Molecular marker TaJAZ10-A-HaeII of wheat TaJAZ10-A gene and application of molecular marker TaJAZ10-A-HaeII

By developing the molecular marker TaJAZ10-A-HaeII of the wheat TaJAZ10-A gene, the problem of difficulty in accurately screening wheat varieties in the existing technology is solved, and efficient screening of haplotype wheat varieties such as high rods, long ears, high biomass and short rods, short ears, and low biomass is achieved, improving the quality and diversity of wheat breeding.

CN120366504APending Publication Date: 2025-07-25SHANXI AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510612208.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-13
Publication Date
2025-07-25

AI Technical Summary

Technical Problem

The existing technology lacks efficient and accurate molecular marker screening technology, making it difficult to quickly and accurately dig wheat varieties with specific excellent traits, affecting the efficiency and quality of wheat seed selection and cultivation.

Method used

The molecular marker TaJAZ10-A-HaeII of the wheat TaJAZ10-A gene was developed. Through PCR amplification and restriction endonuclease HaeII digestion, the two haplotypes TaJAZ10-A-Hap1 and TaJAZ10-A-Hap2 were identified using SNP site differences, and wheat varieties with high rod, long spike, high biomass, multi-tiller and short spike, low spike, and few-tiller were screened.

Benefits of technology

Accurate screening of different haplotype wheat varieties has been achieved, the accuracy and efficiency of wheat breeding has been improved, and the screening basis for wheat varieties with strong ability to resist lodging is provided.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120366504A_ABST
    Figure CN120366504A_ABST
Patent Text Reader

Abstract

The invention belongs to but not limited to the technical field of crop seed selection and cultivation, and discloses a molecular marker TaJAZ10-A-HaeII of a wheat TaJAZ10-A gene and application of the molecular marker TaJAZ10-A-HaeII, the molecular marker is TaJAZ10-A-HaeII, and the nucleotide sequence of the molecular marker is shown as SEQ ID NO: 9. The molecular marker TaJAZ10-A-HaeII can be used for accurately screening out the following two different haplotypes of wheat varieties: TaJAZ10-A-Hap1 is a haplotype with high stem, long spike, high biomass and multiple tillers, and is beneficial to the utilization in the aspects of feed, biological energy, soil improvement, ecological restoration and ornamental application; the TaJAZ10-A-Hap2 is a haplotype with short stems, short ears, low organisms and few tillers, and is helpful for cultivating wheat varieties with strong lodging resistance in a wheat breeding process.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to but is not limited to the technical field of crop seed selection and breeding, and in particular relates to a molecular marker TaJAZ10-A-HaeII of wheat TaJAZ10-A gene and an application thereof. Background Art

[0002] As an important food crop widely grown in the world, wheat provides the main food for 35%-40% of the world's population, contributing about 21% of food calories and 20% of protein. Increasing wheat yields by cultivating excellent varieties has become a key path. Studies have shown that the contribution rate of excellent varieties to the increase in wheat yields exceeds one-third. Therefore, continuously cultivating new high-yield, stable-yield, multi-resistant and widely adaptable wheat varieties is an important way to ensure the sustainable development of wheat production and the absolute safety of food.

[0003] In the process of wheat breeding, wheat varieties with different traits have their own advantages. Tall wheat has well-developed straw fibers and good elasticity, and its stalks have high protein content. It can be used as high-quality feed for cattle and sheep. Returning it to the field after harvest can increase soil organic matter, improve soil structure, enhance soil water and fertilizer retention capacity, promote microbial activity, and benefit the growth of subsequent crops. Short-stemmed wheat has a low center of gravity, a well-developed root system, strong resistance to lodging, high fertilizer utilization efficiency, and is easy to harvest mechanically. It is an excellent genetic breeding material. Long-eared wheat helps to reveal the genetic mechanism of wheat ear development and provide a theoretical basis for genetic improvement; short-eared wheat has better resistance to adverse environments such as drought, high temperature, and low temperature, or when attacked by pests and diseases. High biomass wheat often corresponds to higher grain yields; low biomass wheat can serve as a pioneer crop to maintain ecological stability in harsh environments. Multi-tillering wheat can increase the number of ears per unit area and increase yield under suitable conditions; low-tillering wheat grows neatly and has a compact plant shape, which is easy to manage, and can make nutrients more concentrated to supply grains, improving the fullness and quality of grains.

