Application of substance for detecting SLAMF8 in preparation of product for screening and diagnosing prostatic cancer and detection kit

Abstract

The invention provides application of a substance for detecting SLAMF8 in preparation of a product for screening and diagnosing prostatic cancer and a detection kit, and relates to the technical field of biology. The invention finds that the SLAMF8 can be used as a diagnostic marker of prostatic cancer, and a primer pair with nucleotide sequences as shown in SEQ ID NO.2 and 3 is used; the kit of the primer probe group of the probe with the nucleotide sequence as shown in SEQ ID NO.4 can efficiently diagnose the prostatic cancer.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to the application of a substance for detecting SLAMF8 in the preparation of a product for screening and diagnosing prostate cancer and a detection kit. Background Art

[0002] Prostate cancer is one of the common male malignant tumors, and there are various detection methods and kits available for its diagnosis and prognosis judgment, mainly including the following:

[0003] Prostate-specific antigen (PSA) detection kit: PSA refers to a protein secreted by prostate tissue, and its detection result can be used for prostate cancer screening and diagnosis. The advantage is simplicity and easy operation, but its disadvantage is that PSA has low specificity, resulting in false positive and false negative results.

[0004] PCA3 detection kit: PCA3 is a gene unique to prostate cancer cells. This detection method detects whether a patient has prostate cancer by the concentration of PCA3 in urine samples. The advantage is that it is not sensitive to false positive interference, but its disadvantage is that its sensitivity is lower than that of PSA detection.

[0005] PHI (Prostate Health Index) detection kit: PHI is an index composed of prostate-specific antigen (PSA), free PSA (fPSA), and human kallikrein 2 (hK2), which is helpful in the diagnosis and prognosis prediction of prostate cancer. The advantage is that the combination of PHI helps to reduce false positive results, but its disadvantage is that PSA has a certain impact on PHI and the cost is relatively high.

[0006] Prolaris gene detection kit: The Prolaris gene detection kit evaluates the prognosis and treatment response of prostate cancer based on tumor-related genes, combined with the clinical data of patients, through the RNA level in the in-situ pathological tissue of the detected patients. The advantage is that it can help identify high-risk cases and provide more accurate guidance for treatment, but its disadvantage is that it is relatively expensive and requires high-level technical personnel for data interpretation.

[0007] Enriching the diagnostic markers of prostate cancer and improving prostate cancer detection products can help to improve the diagnostic defects of prostate cancer in the existing technology.

[0008] In view of this, the present invention is specifically proposed. Summary of the Invention

[0009] The object of the present invention is to provide the application of a substance for detecting SLAMF8 in the preparation of a product for diagnosing prostate cancer, and a kit for diagnosing prostate cancer, so as to enrich the diagnostic markers of prostate cancer and improve prostate cancer detection products.

[0010] To solve the above technical problems, the present invention specifically adopts the following technical solutions:

[0011] The SLAMF8 gene (Signaling Lymphocyte Activation Molecule Family Member 8), also known as CD353 and BLAME (B-lymphocyte Activation Molecule), is a transmembrane immunoglobulin superfamily protein. In the human body, SLAMF8 is mainly expressed in immune cells in lymphoid tissues, bone marrow, spleen, gastrointestinal epithelial cells, liver, lung and other tissues. Research shows that SLAMF8 is related to the activation, proliferation and differentiation of various immune cells, including T lymphocytes, B lymphocytes, dendritic cells, myeloid cells and granulocytic cells. Specifically, SLAMF8 is closely related to the biological functions of T lymphocytes. It can promote T cell apoptosis, regulate T cell differentiation and promote T cell proliferation. In addition, SLAMF8 can also participate in the maturation and regulation of dendritic cells, regulate the activation and proliferation of B cells, and regulate the differentiation of granulocytic cells. The present invention discovers that the content level of SLAMF8 is related to prostate cancer. SLAMF8 has a higher transcriptional level in samples with prostate cancer, so it can be used as a diagnostic marker for prostate cancer.

[0012] Based on this discovery, in the first aspect, there is provided the use of a substance for detecting SLAMF8 in the preparation of a product for diagnosing prostate cancer.

