Molecular marker for accurately positioning centromere of Chinese trumpet creeper chromosome

Abstract

The invention relates to the technical field of biology, in particular to a molecular marker for accurately positioning centromere of chromosome of Chinese trumpet creeper, and the sequence of the molecular marker is as shown in SEQ ID NO.1 and SEQ ID NO.2. The method comprises the following steps: specifically enriching a DNA (Deoxyribose Nucleic Acid) sequence combined with a centromere specific histone CENH3 through a chromatin co-immunoprecipitation technology (ChIP), and sequencing the DNA sequence; sequencing data are analyzed to obtain a centromere sequence of the vicia villosa, and two specific repetitive sequences of the centromere of the vicia villosa are obtained after identification and optimization. Primers are designed according to the sequences, PCR amplification is carried out, amplification product sequences are marked, fluorescence in situ hybridization verification is carried out by analyzing a cytogenetics technology, it is proved that the primers are specifically distributed in a centromere area of vicia villosa, and the centromere specificity of the primers is proved. The marker can be used for genetic identification and accurate positioning of the centromere in genome research, and can also be used for cytological identification of the centromere and karyotype research such as chromosome counting and morphological analysis through centromere signal observation.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to a molecular marker for precisely locating the centromere of Vicia villosa chromosomes. Background Art

[0002] The centromere is an essential structural element on eukaryotic chromosomes. During cell division, it is responsible for recruiting kinetochore proteins and ensuring the accurate segregation of chromosomes under the traction of spindle fibers, which is an important guarantee for the stable transmission of genetic material. However, eukaryotic centromeres are often composed of a large number of highly repetitive sequences, making them difficult to identify and locate, which poses a huge obstacle to genomic and cytological research.

[0003] Vicia villosa Roth var. glabrescens (2n = 14) is an annual herbaceous plant of the genus Vicia in the family Fabaceae. It is a forage green manure and rotation crop rich in protein, amino acids, and inorganic salts. It can not only fix nitrogen and increase soil fertility but also improve the yield of other crop rotations, playing a very important role in the sustainable development of agriculture and animal husbandry. Inter-specific hybridization is frequent in the genus Vicia, and the chromosome number and structural variations are complex. There is an urgent need to establish a cytogenetic technology system based on centromere markers. Developing molecular markers that can accurately identify centromeres can not only solve the problem of accurate identification of centromeres and chromosomes in genomic research but also be used for karyotype analysis in cytology, and more importantly, provide a key tool for tracking chromosome behavior, evaluating allopolyploid introgression, and introgressive breeding of excellent genes in distant hybridization. Summary of the Invention

[0004] The purpose of the present invention is to overcome the deficiencies in the prior art and provide a molecular marker for precisely locating the centromere of Vicia villosa chromosomes. This molecular marker can overcome the difficulty of identifying the centromere of Vicia villosa and provide an important technical means for genomic research and breeding utilization.

[0005] To achieve the above purpose, the present invention adopts the following technical scheme:

[0006] A molecular marker for precisely locating the centromere of Vicia villosa chromosomes, the nucleotide sequence of which is shown in SEQ ID NO.1 and SEQ ID NO.2.

[0007] Preferably, the two markers can be obtained by amplification using designed specific primers, and the two pairs of primer sequences are shown in SEQ ID NO.3 and SEQ ID NO.4, and SEQ ID NO.5 and SEQ ID NO.6 respectively.

[0008] Among them, SEQ ID NO.3: 5’GCATGGTGAATCAAACCTTC 3’

[0009] SEQ ID NO.4: 5’GAGTCACCATTCTTTGACCA 3’

[0010] SEQ ID NO.5: 5’TTGTCAAAGCATGGGTAC 3’

[0011] SEQ ID NO.6: 5’TGAGAAGGTTTGAGTCCC 3’

[0012] Use of a molecular marker as described above in the genetic identification and precise mapping of centromeres in genomic research

[0013] Among them, due to certain variations in the repetitive sequences from which the marker is derived among genomes, therefore:

[0014] 1. The core repeating unit of the centromere-specific repetitive sequence may have a few base differences, and all of these belong to the content of the present invention.

[0015] 2. When designing centromere probes, based on the repeating unit of the core centromere region, probes can be designed and developed by changing a few bases, or by changing the number and length of the repeating units included in the probe, and all of these belong to the content of the present invention.