[0004] Although wheat varieties with different traits have obvious advantages, the lack of efficient and accurate molecular marker screening technology makes it difficult to quickly and accurately mine wheat varieties with specific excellent traits and provide a solid molecular basis for high-yield and high-quality breeding. Therefore, how to screen out different haploid wheat varieties is a major challenge in wheat selection and breeding. Therefore, it is of great significance to mine and screen molecular markers with different types of wheat varieties to provide a molecular basis for high-yield and high-quality breeding. Summary of the invention

[0005] In view of the problems existing in the prior art, the present invention provides a molecular marker TaJAZ10-A-HaeII of wheat TaJAZ10-A gene and application thereof.

[0006] The present invention is implemented as follows. A molecular marker for the wheat TaJAZ10-A gene, the molecular marker being TaJAZ10-A-HaeII, whose nucleotide sequence is as shown in SEQ ID NO: 9, with a sequence length of 113 bp.

[0007] Furthermore, the molecular marker is obtained by PCR amplification using the upstream primer TaJAZ10-A-HaeII-F and the downstream primer TaJAZ10-A-HaeII-R. The nucleotide sequence of the upstream primer TaJAZ10-A-HaeII-F is as shown in SEQ ID NO: 7, and the nucleotide sequence of the downstream primer TaJAZ10-A-HaeII-R is as shown in SEQ ID NO: 8.

[0008] Furthermore, the TaJAZ10-A gene contains two genotypes, TaJAZ10-A-Hap1 (TaJAZ10-A-HaeII-T) and TaJAZ10-A-Hap2 (TaJAZ10-A-HaeII-C).

[0009] Furthermore, TaJAZ10-A-Hap1 is homozygous for T at the 1189th SNP site in the third exon region of the gDNA region sequence of TaJAZ10-A (the digestion product has only one band of 113 bp);

[0010] TaJAZ10-A-Hap2 is homozygous for C at the 1189th SNP site in the third exon region of the gDNA region sequence of TaJAZ10-A (the digestion products are 81 bp and 32 bp).

[0011] Another object of the present invention is to provide a kit for screening wheat varieties with TaJAZ10-A-Hap1 or TaJAZ10-A-Hap2 haplotypes, including the molecular marker TaJAZ10-A-HaeII.

[0012] Another object of the present invention is to provide the application of a molecular marker of the wheat TaJAZ10-A gene in screening wheat varieties with TaJAZ10-A-Hap1 or TaJAZ10-A-Hap2 haplotypes.

[0013] Furthermore, TaJAZ10-A-Hap1 is a haplotype with tall stalks, long spikes, high biomass, and many tillers, which is helpful for utilization in aspects such as feed, bioenergy, soil improvement, ecological restoration, and ornamental use;

[0014] TaJAZ10-A-Hap2 is a haplotype with short stalks, short spikes, low biomass, and few tillers, which is helpful for cultivating wheat varieties with strong lodging resistance during the wheat breeding process.

[0015] Combined with the above technical solutions and the technical problems to be solved, the advantages and positive effects of the technical solutions to be protected by the present invention are as follows:

[0016] The present invention provides a molecular marker TaJAZ10-A-HaeII for the wheat TaJAZ10-A gene. This molecular marker TaJAZ10-A-HaeII can accurately screen two different haplotype wheat varieties as follows: TaJAZ10-A-Hap1 is a haplotype with tall stems, long spikes, high biomass, and many tillers, which is helpful for utilization in aspects such as feed, bioenergy, soil improvement, ecological restoration, and ornamental use; while TaJAZ10-A-Hap2 is a haplotype with short stems, short spikes, low biomass, and few tillers, which is helpful for cultivating wheat varieties with strong lodging resistance during the wheat breeding process. This molecular marker TaJAZ10-A-HaeII lays a foundation for subsequent researchers to screen wheat varieties with different types. Description of the Drawings

[0017] Figure 1 It is a diagram of the electrophoresis detection results provided by the embodiments of the present invention.