[0013] In an optional embodiment, the diagnosis of prostate cancer includes one or more of prostate cancer screening (such as early prostate cancer screening), prostate cancer diagnosis, prostate cancer recurrence diagnosis, prostate cancer metastasis prediction and prostate cancer prognosis prediction.

[0014] SLAMF8 is used as a diagnostic marker for the diagnosis of prostate cancer. SLAMF8 as a diagnostic marker includes but is not limited to proteins or nucleic acids. When it is a nucleic acid, it can be DNA or RNA. That is, SLAMF8 can, for example but not limited to, represent the expression level or activity of proteins, the transcriptional level of RNA or the content of DNA in a sample.

[0015] In an optional embodiment, the target substance to be detected includes nucleic acids encoding SLAMF8, including but not limited to mRNA or cDNA encoding the SLAMF8 gene.

[0016] In an optional embodiment, the target substance to be detected includes mRNA of the SLAMF8 gene.

[0017] In an optional embodiment, the substance for detecting SLAMF8 includes reagents and / or instruments for detecting SLAMF8.

[0018] In alternative embodiments, the substances for detecting SLAMF8 include, but are not limited to, reagents and / or instruments for detecting proteins and / or nucleic acids related to SLAMF8. These include, but are not limited to, reagents and / or instruments required for reverse transcription, PCR amplification reaction, qPCR amplification reaction, RT-PCR amplification reaction, ELISA detection method, immunoblotting method, immunomagnetic bead detection, chemiluminescence method, or immunochromatographic test strip, etc. Depending on the specific detection means, those skilled in the art can select the substances for detecting SLAMF8 according to the methods described in general and more specific textbooks, reference documents, process manuals, product instructions, and standard documents, etc. The present invention does not limit this.

[0019] In alternative embodiments, the substances for detecting SLAMF8 include primer-probe sets.

[0020] In alternative embodiments, the nucleotide sequence of the target fragment amplified by the primer-probe set is as shown in SEQ ID NO.1.

[0021] In alternative embodiments, the primer-probe set for detecting SLAMF8 includes a primer pair with nucleotide sequences as shown in SEQ ID NO.2 and 3; and a probe with a nucleotide sequence as shown in SEQ ID NO.4, and the probe is modified with a luminescent label and a quenching label.

[0022] In alternative embodiments, the test samples of the products for diagnosing prostate cancer can be derived from conventional samples used in clinical tests in the art, including but not limited to blood (plasma or serum), cells, tissues, body fluids, and secretions, etc. More specific examples include but are not limited to pharyngeal secretions, or exfoliated cells in urine, etc.

[0023] In alternative embodiments, the products for diagnosing prostate cancer further include at least one of enzymes for amplification reaction, buffer components, metal ions, salts, fluorescent dyes, surfactants, dNTPs, primer-probe sets for amplifying internal standard genes, positive controls, and negative controls.

[0024] In alternative embodiments, the nucleotide sequence of the target fragment of the primer-probe set for amplifying the internal standard gene is as shown in SEQ ID NO.5, and it is derived from the ABL1 gene.

[0025] In alternative embodiments, the primer-probe set for amplifying the internal standard gene includes a primer pair with nucleotide sequences as shown in SEQ ID NO.6 and 7; and a probe with a nucleotide sequence as shown in SEQ ID NO.8, and the probe is modified with a luminescent label and a quenching label.

[0026] In an alternative embodiment, the luminescent markers of each probe are independently selected from FAM, VIC, TET, JOE, HEX, CY3, CY5, TAMRA, ROX, Texas Red or CY5.5.

[0027] In an alternative embodiment, the quenching markers of each probe are independently selected from BHQ1, BHQ2, BHQ3 or MGB.

[0028] In an alternative embodiment, the luminescent marker is labeled at the 5'-end of the probe, and the quenching marker is labeled at the 3'-end of the probe.

[0029] In an alternative embodiment, the luminescent markers and / or quenching markers labeled on the probe for detecting SLAMF8 and the probe for detecting the internal reference gene can be the same or different.

[0030] In an alternative embodiment, when the content of SLAMF8 in the test sample is higher than that in the normal sample, the test sample is determined to be a prostate cancer sample. The normal sample is a sample that has been determined to be free of prostate cancer by an acceptable standard known in the art.

