH175.
[0038] For the construction of the AlbHLH175 interference expression vector, a specific fragment with a size of approximately 300 bp of the AlbHLH175 coding sequence as shown in SEQ ID NO.5 was selected.
[0039] caaattaggactacttcatatgaaaacgtagaagttgaagtgaggattttgggtccagatgcaatgataagggtacaatcggaaaatgtgaattatc
[0040] catcaacaagattgatgagggcacttcaagatcttgaattacatgtccaccatgctagtatttcaagtgttaatgatttaatgttacaagacatagttgt
[0041] taaagttccacaaggattgggtactgaagatggattaaaaactgctcttcttagaagcttagagcagcagtagtaatagtagcagcatgtcgggat
[0042] gtgtgat
[0043] According to the designed sequence, KpnⅠ and XhoI restriction sites were introduced into the upstream primer, and BamH I and XbaI restriction sites were introduced into the downstream primer. The specific primers are as follows:
[0044] Ri-A1bHLH1-F1-KpnI-recombinant: 5’-TTTCCTTACCAATTGGGGTACCcaaattaggactac-3’(SEQ ID NO.6)
[0045] Ri-A1bHLH1-R1-XhoI-recombinant: 5’-GGAGAGGACACGCTCGAGatcacacatcccgacat-3’(SEQID NO.7);
[0046] Ri-A1bHLH1-F2-BamHI: gcGGATCCatggatcaaattaggactacttcat(SEQ ID NO.8);
[0047] Ri-A1bHLH1-R2-XbaI: gCTCTAGAatcacacatcccgacatg(SEQ ID NO.9);
[0048] This specific fragment was ligated to the intermediate vector pHANNIBAL in both forward and reverse directions. After successful sequencing verification, pHANNIBAL was digested with Sac I and Spe I and ligated to the interference expression vector pBIN19 digested with Sac I and Xba I, and finally the interference vector RNAi-AlbHLH175 was obtained.
[0049] The overexpression vector pBI121-AlbHLH175 and the interference expression vector RNAi-AlbHLH175 were respectively transformed into Agrobacterium tumefaciens C58C1, and the positive clones were used for subsequent genetic transformation of Anisodus luridus leaves. The infected Anisodus luridus leaves were placed on a selection medium supplemented with the corresponding antibiotics ( Figure 4 , A), and after the hairy roots grew out ( Figure 4 , B), they were respectively inoculated onto a screening medium for subculture ( Figure 4 , C). The hairy roots identified as positive by PCR were inoculated into a liquid medium for large-scale culture ( Figure 4 , D), and the hairy roots cultured for about 28 days will be used for subsequent gene expression analysis and content analysis.
[0050] Genomic DNA was extracted by the TPS simple method and used as a template for PCR amplification. The plasmids pBI121-AlbHLH175 and RNAi-AlbHLH175 were used as positive controls (P), and water was used as a negative control (N). The target gene AlbHLH175, the resistance screening gene NPTII, and the Ri plasmid-specific genes rol B and rol C were amplified respectively. The amplification results were observed by agarose gel electrophoresis ( Figure 4 , E–G). The results showed that the genes AlbHLH175, NPTII, rol B, and rol C were amplified in both the positive control and the overexpression lines (OE-2, OE-3, OE-6, OE-8, OE-10), while no amplification bands were observed in the negative control, indicating that OE-2, OE-3, OE-6, OE-8, and OE-10 were overexpression positive lines. Similarly, the genes AlbHLH175, NPTII, rol B, and rol C were detected in both the positive control and the interference lines (RI-3, RI-5, RI-6, RI-8, RI-9), and no bands were observed in the negative control ( Figure 4 , H–J), indicating that RI-3, RI-5, RI-6, RI-8, and RI-9 were inhibitory expression positive lines. In summary, transgenic hairy roots with overexpression and inhibitory expression of AlbHLH175 were successfully obtained in this experiment.