[0018] Figure 2 It is a diagram that reaches a significant or highly significant level under the environments of E1, E2, E3, E4, E5, E6, E7, E8, E9, and E10 provided by the embodiments of the present invention.

[0019] Figure 3 It is a diagram of planting year - planting location - treatment method provided by the embodiments of the present invention.

[0020] Figure 4 It is a diagram of the distribution frequencies of two haplotypes TaJAZ10-A-Hap1 and TaJAZ10-A-Hap2 of TaJAZ10-A provided by the embodiments of the present invention.

[0021] Figure 5 It is a diagram of the frequency distribution of TaJAZ10-A haplotypes in wheat varieties of different years provided by the embodiments of the present invention. Detailed Embodiments

[0022] In order to make the objectives, technical solutions, and advantages of the present invention clearer, the present invention will be further described in detail below in conjunction with embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0023] TaJAZ10-A Sequence Polymorphism, Molecular Marker Development, and Association Analysis

[0024] I. TaJAZ10-A Sequence Polymorphism

[0025] Clone the gDNA of TaJAZ10-A from 32 polymorphic wheat materials in Table 1 (these wheat materials are described in "Du, Y., Li, C., Mao, X., Wang, J., Li, L., Yang, J., Zhuang, M., Sun, D., & Jing, R. (2022). TaERF73 is associated with root depth, thousand-grain weight and plant height in wheat over a range of environmental conditions. Food and Energy Security, 11, e325. https: / / doi.org / 10.1002 / fes3.325"), and perform segmental amplification and sequencing using the gDNA-specific primers TaJAZ10-A-gF1 / gR1 and TaJAZ10-A-gF2 / gR2.

[0026] TaJAZ10-A-gF1: 5’-TCAGTGGCAGTGCGGGAC-3’ (SEQ ID No.1);

[0027] TaJAZ10-A-gR1: 5’-AAGCTCCTGAGCCTGTAATGAA-3’ (SEQ ID No.2).

[0028] The amplification product is 2033 bp, as shown in SEQ ID No.5.

[0029] TaJAZ10-A-gF2: 5’-CCTTTCGTGATGAACAATGCG-3’ (SEQ ID No.3);

[0030] TaJAZ10-A-gR2: 5’-ACATCCATTCATTGCGTTGC-3’ (SEQ ID No.4).

[0031] The amplification product is 1812 bp, as shown in SEQ ID No.6.

[0032] Table 1 32 polymorphic materials

[0033] Number Name Number Name Number Name Number Name 1 Jin 2148-7 9 Overbearing Whip 17 04-030 25 Spring 049th-5-1 2 Linkang 5108 10 Jimai 41 18 Beijing 14 26 Spring 454th-50-1 3 Chang 6878 11 Jimai 6 19 Beijing 10 27 Jing 411 4 Changle 5 12 Cangzhou Wheat 20 An 85 Zhong 124-1 28 Dan R8093 5 Baiqimai 13 Yanzhen 1 21 Beijing 8686 29 Fengkang 13 6 Changwu 131 14 Purple Stalk White Awn First 22 04-044 30 Jinghe 8922 7 Dali 1 15 Neixiang 188 23 Spring 229th-25 31 Chinese Spring 8 Red Monk 16 White Rough Wheat 24 Jingpin 10 32 PANDAS

[0034] SEQ ID No.5:

[0035]

[0036] SEQ ID No.6:

[0037]

[0038] It was found that there was a SNP site (T / C) at the 1189th bp in the third exon region of the gDNA region sequence of TaJAZ10-A Figure 1 A), which belongs to a non-synonymous mutation, resulting in the amino acid changing from cysteine (Cys, C) to arginine (Arg, R). This variant site divides TaJAZ10-A into two haplotypes, TaJAZ10-A-Hap1 and TaJAZ10-A-Hap2. The physical position of the above SNP site is based on the Chinese Spring genome v1.1 as the reference genome.

