Primer group for amplifying mtDNA and application of primer group in preparation of kit

Abstract

The invention discloses a primer group for amplifying mtDNA and application of the primer group in preparation of a kit, belongs to the technical field of biomedicine, and particularly relates to the primer group for amplifying the mtDNA, the mtDNA comprises mtDNA P5, and the nucleotide sequence of the mtDNA P5 is shown as SEQ ID NO.5; the primer group of the mtDNA comprises a forward primer of the mtDNA P5 and a reverse primer of the mtDNA P5, the nucleotide sequence of the forward primer is as shown in SEQ ID NO.14, and the nucleotide sequence of the reverse primer is as shown in SEQ ID NO.15. The primer group of the mtDNA comprises the forward primer of the mtDNA P5 and the reverse primer of the mtDNA P5. The invention further provides application of the primer group for amplifying the mtDNA in preparation of the kit for detecting the lacunal cerebral infarction. The accurate quantitative relation between the CT value of the mtDNA and the lacuna cerebral infarction disease is found, and a brand new thought and a technical method are provided for early non-invasive accurate detection of the lacuna cerebral infarction.

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technologies, and particularly relates to a primer set for amplifying mtDNA and its application in the preparation of a kit. Background Art

[0002] As one of the disease categories with the highest lethality rate globally, vascular diseases are statistically on the rise in incidence every year. Thrombosis, as the core pathogenic link in diseases such as atherosclerosis and venous thromboembolism, mainly involves pathological mechanisms such as vascular endothelial injury, platelet activation, and hyperactivity of the coagulation cascade reaction. Lacunar infarction (LI) is one of the common types of cerebrovascular diseases, accounting for about 20% - 30% of ischemic cerebrovascular disease cases. It is easily overlooked due to its non - obvious early symptoms. Without timely intervention, the condition may progress, causing irreversible effects on the cognitive function of patients and even endangering the life safety of patients. The pathogenesis and disease progression of LI are related to vascular endothelial dysfunction, increased blood - brain barrier permeability, etc. Currently, the methods used clinically to evaluate the risk of cerebral infarction mainly include clinical symptom assessment, hematological examinations (such as coagulation function tests, D - dimer tests, etc.), imaging examinations, etc. However, these methods have certain limitations. For example, clinical symptom assessment relies on the subjective feelings of patients and the experience of doctors, and early symptoms may not be obvious, easily leading to missed diagnoses; the traditional indicators in hematological examinations have room for improvement in terms of specificity and sensitivity, and false - positive or false - negative results may occur; although imaging examinations can directly show the location and size of cerebral infarction, they can usually only be detected at a certain stage after infarction formation, making it difficult to achieve early warning. Therefore, establishing a precise early LI risk assessment system has become an urgent clinical problem to be solved.

[0003] In recent years, studies have found that the leakage of mitochondrial DNA (mtDNA) is a key link in inducing inflammatory responses and vascular endothelial dysfunction. mtDNA is a genetic material present in mitochondria. When cells are damaged or stressed, the permeability of the mitochondrial membrane changes, leading to the possible release of mtDNA into the extracellular space and entering the blood circulation. However, there is no prior art disclosing the relevant research progress on detecting LI based on mtDNA. Summary of the Invention

[0004] To solve the above - mentioned technical problems, the present invention provides a primer set for amplifying mtDNA and its application in the preparation of a kit, discovers the precise quantitative relationship between the CT values of 5 mtDNAs and the occurrence of lacunar infarction, breaks through the limitations of traditional detection indicators, and provides a new idea and technical method for the early non - invasive and precise detection of lacunar infarction.

[0005] To achieve the above object, the present invention provides a primer set for amplifying mtDNA, wherein the mtDNA includes mtDNA P5, and the nucleotide sequence of mtDNA P5 is as shown in SEQ ID NO.5; the primer set of mtDNA includes a forward primer of mtDNA P5 and a reverse primer of mtDNA P5, and the nucleotide sequence of the forward primer of mtDNA P5 is as shown in SEQ ID NO.14, and the nucleotide sequence of the reverse primer of mtDNA P5 is as shown in SEQ ID NO.15.