[0051] Example 3. Analysis of the expression level of AlbHLH175 and the alkaloid content in overexpressed transgenic hairy roots
[0052] Agrobacterium-mediated T-DNA insertion is random, and the number of inserted copies is also unequal. Even if it is successfully inserted into the plant genome, it may not necessarily initiate expression. Therefore, qPCR technology was used in this experiment to detect the expression of AlbHLH175 in overexpressed transgenic hairy roots. As Figure 5 shown, the expression levels of AlbHLH175 in the overexpression lines OE-2, OE-3, OE-6, OE-8, and OE-10 were all significantly increased. Compared with the vector control (CK), the expression level of AlbHLH175 was increased by 3.3 - 8.4 times.
[0053] Analysis of the expression levels of TAs biosynthetic genes in AlbHLH175 overexpressed transgenic hairy roots: qPCR technology was used to analyze the expression levels of TAs biosynthetic genes in AlbHLH175 overexpressed transgenic hairy roots. As Figure 6As shown, in the overexpression lines OE-2, OE-3, OE-6, OE-8, and OE-10, the expression levels of AlODC, AlPMT, AlMPO, AlPYKS, AlCYP82M3, AlPPAR, and AlHDH were significantly increased, while the expression levels of AlTRI, AlAT4, AlUGT1, AlLS, AlCYP80F1, and AlH6H did not change significantly. Compared with the control CK, the expression level of AlODC in the overexpression lines increased by 5.6 - 13.5 times, that of AlPMT increased by 6.3 - 12.3 times, that of AlMPO increased by 3.6 - 6.5 times, that of AlPYKS increased by 5.1 - 9.7 times, that of AlCYP82M3 increased by 2.8 - 5.3 times, that of AlPPAR increased by 2.9 - 5.9 times, and that of AlHDH increased by 2.1 - 6.3 times. The results indicate that AlbHLH175 can positively regulate the expression of seven biosynthetic genes, namely AlODC, AlPMT, AlMPO, AlPYKS, AlCYP82M3, AlPPAR, and AlHDH.
[0054] In the TAs biosynthetic pathway, products other than hyoscyamine, scopolamine, and anisodamine are collectively referred to as intermediate products. To explore the effects of AlbHLH175 overexpression on the contents of intermediate products and TAs in the TAs biosynthetic pathway, the contents of putrescine and N-methylputrescine were analyzed by HPLC, and the contents of tropine, tropinone, cuscohygrine, hyoscyamine, scopolamine, and anisodamine were analyzed by LC-MS. The results are as Figure 7 shown.
[0055] The results showed that in the overexpression lines OE-2, OE-3, OE-6, OE-8, and OE-10, the content of putrescine was 147.86 - 178.45 nmol / g FW, which was 1.5 - 1.81 times higher than that of the control hairy roots ( Figure 7 , A); the content of N-methylputrescine was 98.56 - 153.15 nmol / g FW, which was 1.37 - 2.13 times higher than that of the control hairy roots ( Figure 7 , B); the content of tropinone was 4.93 - 7.02 mg / g DW, which was 1.46 - 2.08 times higher than that of the control ( Figure 7 , C); the content of tropine was 2.25 - 3.05 mg / g DW, which was 1.82 - 2.47 times higher than that of the control ( Figure 7 , D); the content of cuscohygrine was 0.121 - 0.168 mg / g DW, which was 1.49 - 2.07 times higher than that of the control ( Figure 7 , E); the content of hyoscyamine was 2.76 - 3.85 mg / g DW, which was 2.46 - 3.43 times higher than that of the control hairy roots ( Figure 7, F); the content of anisodamine is 1.12 - 1.85 mg / g DW, which is 1.77 - 2.93 times higher than that of the control hairy roots ( Figure 7 , G); the content of scopolamine is 1.32 - 1.73 mg / g DW, which is 1.91 - 2.5 times higher than that of the control hairy roots ( Figure 7 , H). In summary, overexpression of AlbHLH175 can promote the accumulation of putrescine, N-methylputrescine, tropinone, tropine, conessine, hyoscyamine, anisodamine and scopolamine.
[0056] Example 4. Analysis of the expression level of AlbHLH175 and alkaloids in RNAi transgenic hairy roots
[0057] The qPCR technique was used to detect the expression of AlbHLH175 in RNAi transgenic hairy roots, and the results are as Figure 8 shown. The results showed that the expression level of AlbHLH175 was significantly reduced in the RNAi transgenic lines RI-3, RI-5, RI-6, RI-8, and RI-9. Compared with the control (CK), the expression level of AlbHLH175 decreased by 51.93% - 84.99%.