[0039] II. Development of molecular markers for TaJAZ10-A

[0040] Based on the SNP site differences in the TaJAZ10-A genomic sequence among 32 polymorphic materials (Table 1), a dCAPS marker named TaJAZ10-A-HaeII was designed using the online website dCAPS Finder2.0 at the 1189th (A / G) SNP variation. By introducing a mismatched base C in the primer, the 1189th (A / G) variation can be cut by the restriction endonuclease Haeii (Y▼CGCGR) Figure 1 C). The second-round PCR amplification was carried out using the molecular marker primers TaJAZ10-A-HaeII-F / R (the primers used in the first-round PCR amplification were TaJAZ10-A-gF1 / gR1 and TaJAZ10-A-gF2 / gR2), and the length of the target fragment was 113 bp; then the PCR product was digested with the restriction endonuclease Haeii, and different allelic variations of TaJAZ10-A were judged according to the fragment sizes of the digested products Figure 1 D);

[0041] TaJAZ10-A-HaeII-F: 5’-AGGGCAAATTATCTACCTTGATTTATAGGC-3’ (SEQ ID No.7);

[0042] TaJAZ10-A-HaeII-R: 5’-TCCCGAACGGTGTTGCTG-3’ (SEQ ID No.8).

[0043] The theoretical amplification product is a 131-bp target band (SEQ ID No.9).

[0044] SEQ ID No.9:

[0045] AGGGCAAATTATCTACCTTGATTTATAGACACCAACAGTCGAAGCAGCCACCGCATTGTTCATC ACGAAAGGCGGTTGTTTGAACGGGCTACCAGCAGCAACACCGTTCGGGA

[0046] III. Association analysis between TaJAZ10-A marker TaJAZ10-A-HaeII and agronomic traits

[0047] Using the molecular marker TaJAZ10-A-HaeII to scan 389 wheat materials in natural population I (Table 2. Since all wheat materials are cultivated varieties, they are usually considered highly homozygous plant materials, and the haplotypes are all homozygous. The same below), allelic variations TaJAZ10-A-HaeII-T (TaJAZ10-A-Hap1) and TaJAZ10-A-HaeII-C (TaJAZ10-A-Hap2) were found in natural population I.

[0048] The genotypes of TaJAZ10-A of 389 wheat materials in natural population I are summarized in Table 2 (These wheat materials are recorded in "Shi H, Chen M, Gao L, Wang Y, Bai Y, Yan H, Xu C, Zhou Y, Xu Z, Chen J, Tang W, Wang S, Shi Y, Wu Y, Sun D, Jia J, Ma Y. Genome-wide association study of agronomic traits related to nitrogen use efficiency in wheat. Theor Appl Genet. 2022 Dec;135(12):4289-4302. doi: 10.1007 / s00122-022-04218-5. Epub 2022 Sep 22. PMID: 36136127.). These wheat materials are recorded in Figure 1 D shows the electrophoresis detection results of the PCR products of some materials after digestion with Haeii endonuclease. Among them, the one marked with T is homozygous T at the 1189th SNP site (the digestion product has only one band of 113 bp), so it is classified as TaJAZ10-A-Hap1; the one marked with C is homozygous C at the 1189th SNP site (the digestion products are 81 bp and 32 bp); so it is classified as TaJAZ10-A-Hap2. After statistics, TaJAZ10-A-Hap1 and TaJAZ10-A-Hap2 account for 46.53% and 53.47% respectively in natural population I.

[0049] Haplotype analysis results of natural population Ⅰ in Table 2

[0050]

[0051]

[0052]

[0053]

[0054]

[0055] The marker TaJAZ10-A-HaeII and the agronomic traits (plant height, spike length, spike grain number, biological yield, 1000-grain weight, fertile spikelet number, effective tiller number, yield per plant, sterile spikelet number, spikelet number per spike) of natural population Ⅰ (Table 2) were associated using the general linear model (GLM) in Tassel 5.0 software, and 4 agronomic traits of plant height, spike length, biological yield and effective tiller number were significantly associated respectively (Table 3).