[0031] In an alternative embodiment, when the content ratio of SLAMF8 mRNA and internal reference mRNA in the test sample is higher than that in the normal sample, the test sample is determined to be a prostate cancer sample.

[0032] In an alternative embodiment, when the content ratio of SLAMF8 mRNA and internal reference mRNA in the test sample is higher than 0.3543, it is determined to be a prostate cancer sample.

[0033] In an alternative embodiment, the mRNA content of human SLAMF8 gene is detected by a one-step real-time fluorescence RT-PCR detection method and the double standard curve quantification principle.

[0034] In a second aspect, a primer-probe set for detecting SLAMF8 is also provided, including a primer pair with nucleotide sequences shown in SEQ ID NO.2 and 3; and a probe with a nucleotide sequence shown in SEQ ID NO.4, and the probe is modified with a luminescent marker and a quenching marker. This primer-probe set can quantitatively detect SLAMF8 within a linear range of 10 - 10000 copies / μL.

[0035] In an alternative embodiment, the luminescent marker of the probe shown in SEQ ID NO.4 is selected from FAM, VIC, TET, JOE, HEX, CY3, CY5, TAMRA, ROX, Texas Red or CY5.5.

[0036] In an alternative embodiment, the quenching label of the probe shown in SEQ ID NO.4 is selected from BHQ1, BHQ2, BHQ3 or MGB.

[0037] In an alternative embodiment, the luminescent label is labeled at the 5'-end of the probe shown in SEQ ID NO.4, and the quenching label is labeled at the 3'-end of the probe shown in SEQ ID NO.4.

[0038] In a third aspect, there is also provided a kit for diagnosing prostate cancer, which kit comprises the primer-probe set for detecting SLAMF8 of the second aspect.

[0039] In an alternative embodiment, it further comprises at least one of an enzyme for amplification reaction, buffer components, metal ions, salts, fluorescent dyes, surfactants, dNTPs, a primer-probe set for amplifying an internal standard gene, a positive control and a negative control.

[0040] In an alternative embodiment, the nucleotide sequence of the target fragment of the primer-probe set for amplifying the internal standard gene is as shown in SEQ ID NO.5, and it is derived from the ABL1 gene.

[0041] In an alternative embodiment, the primer-probe set for amplifying the internal standard gene comprises a primer pair with nucleotide sequences as shown in SEQ ID NOs.6 and 7; and a probe with a nucleotide sequence as shown in SEQ ID NO.8, and the probe is modified with a luminescent label and a quenching label.

[0042] In an alternative embodiment, the luminescent label of the probe shown in SEQ ID NO.8 is selected from FAM, VIC, TET, JOE, HEX, CY3, CY5, TAMRA, ROX, Texas Red or CY5.5.

[0043] In an alternative embodiment, the quenching label of the probe shown in SEQ ID NO.8 is selected from BHQ1, BHQ2, BHQ3 or MGB.

[0044] In an alternative embodiment, the luminescent label is labeled at the 5'-end of the probe shown in SEQ ID NO.8, and the quenching label is labeled at the 3'-end of the probe shown in SEQ ID NO.8.

[0045] In a fourth aspect, there is also provided a method for detecting SLAMF8 for non-diagnostic and non-therapeutic purposes, which comprises using the primer-probe set for detecting SLAMF8 of the second aspect, or the kit of the third aspect to amplify the product to be tested.

[0046] In an alternative embodiment, the mRNA content of the human SLAMF8 gene is detected by a one-step real-time fluorescence RT-PCR detection method and the dual standard curve quantification principle.

[0047] Compared with the prior art, the present invention has the following beneficial effects:

[0048] The present invention discovers that SLAMF8 is related to prostate cancer and is up-regulated in prostate cancer. The present invention uses it as a diagnostic marker and finds that the sensitivity and specificity as a diagnostic marker can reach more than 90%. Based on this discovery, the present invention provides the application of a substance for detecting SLAMF8 in the preparation of a product for diagnosing prostate cancer. The detection samples of the kit prepared with SLAMF8 as a diagnostic marker are flexible. Pharyngeal secretions or exfoliated cells in urine and other samples can be used. Collecting samples is non-invasive, convenient for large-scale screening, and real-time follow-up monitoring of prognosis, which is beneficial to the diagnosis, recurrence, and metastasis prediction of prostate cancer, as well as the judgment of treatment efficacy.