[0006] Preferably, the mtDNA further includes mtDNA P1, mtDNA P2, mtDNA P3 and mtDNA P4, the nucleotide sequence of mtDNA P1 is as shown in SEQ ID NO.1, the nucleotide sequence of mtDNA P2 is as shown in SEQ ID NO.2, the nucleotide sequence of mtDNA P3 is as shown in SEQ ID NO.3, and the nucleotide sequence of mtDNA P4 is as shown in SEQ ID NO.4; the primer set of mtDNA includes a forward primer of mtDNA P1, a reverse primer of mtDNA P1, a forward primer of mtDNA P2, a reverse primer of mtDNA P2, a forward primer of mtDNA P3, a reverse primer of mtDNA P3, a forward primer of mtDNA P4 and a reverse primer of mtDNA P4, the nucleotide sequence of the forward primer of mtDNA P1 is as shown in SEQ ID NO.6, the nucleotide sequence of the reverse primer of mtDNA P1 is as shown in SEQ ID NO.7, the nucleotide sequence of the forward primer of mtDNA P2 is as shown in SEQ ID NO.8, the nucleotide sequence of the reverse primer of mtDNA P2 is as shown in SEQ ID NO.9, the nucleotide sequence of the forward primer of mtDNA P3 is as shown in SEQ ID NO.10, the nucleotide sequence of the reverse primer of mtDNA P3 is as shown in SEQ ID NO.11, the nucleotide sequence of the forward primer of mtDNA P4 is as shown in SEQ ID NO.12, and the nucleotide sequence of the reverse primer of mtDNA P4 is as shown in SEQ ID NO.13.

[0007] The present invention also provides an application of the primer set for amplifying mtDNA in the preparation of a kit for detecting lacunar infarction.

[0008] Preferably, the primer set for amplifying mtDNA is used to amplify mtDNA, and the relationship between the CT value of mtDNA and the incidence of lacunar infarction is determined as follows: when the age > 50 years old and the CT value of mtDNA P5 ≤ 29, the patient is diagnosed with lacunar infarction; when the age > 50 years old, the CT value of mtDNA P5 > 29, and the CT values of at least two of mtDNA P1, mtDNA P2, mtDNA P3, and mtDNA P4 ≤ 29, the lacunar infarction is diagnosed; when the age > 50 years old, the CT value of mtDNA P5 > 29, and the CT values of at most one of mtDNA P1, mtDNA P2, mtDNA P3, and mtDNA P4 ≤ 29, it is confirmed that the patient does not have lacunar infarction.

[0009] The present invention also provides a kit for detecting lacunar infarction, including the primer set for amplifying mtDNA.

[0010] The present invention also provides a method for detecting lacunar infarction not for the purpose of disease diagnosis and treatment, including the following steps: collecting a serum sample of a person to be tested, extracting DNA, using the extracted DNA as a template, and performing real-time fluorescence quantitative PCR amplification with the primer set for amplifying mtDNA to confirm the CT value of each mtDNA and determine the relationship between the CT value of mtDNA and the incidence of lacunar infarction.

[0011] Preferably, the relationship between the CT value of mtDNA and the incidence of lacunar infarction is determined as follows: when the age > 50 years old and the CT value of mtDNA P5 ≤ 29, the patient is diagnosed with lacunar infarction; when the age > 50 years old, the CT value of mtDNA P5 > 29, and the CT values of at least two of mtDNA P1, mtDNA P2, mtDNA P3, and mtDNA P4 ≤ 29, the lacunar infarction is diagnosed; when the age > 50 years old, the CT value of mtDNA P5 > 29, and the CT values of at most one of mtDNA P1, mtDNA P2, mtDNA P3, and mtDNA P4 ≤ 29, it is confirmed that the patient does not have lacunar infarction.

[0012] Compared with the prior art, the present invention has the following advantages and technical effects: The present invention found that through real-time fluorescence quantitative PCR research on 53 clinical samples, it revealed the precise quantitative relationship between the CT values of 5 mtDNAs, namely mtDNA P1, mtDNA P2, mtDNA P3, mtDNA P4, and mtDNA P5, in clinical serum samples and the LI risk, confirmed that the inflammatory response caused by mtDNA leakage leads to vascular endothelial dysfunction and aggravates the formation of LI, breaking through the limitations of traditional detection indicators, providing a new idea and technical method for the early non-invasive and precise detection of LI, and this method has high specificity and sensitivity.