[0016] 3. The application scope of the probes of the present invention, in addition to Vicia villosa Roth written in this patent, can also be applied to other related species that can hybridize with this probe to display the centromere region. Moreover, in addition to chromosome counting and centromere region display, this sequence and probe can also be applied in the research of differentiating related species of Vicia villosa Roth, evolution, etc. All of these belong to the application scope of the centromere probes developed by the present invention.

[0017] By adopting the above technical solution: The present invention is based on the centromere-specific histone CENH3, and develops chromatin immunoprecipitation assay (ChIP) to isolate the DNA that interacts with the centromere-specific histone CENH3, that is, centromeric DNA. Through analysis and verification, the centromeres of Vicia villosa Roth can be precisely located, providing an important technical means for genomic research and breeding utilization.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] 1. The present invention uses CENH3 antibody for ChIP-seq experiments and bioinformatics analysis to obtain centromeric region repetitive sequences. Based on these sequences, primers are designed. After the amplification products are labeled, through FISH experiments, bright signals can be generated in the centromeric regions of all chromosomes of Vicia villosa Roth, accurately showing the positions of centromeres on chromosomes, enabling accurate identification of centromeres. At the same time, by counting the number of signals, all chromosomes can be quickly and accurately counted, and centromeres of different chromosomes can be distinguished.

[0020] 2. The present invention can not only be used for centromere identification of Vicia villosa Roth, but also be applicable to other related species, which is conducive to obtaining accurate centromere localization analysis of chromosomes in genomic, cytological, and breeding analyses, and has broad application significance. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is a hybridization of Vicia villosa Roth with probes of the amplified sequences Vv01 (i.e., the sequence corresponding to SEQ ID NO.1) and Vv02 (i.e., the sequence corresponding to SEQ ID NO.2) of the primers marked in the present invention;

[0022] A: FISH hybridization signals of centromeric repetitive sequence Vv01;

[0023] B: FISH hybridization signals of centromeric repetitive sequence Vv02. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0024] The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings, so that those skilled in the art can better understand the advantages and features of the present invention, and thus make a clearer definition of the protection scope of the present invention. The embodiments described in the present invention are only a part of the embodiments of the present invention, rather than all embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0025] Example 1: Implementation of ChIP-Seq Technology

[0026] The ChIP-Seq technology refers to a method of performing high-throughput sequencing on the DNA obtained after chromatin immunoprecipitation (ChIP).

[0027] The basic process of ChIP-Seq used in the present invention is as follows:

[0028] 1. Grind fresh and tender leaves in liquid nitrogen and extract cell nuclei;

[0029] 2. After extracting cell nuclei, use micrococcal nuclease to enzymatically digest the cell nuclei and randomly fragment the chromatin into fragments smaller than 300 bp;

[0030] 3. Add an antibody against centromere-specific histone CENH3 and bind it to the target protein-DNA complex. Divide the digested cell nuclei into three equal parts, one as an internal reference (Input), one added with pre-immune serum (Mock), and the other added with the CENH3-specific antibody to immunoprecipitate the protein-DNA complex, and invert gently overnight at 4°C.

[0031] 4. Add Protein A to bind the antibody-target protein-DNA complex and precipitate it. After incubating overnight, add Protein A to each tube and invert gently at 4°C for 2 h.

[0032] 5. Wash the precipitated complex to remove some non-specific bindings. Let it stand at 4°C for 10 min, centrifuge at 3600 rpm for 1 min, and remove the supernatant.

[0033] 6. Elute to obtain the enriched target protein-DNA complex: Wash the precipitated complex successively with low-salt solution, high-salt solution, LiCl, and TE. The washing steps are as follows: Add the solution, invert gently at 4°C for 10 min, let it stand at 4°C for 10 min, centrifuge at 3600 rpm for 1 min, and remove the supernatant.

[0034] 7. Isolate and purify DNA: After washing, start eluting. The elution buffer formulation: The composition of 1 ml solution is: 100 μL of 10% SDS, 100 μL of 1 M NaHCO3, and 800 μL of ddH2O. Add the elution buffer to each tube, invert gently at room temperature for 15 min, let it stand and centrifuge, and collect the supernatant. Repeat the washing once.

[0035] 8. Reverse cross-linking: Add NaCl to each tube to make the final concentration 0.2 M; mix well and reverse cross-link overnight at 65°C.