[0049] The present invention also provides a primer-probe set for detecting SLAMF8 and a detection kit containing the same, with a sensitivity of up to 10 copies / μL; and it can specifically amplify the SLAMF8 gene, without amplifying human cDNA and gDNA, having good specificity and sensitivity. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following will briefly introduce the drawings required for the description of the specific embodiments or the prior art. Obviously, the following drawings are some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0051] Figure 1 It is the amplification curve of SLAMF8 and the internal standard amplification curve in Example 2 of the present invention;

[0052] Figure 2 It is the internal standard standard curve in Example 2 of the present invention;

[0053] Figure 3 It is the SLAMF8 standard curve in Example 2 of the present invention;

[0054] Figure 4 It is the amplification result of clinical sample gDNA in Example 3 of the present invention;

[0055] Figure 5 It is the amplification result of clinical sample cDNA in Example 3 of the present invention;

[0056] Figure 6 It is the Ct values of the SLAMF8 gene and the internal standard gene in Example 5 of the present invention;

[0057] Figure 7Concentrations of SLAMF8 gene mRNA and internal reference gene mRNA in Example 5 of the present invention (* indicates P value of T-test < 0.05);

[0058] Figure 8 Ratio of mRNA content of SLAMF8 gene to internal reference gene in Example 5 of the present invention;

[0059] Figure 9 ROC curve in Example 5 of the present invention (* indicates P value of T-test < 0.05). Detailed implementation manners

[0060] The technical solutions of the present invention will be clearly and completely described below in conjunction with the embodiments. Obviously, the described embodiments are some, but not all, of the embodiments of the present invention. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0061] Example 1

[0062] This example provides a kit for diagnosing prostate cancer, including a primer-probe composition for detecting the SLAMF8 gene and a probe composition for detecting the internal reference. The primer-probe composition for detecting SLAMF8 is designed according to the gene information in Table 1.

[0063] Table 1

[0064]

[0065]

[0066] The internal reference gene is derived from the ABL1 (ABL proto-oncogene 1, non-receptor tyrosine kinase) gene. The SLAMF8 target fragment and the ABL1 target fragment are as follows.

[0067] SLAMF8 target fragment:

[0068] gcccaggcccgtggtacaagtgttcattgctgtagaaagggatgctcagccctccaagacctgccaggttttcttgtcctgttgggcccccaacatcagcgaaataacctatagctggcgacgggagacaaccatggactttggtatggaaccacacagcctcttcacagacggacaggtgctgagcatttccctgggaccaggagacagagatgtggcctattcctgcattgtctccaaccctgtcagctgggacttggccacagtcacgccctgggatagctgtcatcatgaggcagcaccagggaaggcctcctacaaagatgtgctgctggtggtggtgcctgtctcgctgctcctgatgctggttactctcttctctgcctggcactggtgcccc(SEQ ID NO.1)

[0069] ABL1 target fragment:

[0070] AAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAGGTGAAAAGCTCCGGGTCTTAGGCTATAATCACAATGGGGAATGGTGTGAAGCCCAAACCAAAAATGGCCAAGGCTGGGTCCCAAGCAACTACATCACGCCAGTCAACAGTCTGGAGAAACACTCCTGGTACCATGGGCCTGTGTCCCGCAATGCCGCTGAGTATCTGCTGAGCAGCGGGATCA(SEQ IDNO.5)

[0071] Table 2

[0072] Primer / Probe Sequence (5'-3') Sequence ID SLAMF8-F 5′-CCCAACATCAGCGAAATAACC-3′ SEQ ID NO.2 SLAMF8-R 5′-GAAGAGAGTAACCAGCATCAG-3 SEQ ID NO.3 SLAMF8-P 5‘-FAM-CCTTCCCTGGTGCTGCCTCATGAT-BHQ1-3’ SEQ ID NO.4 ABL1-F 5‘-CACTCTAAGCATAACTAAAGGTGAAAAGC-3’ SEQ ID NO.6 ABL1-R 5‘-GATGTAGTTGCTTGGGACCCA-3’ SEQ ID NO.7 ABL1-P 5‘-FAM-CCATTTTTGGTTTGGGCTTCACACCATT-BHQ1-3’ SEQ ID NO.8

[0073] Example 2

[0074] Verification of kit sensitivity (amplification efficiency):

[0075] 1. Verification method:

[0076] Prepare the SLAMF8 PCR detection reagent and the internal reference gene PCR detection reagent, and detect the reference samples 1 - 4 (the target gene concentrations are 10, 100, 1000, and 10000 copies / μL respectively).