[0056] Table 3 Association analysis between TaJAZ10-A marker TaJAZ10-A-HaeII and agronomic traits in natural population Ⅰ

[0057]

[0058]

[0059] Note: E1: 2020-HB-N; E2: 2020-HB-LN; E3: 2019-HB-N; E4: 2019-HB-LN; E5: 2020-SX-N; E6: 2020-SX-LN; E7: 2019-SX-N; E8: 2019-SX-LN; E9: 2018-SX-N; E10: 2018-SX-LN. The naming method is planting year-planting location-nitrogen treatment method. Among them, SX is the Shenfeng experimental field of Shanxi Agricultural University, HB is the experimental field in Zhaoxian County, Hebei, N is the normal nitrogen treatment (i.e., applying nitrogen, the nitrogen application rate is 18 kg / 667 m 2 (calculated as pure nitrogen), and 30%, 40% and 30% of the total nitrogen fertilizer amount are applied during irrigation before winter, jointing stage and heading stage respectively), LN is the low nitrogen treatment (i.e., no nitrogen is applied during the whole growth process of wheat). *, **, *** indicate that the phenotypes are significantly different at the probability levels of 0.05, 0.01, and 0.001 respectively.

[0060] Analysis of variance was performed on the plant height of the two haplotypes in 10 environments, and it was found that the plant height of haplotype TaJAZ10-A-Hap1 was higher than that of haplotype TaJAZ10-A-Hap2 in all 10 environments, and significant or highly significant levels were reached in environments E1, E2, E3, E4, E5, E6, E7, E8, E9, and E10 ( Figure 2 ); Analysis of variance was performed on the spike length of the two haplotypes in 10 environments, and it was found that the spike length of haplotype TaJAZ10-A-Hap1 was higher than that of haplotype TaJAZ10-A-Hap2 in 5 environments, and significant or highly significant levels were reached in environments E1, E2, E3, E4, and E8 ( Figure 2 ); Analysis of variance was performed on the biological yield of the two haplotypes in 10 environments, and it was found that the biological yield of haplotype TaJAZ10-A-Hap1 was higher than that of haplotype TaJAZ10-A-Hap2 in all 10 environments, and significant or highly significant levels were reached in environments E1, E2, E3, E4, E5, E6, E7, E8, E9, and E10 ( Figure 2 ); Analysis of variance was performed on the effective tillers of the two haplotypes in 10 environments, and it was found that the effective tillers of haplotype TaJAZ10-A-Hap1 were higher than those of haplotype TaJAZ10-A-Hap2 in 8 environments, and significant or highly significant levels were reached in environments E1, E3, E4, E5, E7, E8, E9, and E10 ( Figure 2 ).

[0061] IV. Verification of the association analysis results of marker TaJAZ10-A-HaeII using natural population II

[0062] Using the molecular marker TaJAZ10-A-HaeII to scan 323 wheat materials in natural population II. Natural population II (Table 4, these materials are recorded in "Du, Y., Li, C., Mao, X., Wang, J., Li, L., Yang, J., Zhuang, M., Sun, D., & Jing, R. (2022). TaERF73 is associated with root depth, thousand-grain weight and plant height in wheat over a range of environmental conditions. Food and Energy Security, 11, e325. https: / / doi.org / 10.1002 / fes3.325"), consists of 323 wheat varieties from different regions and years (1940s - 2010s). (Since all wheat materials are cultivated species, they are usually considered highly homozygous plant materials, and the haplotypes are all homozygous. The same below). It was found that the allelic variations TaJAZ10-A-HaeII-T (TaJAZ10-A-Hap1) and TaJAZ10-A-HaeII-C (TaJAZ10-A-Hap2) in natural population II accounted for 57.28% and 42.72% respectively.

[0063] Using two haplotypes in 323 varieties in natural population II to conduct a significant difference verification on plant height, spike length, biological yield and effective tiller results.

[0064] Table 4 Haplotypes of TaJAZ10-A marker TaJAZ10-A-HaeII in natural population II

[0065]

[0066]

[0067]

[0068]

[0069]