[0036] 9. After reverse cross-linking is completed, add RNase A to each tube and incubate at 37°C for 1 h.

[0037] 10. Add EDTA, Tris-HCl, and proteinase K to each tube and incubate at 45°C for 2 h.

[0038] 11. Recovery of DNA fragments: Use the QIAGEN gel extraction kit, product number: 28704, name: QIAquick Gel Extraction Kit(50).

[0039] 12. After the purified DNA is subjected to end repair, A addition, and addition of sequencing adapters, then perform low-cycle PCR amplification and agarose gel electrophoresis to recover fragments of specific size, and prepare a sequencing library.

[0040] 13. Sequence using the Illumina Hiseq sequencer.

[0041] Example 2: Identification of centromere-specific repetitive sequences

[0042] 1. First, use Trim Galore (v0.6.10) (https: / / github.com / FelixKrueger / TrimGalore) to process the sequencing results of ChIP and Input to remove PCR duplicates and low-quality reads;

[0043] 2. Randomly select 3 million pairs from the filtered Input paired-end sequencing data, a total of 6 million reads, and import them into the RepeatExplorer2 online analysis platform (https: / / repeatexplorer-elixir.cerit-sc.cz / galaxy / );

[0044] 3. Record the similarity and overlap information between reads, and then perform clustering and splicing of sequences based on this information. Finally, different repetitive sequence types in the genome form different repetitive sequence clusters;

[0045] 4. Use BLASTn to align the filtered ChIP and Input sequencing data to the reads of the repetitive sequence clusters. The parameter requirement is that the E-value threshold is 1e-8, and the most suitable alignment result is selected according to the bit score;

[0046] 5. Count the number of reads of the ChIP and Input sequencing data aligned to each repetitive sequence cluster. Calculate the ChIP / Input ratio of each cluster by calculating the number of ChIP reads / the number of Input reads, and calculate the proportion of each cluster in the genome by calculating the number of matching reads / the total number of reads;

[0047] 6. Use SeqGrapheR to depict the 3D structure network of the clusters. Select the representative contigs of each cluster according to the representativeness of the contigs in the cluster.

[0048] Example 3: Primer design and PCR amplification

[0049] 1. Use the primer design software Primer Premier 5.0 to design primers for the centromere sequence CENTS. The set conditions are: one is the full length or partial sequence of the nucleic acid sequence; the second is that the primer length is 21bp ± 5bp; the third is that the GC content of the primer sequence is 40 - 60%; the fourth is to avoid the formation of stable dimers or hairpin structures between primers; the fifth is that the primer cannot mismatch at non-target sites of the template sequence;

[0050] 2. The conditions for PCR amplification were as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 45 s, annealing at 57°C for 30 s, extension at 72°C for 90 s, for 30 cycles, and final extension at 72°C for 7 min. The PCR products were purified and recovered using a kit.

[0051] In summary, according to the definition of the functional centromere, whether it binds to the CENH3 protein is the core condition for determining whether a DNA sequence is a functional centromere sequence. Therefore, the sequences obtained from the ChIP experiment using CENH3 as a means must be DNA sequences from the functional centromere. Since centromere sequences vary greatly and there is extremely low conservation among species, it is impossible to obtain centromere sequences of different species through homologous cloning methods. The present invention uses the ChIP-Seq method to directly obtain the true centromere sequence of the species, and the FISH experiment also proves the effectiveness of this method and the centromere localization of the sequence, and the technical method is reliable.

[0052] The descriptions and practices disclosed in the present invention are easy to think about and understand for those of ordinary skill in the art. And without departing from the principle of the present invention, several improvements and refinements can be made. Therefore, the modifications or improvements made without deviating from the spirit of the present invention should also be regarded as within the protection scope of the present invention.

Claims

1. A molecular marker for precisely locating the centromere of the chromosome of common vetch, characterized in that, The molecular marker sequences are shown in SEQ ID NO.1 and SEQ ID NO.

2.

2. The molecular marker for precisely positioning the centromere of the vetch chromosome according to claim 1, wherein The two markers can be obtained by amplification using designed specific primers. The sequences of the two pairs of primers are shown in SEQ ID NO.3 and SEQ ID NO.4, and SEQ ID NO.5 and SEQ ID NO.6 respectively.

3. Use of a molecular marker as described in claim 1 in the genetic identification and precise mapping of centromeres in genomic research.

Images