[0013] The detection method of the present invention is easy to operate. Through real-time fluorescence quantitative PCR, the CT value can be quickly and accurately detected, providing an efficient means for clinical diagnosis. Brief Description of the Drawings

[0014] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required to be used in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.

[0015] Figure 1 It is the analysis result of the correlation between the CT values of 5 mtDNAs and whether there is lacunar infarction. Among them, A is mtDNAP1, B is mtDNA P2, C is mtDNA P3, D is mtDNA P4, E is mtDNA P5. In the figure, Non-LI indicates not having lacunar infarction, and LI indicates having lacunar infarction; Figure 2 It is the flow chart of the present invention's research on whether mtDNA is related to lacunar infarction. Detailed Embodiments

[0016] Now, the various exemplary embodiments of the present invention will be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0017] It should be understood that the terms described in the present invention are only for describing specific embodiments and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0018] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although this invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of this invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to those documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0019] Without departing from the scope or spirit of this invention, various improvements and changes can be made to the specific embodiments of the specification of this invention, which are obvious to those skilled in the art. Other embodiments obtained from the specification of this invention are obvious to those skilled in the art. The specification and examples of this invention are merely exemplary.

[0020] Regarding the use of "comprising", "including", "having", "containing", etc. herein, they are all open-ended terms, meaning including but not limited to.

[0021] Example 1 I. Sample collection: Select 53 clinical patients, and collect 2 mL of their blood samples respectively. After standing at 4°C for 30 min until the blood coagulates, centrifuge at 1500 g for 15 min at 4°C to obtain serum samples, and store the serum samples in a -80°C refrigerator for later use.

[0022] II. DNA extraction: The DNA extraction kit was purchased from Shanghai Xingqi Baidai Biotechnology Co., Ltd., and the specific operation steps are as follows: ① Thaw the serum sample at room temperature. Take a 1.5 mL centrifuge tube, add 200 uL of the serum sample, 180 μL of lysis solution, 3 μL of digestion solution A and 20 μL of digestion solution B, mix well by oscillation, and incubate in a 65°C water bath for 10 min.

[0023] ② Add 400 μL of isopropanol and mix well. If there is a translucent suspension, it does not affect the DNA extraction and subsequent experiments.

[0024] ③ Place the adsorption column back into the collection tube, transfer the above solution to the adsorption column, centrifuge at 12000 rpm for 1 min, and discard the waste liquid in the collection tube.

[0025] ④ Place the adsorption column back into the collection tube, add 500 μL of washing solution A to the adsorption column, let it stand for 1 min, centrifuge at 12000 rpm for 1 min, and discard the waste liquid in the tube.

[0026] ⑤ Place the adsorption column back into the collection tube, add 500 μL of Wash Buffer B to the adsorption column, centrifuge at 12,000 rpm for 1 min, and discard the waste liquid in the tube.

[0027] ⑥ Repeat step ⑤.

[0028] ⑦ Take 40 μL of the eluent for each sample, place it in a 1.5 mL centrifuge tube, and preheat at 65 °C.

[0029] ⑧ Place the adsorption column back into the collection tube, centrifuge at 12,000 rpm for 2 min to remove the remaining wash buffer.

[0030] ⑨ Take out the adsorption column, place it back into a new sterile 1.5 mL tube, add 40 μL of preheated eluent to the adsorption column, let it stand for 2 min, centrifuge at 12,000 rpm for 1 min, collect the DNA solution, and after measuring and adjusting the concentration of the extracted DNA, it can be used for the next experiment or stored at -20 °C.

[0031] III. Real-time fluorescence quantitative PCR reaction: Reaction system (20 μL): 1 μL of forward primer (10 μM); 1 μL of reverse primer (10 μM); 10 μL of PowerUp™ SYBR™ Green Premix; 4 μL of DNA (10 ng / μL) template; 4 μL of RNase-free water.

[0032] Reaction conditions are as follows: Activate UDG enzyme at 95 °C for 2 min, pre-denature at 95 °C for 2 min; then perform 40 cycles, each cycle including denaturation at 95 °C for 15 s, annealing and extension at 60 °C for 15 s, and extension at 72 °C for 1 min, and collect fluorescence signals during the annealing and extension stage.