[0077] The reaction system is as follows:

[0078] Table 3

[0079]

[0080] The reaction program is as follows:

[0081] Table 4

[0082]

[0083] 2. Passing criteria: Through standard curve analysis, the linear R of the SLAMF8 gene and the internal reference gene 2 > 0.99, and the amplification efficiency is between 90 - 110%.

[0084] 3. The verification results are as Figures 1 to 3 and shown in Table 5. It can be seen from Figure 1 that the primer - probe sets of the SLAMF8 gene and the internal reference gene designed in the kit can successfully amplify the target gene with a concentration of 10 - 10000 copies / μL, and within this linear range, the linear R 2 can reach 0.99, and the amplification efficiencies are 95.207% and 92.524% respectively, indicating that the kit provided in Example 1 has a relatively high amplification efficiency, and the sensitivity can reach 10 copies / μL.

[0085] Table 5

[0086]

[0087] Example 3

[0088] Kit specificity verification:

[0089] When extracting RNA from human samples, genomic fragment contamination may be incorporated. The kit designs specific primer - probes for the mRNA fragment of the SLAMF8 gene to avoid interference from genomic fragments in cDNA.

[0090] 1. Verification method:

[0091] Prepare the SLAMF8 PCR gene detection reagent according to Example 1 to detect cDNA and genomic gDNA of normal individuals. At the same time, use the SLAMF8 genomic detection reagent as a control group (the only difference from Example 1 is the probe. The probe of the SLAMF8 genomic detection reagent is 5‘-FAM-ACTTTGGTATGGAACCACAC-MGB-3’, SEQ ID NO.9).

[0092] 2. Passing criteria:

[0093] The SLAMF8 genomic detection reagent in the control group detected cDNA and gDNA of clinical samples with obvious amplification, while the SLAMF8 gene detection reagent (detecting RNA) provided in Example 1 detected cDNA and gDNA of clinical samples without amplification.

[0094] 3. Verification results: As shown in Figure 4 and Figure 5 , and Table 6. It can be seen that the SLAMF8 genomic detection reagent in the control group detected cDNA and gDNA of clinical samples with obvious amplification, while the SLAMF8 gene detection reagent (detecting RNA) provided in Example 1 detected cDNA and gDNA of clinical samples without amplification.

[0095] Table 6

[0096]

[0097] Example 4

[0098] Accuracy verification:

[0099] 1. Verification method:

[0100] Prepare the SLAMF8 detection reagent according to Example 1 to detect Reference Standards 1-4 (target gene concentration: 10-10000 copies / μL) and positive control (target value 5000 copies / μL). Reference Standards 1-4 form a standard curve to quantify the positive control SLAMF8.

[0101] 2. Passing criteria: The relative deviation between the content of the positive control SLAMF8 and the target value analyzed through the standard curve should be <15%.

[0102] 3. Verification results: As shown in Table 7, the relative deviation should be <15%, meeting the methodological requirements.

[0103] Table 7

[0104]

[0105] Example 5

[0106] The kit provided in Example 1 was used to detect clinical samples, which were the morning urine samples of patients. The Solibao urine RNA extraction kit (R1300) was used to extract the samples. The mRNA content of the SLAMF8 gene in the clinical samples was detected by one-step real-time fluorescence RT-PCR and double standard curves. The reaction system and reaction program were the same as those in Example 2. Standard curves were constructed by detecting reference samples 1-4 (the target gene concentrations were 10, 100, 1000, and 10000 copies / μL respectively). The detection results of reference samples 1-4 are shown in the following table.

