TaqMan real-time fluorescent quantitative PCR probe primer combination and kit for identifying black water chicken and application of TaqMan real-time fluorescent quantitative PCR probe primer combination and kit

By designing the combination of real-time fluorescence quantitative PCR probe primers for black water chickens, the problems of large identification errors and high risk of false positives/false negatives in the prior art are solved, and high sensitivity and specificity detection effects are achieved, supporting ecological protection and disease prevention and control.

CN120366479APending Publication Date: 2025-07-25KUNMING INST OF ZOOLOGY CHINESE ACAD OF SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510818046.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-18
Publication Date
2025-07-25

AI Technical Summary

Technical Problem

The prior art has problems with high morphological identification errors, insufficient sensitivity or poor specificity in the identification of black water chickens, resulting in high risk of false positive/false negative.

Method used

Design a specific TaqMan real-time fluorescence quantitative PCR probe primer combination for black water chickens, including probes, upstream and downstream primers, to achieve high sensitivity and specific detection through real-time fluorescence signal monitoring.

Benefits of technology

It significantly improves the accuracy and efficiency of black water chicken detection, provides reliable technical support for ecological monitoring and protection, and reduces the risk of false positive/false negative.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120366479A_ABST
    Figure CN120366479A_ABST
Patent Text Reader

Abstract

The embodiment of the invention discloses a fluorescent primer combination for identifying TaqMan real-time fluorescent quantitative PCR (Polymerase Chain Reaction) of black turkeys, a kit and application. Comprising a probe, an upstream primer and a downstream primer, the nucleotide sequence of the probe is 5 '-FAM-TCAGTAGCATGGT-MGB-3', the nucleotide sequence of the upstream primer is 5 '-ACTACTATCCCTCCGTCCT-3', and the nucleotide sequence of the downstream primer is 5 '-CCTGCTGGGGTCAAAGAATGTG-3'. The probe primer provided by the invention has excellent specificity and sensitivity in the aspect of identifying black water chicken species, the detection accuracy is greatly improved, powerful technical support is provided for population monitoring, ecological protection and disease prevention and control of the black water chicken, and the biodiversity of a wetland ecosystem is better protected.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The embodiments of the present invention relate to the field of biological detection technologies, and particularly to a probe primer combination, a kit and an application for identifying Gallinula chloropus by TaqMan real-time fluorescence quantitative PCR. Background Art

[0002] The common moorhen (Gallinula chloropus), as a bird in the order Gruiformes and family Rallidae, is widely distributed all over the world except in Oceania. It plays an important role in wetland ecosystems and has an important impact on maintaining ecological balance. With the in-depth study of wetland ecosystems and the increasing emphasis on biodiversity conservation work, the need for accurately identifying the species of common moorhens, monitoring their population numbers and genetic diversity has become increasingly urgent.

[0003] In existing biological detection technologies, traditional identification methods mainly rely on morphological characteristics. However, there may be certain differences in morphological characteristics among common moorhens at different growth stages and different geographical populations, which brings relatively large errors to morphological-based identification. For example, juveniles and adults differ in feather color, body size, etc., and the subtle morphological differences between some similar species are also prone to misjudgment. In addition, traditional serological methods and ordinary PCR techniques either have insufficient sensitivity and cannot detect low levels of target nucleic acids, or have poor specificity and are easily interfered by nucleic acids of other species, resulting in false positive results.

[0004] The real-time fluorescence quantitative PCR (qPCR) technology combined with the TaqMan probe method has been widely used in the field of species-specific detection due to its high sensitivity, strong specificity and rapid quantification ability. Its core lies in designing primers and probes targeting the unique gene sequences of the target species, and real-time monitoring of the amplification process through fluorescence signals, enabling accurate qualitative and quantitative analysis of target DNA without subsequent electrophoresis or sequencing. However, there is still a blank in the development of specific molecular markers for common moorhens: the existing publicly available general avian primers or probes lack sufficient interspecies discrimination and are easily interfered by DNA mixed in related species or environmental samples, resulting in an increased risk of false positives / false negatives.