[0033] Table 1 Nucleotide sequences of specific primers for mtDNA ; The nucleotide sequence of human mtDNA is derived from the NCBI database, NCBI Reference Sequence: NC_012920.1, with a full length of 16,569 bp.

[0034] The nucleotide sequence of mtDNA P1 is shown in SEQ ID NO.1, SEQ ID NO.1: ccccctccccatgcttacaagcaagtacagcaatcaaccctcaactatcacacatcaactgcaactccaaagccacccctcacccactaggataccaacaaacctacccacccttaacagtacatagtacataaagccatttaccgtacatagcacattacagtcaaatcccttctcgtccccatggatgacccccctcagataggggtcccttgaccaccatcctccgtgaaatcaatatcccgcacaagagtgctactctcctcgctccgggcccataacacttgggggtagctaaagtgaactgtatccg。

[0035] The nucleotide sequence of mtDNA P2 is shown in SEQ ID NO.2, SEQ ID NO.2: acatctggttcctacttcagggtcataaagcctaaatagcccacacgttccccttaaataagacatcacgat。

[0036] The nucleotide sequence of mtDNA P3 is shown in SEQ ID NO.3, SEQ ID NO.3: tcataaagcctaaatagcccacacgttccccttaaataagacatcacgat。

[0037]

[0038]

[0039] IV. CT Value Detection and Judgment: The CT value refers to the number of amplification cycles required for the fluorescence signal to reach a pre-set threshold. The CT values corresponding to each mtDNA are detected by a real-time fluorescence quantitative PCR instrument, and the CT values are statistically analyzed and correlated with those of clinical patients with lacunar infarction.

[0040] V. Statistical Analysis of Experimental Results: In this study, serum samples of 53 clinical patients were collected. After extracting serum DNA, real-time fluorescence quantitative PCR was performed, and the CT values corresponding to 5 mtDNAs were analyzed. A CT value ≤ 29 was defined as positive (+), and a CT value > 29 was defined as negative (-). The information statistics of all clinical patient samples are shown in Table 2 below, and the analysis of the relationship between mtDNA P5 and lacunar infarction (LI) is shown in Table 3 below.

[0041] Table 2 Information Statistics of Clinical Patient Samples ; ; Note: In the table, "+" represents a CT value ≤ 29, defined as positive; "-" in the table represents a CT value > 29, defined as negative.

[0042] Table 3 Analysis Results of the Relationship between mtDNA P5 and Lacunar Infarction ; According to Table 3, when the CT value of mtDNA P5 ≤ 29 and the age > 50 years, the patient is diagnosed with lacunar infarction. When the CT value of mtDNA P5 ≤ 29 and the age ≤ 50 years, none of them have LI; when the age > 50 years and the CT value of mtDNA P5 > 29, there are two situations of having or not having LI, so this group of data is further analyzed.

[0043] Table 4 Information Statistics of Those with Age > 50 Years and CT Value of mtDNA P5 > 29 ; Table 5 Disease Analysis of Those with Age > 50 Years and CT Value of mtDNA P5 > 29 ; As shown in Table 4 and Table 5 above, among those with age > 50 years and CT value of mtDNA P5 > 29, at least two of the CT values of P1, P2, P3, and P4 mtDNAs ≤ 29, and they are diagnosed with lacunar infarction.

[0044] In summary, when the age > 50 years old and the CT value of mtDNA P5 ≤ 29, the patient is diagnosed with lacunar infarction; when the age > 50 years old, the CT value of mtDNA P5 > 29, and the CT values of at least two of mtDNA P1, mtDNA P2, mtDNA P3, and mtDNA P4 ≤ 29, the patient is diagnosed with lacunar infarction; when the age > 50 years old, the CT value of mtDNA P5 > 29, and the CT values of at most one of mtDNA P1, mtDNA P2, mtDNA P3, and mtDNA P4 ≤ 29, it is confirmed that the patient does not have lacunar infarction; when the age ≤ 50 years old and the CT value of mtDNA P5 ≤ 29, it is confirmed that the patient does not have lacunar infarction; when the age ≤ 50 years old and the CT value of mtDNA P5 > 29, it is confirmed that the patient does not have lacunar infarction.