[0070] In natural population II, an analysis of variance of plant height of the two haplotypes was conducted in 13 environments. It was found that the plant height of haplotype TaJAZ10-A-Hap1 was higher than that of haplotype TaJAZ10-A-Hap2 in all 13 environments, and it reached a significant or extremely significant level in environments E1, E2, E3, E4, E5, E6, E7, E8, E9, E10, E11, E12 and E13.Figure 2 ); Analysis of variance was performed on the spike length of the two haplotypes in 6 environments, and it was found that the spike length of haplotype TaJAZ10-A-Hap1 was higher than that of haplotype TaJAZ10-A-Hap2 in 4 environments, and reached a significant or highly significant level in environments E1, E3, E4, and E6 ( Figure 2 ); Analysis of variance was performed on the biological yield of the two haplotypes in 4 environments, and it was found that the biological yield of haplotype TaJAZ10-A-Hap1 was higher than that of haplotype TaJAZ10-A-Hap2 in 2 environments, and reached a significant or highly significant level in environments E1 and E2 ( Figure 2 ); Analysis of variance was performed on the effective tillers of the two haplotypes in 13 environments, and it was found that the effective tillers of haplotype TaJAZ10-A-Hap1 were higher than those of haplotype TaJAZ10-A-Hap2 in 8 environments, and reached a significant or highly significant level in environments E1, E2, E5, E8, E10, E11, E12, and E13 ( Figure 2 ).

[0071] Figure 3 Planting year - Planting location - Treatment method Note: 2016 - SY - D + H; E2: 2016 - SY - D; E3: 2016 - SY - W + H; E4: 2016 - SY - W; E5: 2016 - CP - W; E6: 2016 - CP - D; E7: 2015 - SY - D + H; E8: 2015 - SY - D; E9: 2015 - SY - W + H; E10: 2015 - SY - W; E11: 2020 - TG - W; E12: 2021 - TG - H; E13: 2021 - TG - W; E14: 2023 - SF - LN AVG; E15: 2023 - SF - NN; E16: 2024 - SF - LN; E17: 2024 - SF - NN. The naming method is planting year - planting location - treatment method. Among them, SY is the experimental field in Shunyi, Beijing, CP is the experimental field in Changping, Beijing, TG is the experimental field in Taigu, Shanxi Agricultural University, SF is the experimental field in Shenfeng, Shanxi Province, D is dry land, H is heat treatment, W is irrigated land, NN is normal nitrogen treatment (i.e., applying nitrogen, the nitrogen application rate is 18 kg / 667 m2 (calculated by pure nitrogen), and 30%, 40%, and 30% of the total nitrogen fertilizer amount are applied during irrigation before winter, jointing stage, and heading stage respectively), and LN is low nitrogen treatment (i.e., no nitrogen is applied during the whole growth process of wheat).

[0072] V. Geographic distribution of different haplotypes of TaJAZ10 - A

[0073] Wheat cultivation in China spreads across the country. According to the natural conditions such as climate, terrain, and soil type in different regions of China, the wheat planting areas in China are divided into ten wheat regions (I - X), namely, I Northern Winter Wheat Region, II Huanghuai Winter Wheat Region, III Middle and Lower Yangtze River Winter Wheat Region, IV Southwest Winter Wheat Region, V South China Winter Wheat Region, VI Northeast Spring Wheat Region, VII Northern Spring Wheat Region, VIII Northwest Spring Wheat Region, IX Qinghai-Tibet Winter and Spring Wheat Region, and X Xinjiang Winter and Spring Wheat Region.

[0074] To study the distribution of TaJAZ10-A haplotypes in wheat regions of China, the distribution frequencies ( Figure 4 ) of two haplotypes of TaJAZ10-A, TaJAZ10-A-Hap1 and TaJAZ10-A-Hap2, in wheat natural population I (Table 2) were counted. The results showed that: in wheat regions II, III, V, VI, VII, IX, and X, the frequency of TaJAZ10-A-Hap1 was higher than that of TaJAZ10-A-Hap2. On the contrary, in wheat regions I and IV, the frequency of TaJAZ10-A-Hap1 was lower than that of TaJAZ10-A-Hap2.

[0075] VI. Frequency Distribution of TaJAZ10-A Haplotypes in Wheat Varieties of Different Eras

[0076] To verify whether excellent allelic variations have been positively selected by breeders and the natural environment, the present invention conducted a statistical analysis on the haplotypes of wheat varieties of different eras in natural population II (Table 4, and these materials are recorded in "Du, Y., Li, C., Mao, X., Wang, J., Li, L., Yang, J., Zhuang, M., Sun, D., & Jing, R. (2022). TaERF73 is associated with root depth, thousand-grain weight and plant height in wheat over a range of environmental conditions. Food and Energy Security, 11, e325. https: / / doi.org / 10.1002 / fes3.325"). The natural population II was scanned using the molecular marker TaJAZ10-A-HaeII to verify whether the haplotype TaJAZ0-A-Hap2 has been positively selected during the wheat variety improvement process.