[0005] Therefore, developing a specific primer combination for common moorhens and a supporting kit based on TaqMan probe technology can significantly improve the detection efficiency and accuracy, providing a reliable technical tool for wildlife law enforcement, ecological monitoring and forensic identification, and having important scientific research and application values. Summary of the Invention

[0006] To this end, the embodiments of the present invention provide a probe primer combination, a kit and an application for identifying Gallinula chloropus by TaqMan real-time fluorescence quantitative PCR.

[0007] To achieve the above object, the embodiments of the present invention provide the following technical solutions:

[0008] According to the first aspect of the embodiments of the present invention, the present invention provides a probe primer combination for identifying Gallinula chloropus TaqMan real-time fluorescence quantitative PCR, including a probe, an upstream primer, and a downstream primer. The nucleotide sequence of the probe is: 5'-FAM-TCAGTAAGTAGCATGGT-MGB-MGB-3', the nucleotide sequence of the upstream primer is 5'-ACTACTATCCCTCCCCGTCCTT-3', and the nucleotide sequence of the downstream primer is 5'-CCTGCTGGGTCAAAGAATGTG-3'.

[0009] According to the second aspect of the embodiments of the present invention, the present invention provides a kit for identifying Gallinula chloropus TaqMan real-time fluorescence quantitative PCR, including the above-mentioned probe primer combination.

[0010] According to the third aspect of the embodiments of the present invention, the present invention provides the above-mentioned probe primer combination, or, the application of the above-mentioned kit in the identification of Gallinula chloropus species.

[0011] According to the fourth aspect of the embodiments of the present invention, the present invention provides a method for identifying Gallinula chloropus species, and the method includes:

[0012] (1) Extract cDNA or genomic DNA of the sample to be tested;

[0013] (2) Perform TaqMan real-time fluorescence quantitative PCR reaction with the probe, upstream primer, and downstream primer as in claim 1 to obtain the Ct value and amplification curve;

[0014] (3) Detection result determination: If the Ct value ≤ 35 and a typical amplification curve appears, the result is positive; if there is no Ct value or no amplification curve, the result is negative; when the Ct value > 35, repeat the sample. If there is no Ct value in the repeated result, it is negative, otherwise it is positive.

[0015] Further, the TaqMan real-time fluorescence quantitative PCR reaction system is: 10 μL of premixed reagent, 0.7 μL of 10 μM upstream primer, 0.7 μL of 10 μM downstream primer, 0.6 μL of 10 μM TaqMan probe, 1 μL of DNA template, and supplemented with ddH2O to a total volume of 20 μL.

[0016] Further, the TaqMan real-time fluorescence quantitative PCR reaction conditions are: pre-denaturation at 95°C for 2 min; 95°C for 15 s, 60°C for 30 s, for 40 cycles.

[0017] The embodiments of the present invention have the following advantages:

[0018] The probe primers provided by the present invention have excellent specificity and sensitivity in identifying the species of Gallinula chloropus, greatly improving the accuracy of detection, providing strong technical support for the population monitoring, ecological protection and disease prevention and control of Gallinula chloropus, and contributing to better protecting the biodiversity of wetland ecosystems. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following will briefly introduce the drawings required for use in the description of the embodiments or the prior art. Obviously, the drawings in the following description are only exemplary, and for those of ordinary skill in the art, without creative efforts, other implementation drawings can also be obtained according to the provided drawings.

[0020] Figure 1 It is the amplification curve graph for specificity verification provided by the present invention;

[0021] Figure 2 It is the amplification curve graph of different copy numbers of the Gallinula chloropus gene provided by the present invention;

[0022] Figure 3 It is the standard curve graph for the detection of the Gallinula chloropus gene provided by the present invention. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0023] The following specific embodiments illustrate the implementation manners of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the scope of protection of the present invention.

[0024] Example 1 Design of Primers and Probes

[0025] By searching the NCBI database, downloading the mitochondrial sequences of the target species and related species, performing alignment analysis with MEGA6 software, and selecting the specific regions of the target species to design primers and probes with Primer Express 3.0.1 software to ensure the detection specificity of the target species. The design and synthesis of primers and probes were completed by Beijing Tsingke Biotechnology Co., Ltd. The information of primers and probes is shown in Table 1 below.