[0058] The contents of TAs and intermediates in the RNAi transgenic lines were analyzed by HPLC and LC-MS, and the results are as Figure 9 shown. The results showed that in the transgenic lines with interference, the content of putrescine was 56.13 - 74.96 nmol / g FW, which was 24.67 - 43.59% lower than that of the control ( Figure 9 , A), and the content of N-methylputrescine was 30.15 - 48.15 nmol / g FW.
[0059] It was 32.82 - 57.93% lower than that of the control hairy roots ( Figure 9 , B), the content of tropinone was 2.03 - 3.06 mg / g DW, which was 29.81 - 48.95% lower than that of the control hairy roots ( Figure 9 , C), the content of tropine was 0.48 - 0.77 mg / g DW, which was 31.85 - 57.52% lower than that of the control hairy roots ( Figure 9 , D), the content of conessine was 0.052 - 0.071 mg / g DW, which was 12.34 - 35.8% lower than that of the control hairy roots ( Figure 9 , E), the content of hyoscyamine was 0.58 - 0.84 mg / g DW, which was 36.84 - 56.39% lower than that of the control hairy roots ( Figure 9 , F), and the content of anisodamine was 0.16 - 0.27 mg / g DW, which was 25% - 55.55% lower than that of the control hairy roots ( Figure 9, G), the content of scopolamine was 0.33 - 0.62 mg / g DW, which was 21.51 - 58.22% lower than that of the control hairy roots ( Figure 9 , H).
[0060] In summary, in the RNAi - transgenic lines, the expression level of AlbHLH175 decreased, resulting in the reduction of the contents of putrescine, N - methylputrescine, tropinone, tropine, cuscohygrine, hyoscyamine, anisodamine and scopolamine, further proving that AlbHLH175 is a positive regulator of TAs biosynthesis.
[0061] The above - described embodiments are merely preferred embodiments given to fully illustrate the present invention, and the protection scope of the present invention is not limited thereto. Equivalent substitutions or transformations made by those skilled in the art on the basis of the present invention are all within the protection scope of the present invention. The protection scope of the present invention is subject to the claims.
Claims
1. Use of overexpressing Anisodus luridus AlbHLH175 gene in increasing the content of tropane alkaloids and their precursors, characterized in that: The nucleic acid sequence of the Anisodus luridus AlbHLH175 gene is shown as SEQ ID NO.
3.
2. The application according to claim 1, wherein: The tropane alkaloids and their precursors are putrescine, N-methylputrescine, tropinone, tropine, cuscohygrine, hyoscyamine, anisodamine or scopolamine.
3. A plant cell with increased production of tropane alkaloids and their precursors, characterized in that: The plant cell contains the coding sequence of the Anisodus luridus AlbHLH175 gene, and the AlbHLH175 gene is shown as SEQ ID NO.3; the tropane alkaloids and their precursors are putrescine, N-methylputrescine, tropinone, tropine, cuscohygrine, hyoscyamine, anisodamine or scopolamine.
4. The plant cell with increased production of tropane alkaloids and their precursors according to claim 3, characterized in that: The plant cell is an Anisodus luridus cell.
5. The plant cell with increased production of tropane alkaloids and their precursors according to claim 3, characterized in that: The AlbHLH175 gene increases the content of alkaloids and their precursors by positively regulating the biosynthesis genes of AlODC, AlPMT, AlMPO, AlPYKS, AlCYP82M3, AlPPAR and / or AlHDH.
6. A method for increasing the yield of tropane alkaloids and their precursors in plants, characterized in that: Overexpress the Anisodus luridus AlbHLH175 gene in a plant with a tropane alkaloid biosynthesis pathway, and the AlbHLH175 gene is shown as SEQ ID NO.
3.
7. The method according to claim 6, characterized in that: The plant is Anisodus luridus.
Citation Information
Cited By
Application of overexpression of antirrhinum majus AntbHLH16 gene in promoting synthesis of tropane alkaloids and precursors in hairy roots
CN122648464A