[0045] The above-described embodiments are only descriptions of the preferred embodiments of the present invention and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. A primer set for amplifying mtDNA, characterized in that, The mtDNA includes mtDNA P5, and the nucleotide sequence of the mtDNA P5 is shown as SEQ ID NO.5; the primer set of the mtDNA includes a forward primer of mtDNA P5 and a reverse primer of mtDNA P5, the nucleotide sequence of the forward primer of mtDNA P5 is shown as SEQ ID NO.14, and the nucleotide sequence of the reverse primer of mtDNA P5 is shown as SEQ ID NO.

15.

2. The primer set for amplifying mtDNA according to claim 1, wherein The mtDNA further includes mtDNA P1, mtDNA P2, mtDNA P3, and mtDNA P4, the nucleotide sequence of the mtDNA P1 is shown as SEQ ID NO.1, the nucleotide sequence of the mtDNA P2 is shown as SEQ ID NO.2, the nucleotide sequence of the mtDNA P3 is shown as SEQ ID NO.3, and the nucleotide sequence of the mtDNA P4 is shown as SEQ ID NO.4; the primer set of the mtDNA includes a forward primer of mtDNA P1, a reverse primer of mtDNA P1, a forward primer of mtDNA P2, a reverse primer of mtDNA P2, a forward primer of mtDNA P3, a reverse primer of mtDNA P3, a forward primer of mtDNA P4, and a reverse primer of mtDNA P4, the nucleotide sequence of the forward primer of mtDNAP1 is shown as SEQ ID NO.6, the nucleotide sequence of the reverse primer of mtDNA P1 is shown as SEQ ID NO.7, the nucleotide sequence of the forward primer of mtDNA P2 is shown as SEQ ID NO.8, the nucleotide sequence of the reverse primer of mtDNA P2 is shown as SEQ ID NO.9, the nucleotide sequence of the forward primer of mtDNA P3 is shown as SEQ ID NO.10, the nucleotide sequence of the reverse primer of mtDNA P3 is shown as SEQ ID NO.11, the nucleotide sequence of the forward primer of mtDNA P4 is shown as SEQ ID NO.12, and the nucleotide sequence of the reverse primer of mtDNA P4 is shown as SEQ ID NO.

13.

3. Use of the primer set for amplifying mtDNA according to claim 1 or 2 in the preparation of a kit for detecting lacunar infarction.

4. The application according to claim 3, wherein Using the primer set for amplifying mtDNA, amplify mtDNA and determine the relationship between the CT value of mtDNA and the incidence of lacunar infarction, specifically: when the age > 50 years old and the CT value of mtDNA P5 ≤ 29, the patient is diagnosed with lacunar infarction; when the age > 50 years old, the CT value of mtDNA P5 > 29, and the CT values of at least two of mtDNA P1, mtDNA P2, mtDNA P3, and mtDNA P4 ≤ 29, the patient is diagnosed with lacunar infarction; when the age > 50 years old, the CT value of mtDNA P5 > 29, and the CT values of at most one of mtDNA P1, mtDNA P2, mtDNA P3, and mtDNA P4 ≤ 29, it is confirmed that the patient does not have lacunar infarction.

5. A kit for detecting lacunar infarction, characterized in that, Comprising the primer set for amplifying mtDNA according to claim 1 or 2.

6. A method for detecting lacunar infarction that is not for the purpose of diagnosing and treating diseases, characterized in that, Comprising the following steps: Collect the serum sample of the subject to be tested, extract DNA, use the extracted DNA as a template, and perform real-time fluorescence quantitative PCR amplification with the primer set for amplifying mtDNA described in claim 1 or 2 to confirm the CT value of each mtDNA and determine the relationship between the CT value of mtDNA and the incidence of lacunar infarction.

7. The method for detecting lacunar infarction according to claim 6, wherein, The determination of the relationship between the CT value of mtDNA and the incidence of lacunar infarction is specifically: when the age > 50 years old and the CT value of mtDNA P5 ≤ 29, the patient is diagnosed with lacunar infarction; when the age > 50 years old, the CT value of mtDNA P5 > 29, and the CT values of at least two of mtDNA P1, mtDNA P2, mtDNA P3, and mtDNA P4 ≤ 29, the patient is diagnosed with lacunar infarction; when the age > 50 years old, the CT value of mtDNA P5 > 29, and the CT values of at most one of mtDNA P1, mtDNA P2, mtDNA P3, and mtDNA P4 ≤ 29, it is confirmed that the patient does not have lacunar infarction.

Images