[0026] Table 1

[0027] Name Sequence (5'→3') Forward primer 5'-ACTACTATCCCTCCCCGTCCTT-3' (SEQ ID NO:1) Reverse primer 5'-CCTGCTGGGTCAAAGAATGTG-3' (SEQ ID NO:2) Probe 5'-FAM-TCAGTAAGTAGCATGGT-MGB-3' (SEQ ID NO:3)

[0028] Example 2 Specificity Detection

[0029] Extract the DNA template of the common moorhen as a positive sample, and extract the DNA templates of the grey heron, black-crowned night heron, Chinese pond heron, eastern cattle egret, white wagtail, yellow-vented bulbul, sparrow, common moorhen, and little egret as negative samples. Use ddH2O to replace the nucleic acid in the system as a no-template control (NFC). Amplify using the upstream primer, downstream primer, and probe in Table 1, and verify the specificity of the primer and probe according to the Ct value. Each sample is measured 3 times repetitively. The submitted sample is a feather, and a commercial kit is used to extract the DNA template.

[0030] The real-time fluorescence PCR reaction system is as follows: 10 μL of 2xT5 Fast qPCR Mix (Tsingke, TSE301), 0.7 μL of 10 μM upstream primer, 0.7 μL of 10 μM downstream primer, 0.6 μL of 10 μM probe, 1 μL of DNA template, and make up to a total volume of 20 μL with ddH2O.

[0031] The real-time fluorescence amplification program is as follows: pre-denaturation at 95°C for 2 min, 1 cycle; 95°C for 15 s, 60°C for 30 s, 40 cycles; collect fluorescence signals during annealing and extension (60°C).

[0032] The results are shown in Table 2 below and Figure 1 , the positive sample shows a typical S-shaped amplification curve (see "1" in Figure 1 ), while the other negative samples and the no-template control are all straight lines (see "2 - 10" in Figure 1 ), and there is no increase in fluorescence value. This indicates that the primers and probes provided by the present invention can specifically detect the DNA of the common moorhen.

[0033] Table 2

[0034]

[0035]

[0036] Example 3 Detection of Probe Amplification Efficiency

[0037] Clone the target product amplified in Example 2 into a vector (Tsingke pClone007 Versatile Simple Vector). After the obtained plasmid is verified by sequencing, it is used as a common moorhen standard plasmid for amplification efficiency detection. The nucleotide sequence of the common moorhen standard plasmid is as follows:

[0038] AGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTT

[0039] TACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCC

[0040] GCAAAAAACGGAATAAGTGCGACACGGAAATGTTGAATACTCATTTTAG

[0041] CTTCCTTAGCTCCTGAAAATCTCGATAACTCAAAAAATACGCCCGGTAGT

[0042] GATCTTATTTCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAAGT

[0043] CAAAAGCCTCCGGTCGGAGGCTTTTGACTTTCTGTTCCGGCTCGTATGTT

[0044] GTGTCTATGGAAGCGGATAACAATTTCACACAGGAAACAGCTATGACCA

[0045] AGTTTGACATCCTTCAGGTGGACTCAAGACTGCAATCGCGTGTCGCCCTT

[0046] CCTGCTGGGTCAAAGAATGTGGTGTTTAGGTTTCGGTCAGTAAGTAGCAT

[0047] GGTAATGCCAGCAGCAAGGACGGGGAGGGATAGTAGTAAGGGCGACAC

[0048] GCGATTGCAGTGTAACACGAGTGATCCTGAGTTCAGATCAACTGGCCGT

[0049] CGTTTTACACAATCAAGTCGTGACTGGGAAAACCCTGGCGCTCCAACTT

[0050] AATCGCCTTGCAGCACTGGCTCACCTTCACGGGTGGGCCTTTCTTCGGTA

[0051] GAAAATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCT

[0052] GCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGA

[0053] TCAAGAGCTACCAACTCTTTTTCCGAGGTAACTGGCTTCAGCAGAGCGC

[0054] AGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTC

[0055] AAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACC

[0056] AGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCA

[0057] AGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTT

[0058] CGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATA

[0059] CCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAA

[0060] GGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCAC

[0061] GAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGG

[0062] TTTCGCCACCTCTGACTTGAGCATCGATTTTTGTGATGCTCGTCAGGGGG

[0063] GCGGAGCCTATGGAAAAACGCCAGCAACGCAGAAAGGCCCACCCGAAG

[0064] GTGAGCCAGGTGATTACATTTGGGCCCTCATTACCAATGCTTAATCAGTG

[0065] AGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGAC

[0066] TCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCC

[0067] AGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATC

[0068] AGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGC

[0069] AACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGT

[0070] AAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAG

[0071] GCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGT

[0072] TCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAG

[0073] CGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCA

[0074] GTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATG

[0075] CCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATT

[0076] CTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATAC

[0077] GGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGA

[0078] AAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGAT

[0079] CC, see SEQ ID NO:4.

[0080] The standard plasmid of Gallinula chloropus was serially diluted as a positive standard, and detected according to the real-time fluorescence PCR reaction system and amplification program in Example 2. Each dilution was repeated 3 times to obtain the probe gradient amplification curve ( Figure 2 in which, 1: dilution factor 10^3, 2: dilution factor 10^4, 3: dilution factor 10^5, 4: dilution factor 10^6, 4: dilution factor 10^7). The CT and copy number LOG values were fitted to obtain the standard curve equation ( Figure 3 ), and the detection R 2 reached 0.9999. The results showed that within the range of 4.43E+7 - 4.43E+3 copies / μL of the Gallinula chloropus gene, there was a good linear relationship between CT and the copy number LOG value. According to the established standard curve, the amplification efficiency was calculated to be 98.2%. The detection data are shown in Table 3.

[0081] Table 3

[0082]

[0083] After diluting the plasmid 10^7 times, the detection repeatability was good, and the probe detection efficiency was within the normal range (90% - 110%). The sensitivity of the primers and probes provided by the present invention met the detection requirements.

[0084] Although the present invention has been described in detail above with general descriptions and specific examples, based on the present invention, some modifications or improvements can be made, which are obvious to those skilled in the art. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of the present invention claimed.

[0085]

[0086]

[0087]

Claims

1. A probe primer combination for identifying Gallinula chloropus by TaqMan real-time fluorescence quantitative PCR, characterized in that, It includes a probe, an upstream primer and a downstream primer. The nucleotide sequence of the probe is: 5'-FAM-TCAGTAAGTAGCATGGT-MGB-MGB-3', the nucleotide sequence of the upstream primer is 5'-ACTACTATCCCTCCCCGTCCTT-3', and the nucleotide sequence of the downstream primer is 5'-CCTGCTGGGTCAAAGAATGTG-3'.

2. A kit for identifying Gallinula chloropus by TaqMan real-time fluorescence quantitative PCR, characterized in that, It includes the probe primer combination as described in claim 1.

3. Application of the probe primer combination as described in claim 1, or the kit as described in claim 2 in the identification of the water rail species.

4. A method for identifying the water rail species, characterized in that, The method includes: (1) Extracting cDNA or genomic DNA of the sample to be tested; (2) Performing TaqMan real-time fluorescence quantitative PCR reaction with the probe, upstream primer and downstream primer as described in claim 1 to obtain the Ct value and amplification curve; (3) Judgment of the detection result: If the Ct value ≤ 35 and a typical amplification curve appears, the result is positive; if there is no Ct value or no amplification curve, the result is negative; when the Ct value > 35, repeat the sample. If there is no Ct value in the repeated result, it is negative, otherwise it is positive.

5. The water rail identification method according to claim 4, characterized in that The TaqMan real-time fluorescence quantitative PCR reaction system is: 10 μL of premixed reagent, 0.7 μL of 10 μM upstream primer, 0.7 μL of 10 μM downstream primer, 0.6 μL of 10 μM TaqMan probe, 1 μL of DNA template, and supplemented with ddH2O to a total volume of 20 μL.

6. The water rail identification method according to claim 4, characterized in that The TaqMan real-time fluorescence quantitative PCR reaction conditions are: pre-denaturation at 95°C for 2 min; 95°C for 15 s, 60°C for 30 s, 40 cycles.