[0077] The results are as Figure 5As shown, it indicates that the haplotype TaJAZ10-A-Hap2 was 25% during the 1940s. After that, over time, the frequency of the haplotype TaJAZ10-A-Hap2 showed a gradually increasing trend and tended to fluctuate stably around 50%. Moreover, the frequency of the haplotype TaJAZ10-A-Hap2 did not yet dominate in the chronological distribution, indicating that there is still a large room for selection of the excellent haplotype TaJAZ10-A-Hap2 in the wheat breeding process.

[0078] Comprehensive association analysis, variance analysis, and geographical and chronological distribution frequencies show that the molecular marker TaJAZ10-A-HaeII developed by the present invention can accurately screen wheat varieties with the following two different haplotypes: TaJAZ10-A-Hap1 is a haplotype with tall stems, long spikes, high biomass, and many tillers, which is helpful for utilization in aspects such as feed, bioenergy, soil improvement, ecological restoration, and ornamental use; while TaJAZ10-A-Hap2 is a haplotype with short stems, short spikes, low biomass, and few tillers, which is helpful for cultivating wheat varieties with strong lodging resistance during the wheat breeding process. The molecular marker TaJAZ10-A-HaeII provided by the present invention lays a foundation for subsequent researchers to screen wheat varieties with different types.

[0079] As described above, it is only the specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any modification, equivalent replacement, and improvement made by any person skilled in the art within the technical scope disclosed by the present invention, as long as it is made within the spirit and principle of the present invention, shall be covered by the protection scope of the present invention.

Claims

1. A molecular marker for the wheat TaJAZ10-A gene, characterized in that, The molecular marker is TaJAZ10-A-HaeII, and its nucleotide sequence is as shown in SEQ ID NO: 9, with a sequence length of 113 bp.

2. The molecular marker of wheat TaJAZ10-A gene according to claim 1, characterized in that, The molecular marker is obtained by PCR amplification using the upstream primer TaJAZ10-A-HaeII-F and the downstream primer TaJAZ10-A-HaeII-R. The nucleotide sequence of the upstream primer TaJAZ10-A-HaeII-F is as shown in SEQ ID NO: 7, and the nucleotide sequence of the downstream primer TaJAZ10-A-HaeII-R is as shown in SEQ ID NO:

8.

3. The molecular marker of the wheat TaJAZ10-A gene as described in claim 1, characterized in that, The TaJAZ10-A gene contains two genotypes, TaJAZ10-A-Hap1 and TaJAZ10-A-Hap2.

4. The molecular marker of the wheat TaJAZ10-A gene according to claim 1, characterized in that, TaJAZ10-A-Hap1 is homozygous for T at the 1189th SNP site in the third exon region of the gDNA region sequence of TaJAZ10-A, and the digestion product has only one band of 113 bp. TaJAZ10-A-Hap2 is homozygous for C at the 1189th SNP site in the third exon region of the gDNA region sequence of TaJAZ10-A, and the digestion products are 81 bp and 32 bp.

5. A kit for screening wheat varieties with TaJAZ10-A-Hap1 or TaJAZ10-A-Hap2 haplotypes, comprising the molecular marker TaJAZ10-A-HaeII as claimed in claim 1.

6. An application of the molecular marker of the wheat TaJAZ10-A gene as claimed in claim 1 in screening wheat varieties with TaJAZ10-A-Hap1 or TaJAZ10-A-Hap2 haplotypes.

7. The application according to claim 6, wherein, The TaJAZ10-A-Hap1 is a haplotype with tall stems, long spikes, high biomass, and many tillers, which is helpful for utilization in aspects such as feed, bioenergy, soil improvement, ecological restoration, and ornamental use. The TaJAZ10-A-Hap2 is a haplotype with short stems, short spikes, low biomass, and few tillers, which is helpful for breeding wheat varieties with strong lodging resistance in the wheat breeding process.