[0107] Table 8

[0108]

[0109]

[0110] Table 9

[0111]

[0112] The detection results are as Figure 6 , Figure 7 and Figure 8 shown. It can be seen from Figure 6 that the Ct value of SLAMF8 in the tumor group is lower than that in the benign hyperplasia group and the normal group, indicating that the mRNA content of SLAMF in the tumor group is higher. There is no difference in the transcription level of the internal reference gene among the tumor group, the benign hyperplasia group, and the normal group. Figure 7 This further indicates that there is more SLAMF8 mRNA in the tumor group, and there is no difference in the content of the internal reference gene among the tumor group, the benign hyperplasia group, and the normal group. It can be seen from Figure 8 that the ratio of the mRNA content of the SLAMF8 gene to the internal reference gene in the tumor group is significantly greater than that in other groups. Therefore, SLAMF8 in the subject sample can be used as a diagnostic marker for prostate cancer. The increase in the SLAMF8 transcription level indicates that the test sample is from a prostate cancer patient. The ROC curve is as Figure 9 shown, and the relevant parameters are shown in Table 8, indicating that using SLAMF8 in the subject sample as a diagnostic marker, the sensitivity can reach 94.1% and the specificity can reach 95.1%.

[0113] Table 10

[0114]

[0115] Excerpts of some experimental data are shown in Tables 11-13:

[0116] Table 11

[0117]

[0118] Table 12

[0119]

[0120] Table 13

[0121]

[0122]

[0123] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions recorded in the foregoing embodiments, or perform equivalent replacements on some or all of the technical features; and these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. Use of a substance that detects SLAMF8 in the preparation of a product for diagnosing prostate cancer.

2. The application according to claim 1, characterized in that, The diagnosis of prostate cancer includes one or more of prostate cancer screening, prostate cancer diagnosis, prostate cancer recurrence diagnosis, prostate cancer metastasis prediction, and prostate cancer prognosis prediction.

3. The application according to claim 1, wherein The target substance to be detected includes polynucleotides encoding SLAMF8; Preferably, the target substance to be detected is the mRNA of the SLAMF8 gene.

4. The application according to claim 1, wherein The test samples of the product for diagnosing prostate cancer include blood, body fluids, cells, tissues, or secretions; Preferably, the cells include exfoliated cells in urine; Preferably, the secretions include pharyngeal secretions.

5. The application according to any one of claims 1 to 4, characterized in that, The substance that detects SLAMF8 includes a primer-probe set; Preferably, the nucleotide sequence of the target fragment amplified by the primer-probe set is as shown in SEQ ID NO.1; Preferably, the primer-probe set for detecting SLAMF8 includes a primer pair with nucleotide sequences as shown in SEQ ID NO.2 and 3; and a probe with a nucleotide sequence as shown in SEQ ID NO.4, and the probe is modified with a luminescent label and a quenching label.

6. A primer-probe set for detecting SLAMF8, characterized in that, Includes a primer pair with nucleotide sequences as shown in SEQ ID NO.2 and 3; and a probe with a nucleotide sequence as shown in SEQ ID NO.4, and the probe is modified with a luminescent label and a quenching label.

7. A kit for diagnosing prostate cancer, characterized in that, Includes the primer-probe set for detecting SLAMF8 described in claim 6.

8. The kit according to claim 7, wherein Also includes at least one of an enzyme for amplification reaction, buffer components, metal ions, salts, fluorescent dyes, surfactants, dNTPs, a primer-probe set for amplifying an internal standard gene, a positive control, and a negative control.

9. The kit according to claim 8, wherein The nucleotide sequence of the target fragment of the primer-probe set for amplifying the internal standard gene is as shown in SEQ ID NO.5; Preferably, the primer-probe set for amplifying the internal standard gene includes a primer pair with nucleotide sequences as shown in SEQ ID NO.6 and 7; and a probe with a nucleotide sequence as shown in SEQ ID NO.8, and the probe is modified with a luminescent label and a quenching label.

10. A method for detecting SLAMF8 for non-diagnostic and non-therapeutic purposes, characterized in that, Includes using the primer-probe set for detecting SLAMF8 described in claim 6, or the kit according to any one of claims 7 to 9 to amplify the product to be tested.

Images