Reagent for nucleic acid extraction and amplification of porcine epidemic diarrhea virus and application
Through RT-RAA technology combined with colloidal gold test strips and specific primer probes, the problem of on-site detection of PEDV is solved, and the rapid extraction and amplification of viral nucleic acids is achieved. It is suitable for on-site rapid detection of PEDV, improving the sensitivity and specificity of the detection.
Patent Information
- Application Number
- CN202510873453.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-27
- Publication Date
- 2025-07-25
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
The existing technology is difficult to achieve fast, simple and accurate on-site detection of pig epidemic diarrhea virus (PEDV), and the nucleic acid extraction steps are complex and time-consuming, which limits the effective prevention and control of virus spread and economic losses.
Recombinase-mediated amplification (RT-RAA) technology was used to combine colloidal gold test strips, and specific primer probe combinations were designed, and nucleic acid extraction was performed using trimethylolamide, tretone X-100 and chelating resin 100 to achieve rapid extraction and amplification detection of viral nucleic acids.
Without the need for expensive equipment, the on-site rapid extraction and detection of PEDV viral nucleic acid is achieved. It is simple to operate and takes only 20 minutes. It is suitable for on-site rapid detection of PEDV, improving the sensitivity and specificity of the detection.
Smart Images

Figure CN120366519A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of molecular detection, and more specifically, to a reagent for nucleic acid extraction and amplification of porcine epidemic diarrhea virus and its application. Background Art
[0002] Porcine Epidemic Diarrhea (PED) is an acute and highly contagious intestinal disease caused by Porcine Epidemic Diarrhea Virus (PEDV). It can cause symptoms such as vomiting, diarrhea, and dehydration in piglets, and the mortality rate of piglets can reach 100%. PEDV was first discovered in 1971, and since then, the virus has spread widely around the world. In 1973, an acute diarrhea outbreak similar to TGE was first observed in China, but it was not until 1984 that the pathogen of this disease was confirmed to be PEDV. In October 2010, a highly pathogenic variant PEDV strain emerged, which is characterized by a high incidence rate (nearly 100%) and high mortality rate (80% - 100%) in newborn piglets. Sequence insertions and mutations found in the variant strains may endow the PEDV variant strains with stronger pathogenicity, thus affecting the effectiveness of the original vaccines, and ultimately leading to severe porcine epidemic diarrhea outbreaks in pig farms. PEDV constantly undergoes gene mutations, and the existing classical strain vaccines have unsatisfactory preventive and control effects on the mutant strains. Early detection and accurate diagnosis of PEDV are the keys to controlling its spread in farms. Therefore, developing a simple, sensitive, accurate, rapid, and efficient on-site detection technology for PEDV is of great significance for disease prevention and control.
[0003] Currently, a variety of PEDV detection methods have been established, including virus isolation, immunofluorescence (IF), immunohistochemistry (IHC), polymerase chain reaction (PCR), and enzyme-linked immunosorbent assay (ELISA). Among them, molecular detections such as real-time fluorescence quantitative PCR (RT-qPCR) have become the preferred methods for diagnosing PEDV infection, which can sensitively, specifically, and accurately detect the viral nucleic acid in clinical samples. However, these technologies all require bulky and expensive instrument equipment and complex operations, making it difficult to be used for rapid on-site detection and restricting their wide application. Therefore, a new technology is needed to solve the above problems.
[0004] Recombinase-Aided Amplification (RAA) technology is a novel nucleic acid amplification technology. Compared with traditional PCR technology, it does not require expensive experimental equipment and consumables, has a wider application range, and is easier to operate. Its rapid amplification of DNA or RNA can be achieved at a lower temperature. The reaction speed is fast, and amplification products can be obtained within 5 - 30 minutes. Compared with other isothermal amplification technologies such as LAMP, RAA is easier to perform, only requires a pair of primers, and has a shorter running time. While LAMP requires four to six primers, runs at a higher temperature of 65°C, and has a longer running time. Currently, RAA technology has been widely used in the detection of pathogens such as viruses and bacteria. Although RAA technology has many advantages, when applying it to the detection of PEDV, there are still some technical challenges. RAA technology has extremely high requirements for the specificity and stability of primers during the amplification process. However, the gene sequence of PEDV has certain variations. How to design primers that can accurately identify and amplify the specific nucleic acid fragment of PEDV while avoiding non-specific binding with other related viruses or host nucleic acids is an urgent problem to be solved. In addition, various components in the RAA reaction system, such as recombinase and single-stranded binding protein, are sensitive to reaction conditions. How to optimize the reaction system to maintain a stable amplification effect under different sample sources and environmental conditions is also a key technical problem. Finally, combining RAA technology with lateral flow dipstick (LFD) technology for the detection of PEDV requires solving the compatibility problem between the two to ensure that the amplification products can be effectively detected by LFD and achieve rapid and accurate on-site detection.
[0005] In addition, nucleic acid extraction is also a key step restricting the speed of on-site rapid nucleic acid detection. Currently, the nucleic acid extraction steps commonly used in molecular biology experiments are complex, time-consuming, and costly, and are not suitable for on-site rapid nucleic acid detection. On-site rapid diagnosis is necessary for reducing the spread of the virus and economic losses. Therefore, it is also necessary to provide an effective way to achieve on-site rapid extraction of nucleic acids. Summary of the Invention
[0006] To solve the above-mentioned technical problems existing in the prior art, based on RT-RAA technology and using the PEDV N gene as the detection target, the present invention has developed an on-site visual detection method for PEDV nucleic acid. At the same time, a simple and rapid nucleic acid extraction method has also been developed, enabling it to efficiently extract viral nucleic acids from samples without expensive reagents and precision instruments and apply them to the sample pretreatment of RT-RAA detection. The entire detection process only takes 20 minutes, is easy to operate, and is suitable for on-site rapid detection of PEDV, providing technical support for the daily monitoring and prevention and control of PEDV.
[0007] The technical solution of the present invention is as follows: The first object of the present invention is to provide a primer-probe combination for recombinase-mediated amplification detection of porcine epidemic diarrhea virus, and the primer-probe combination includes: Forward primer F: 5'-TCACAGAATCGTGGAAATAACCAGGGTCG-3' (SEQ ID NO.1); Reverse primer R: 5'-Biotin-CATCCTTGACAGCAGCCACCAGATCATCGC-3' (SEQ ID NO.2); Probe P: 5'-6-FAM-SEQ ID NO.3-dSpacer-SEQ ID NO.4-C3-Spacer / -3' connected in sequence from 5’ to 3’; Wherein, SEQ ID NO.3 is the sequence of AACAGAGGAGGCAATAATAATAACAATAACAAG; SEQ ID NO.4 is the sequence of CGTAACCAGTCCAAG; Wherein "Biotin" is biotin, "6-FAM" is a fluorescent group, "dSpacer" is a base deletion, and "C3-spacer" is a blocking gene.
[0008] That is, probe P is 5'-6-FAM-AACAGAGGAGGCAATAATAATAACAATAACAAG-dSpacer-CGTAACCAGTCCAAG-C3-Spacer-3'.
[0009] The second object of the present invention is to provide the application of the aforementioned primer-probe combination in the preparation of a reagent or kit for recombinase-mediated amplification detection of porcine epidemic diarrhea virus.
[0010] The third object of the present invention is to provide a reagent combination for recombinase-mediated amplification detection of porcine epidemic diarrhea virus, and the reagent combination includes the aforementioned primer-probe combination.
[0011] Furthermore, the reagent combination includes a porcine epidemic diarrhea virus extraction reagent and a porcine epidemic diarrhea virus detection reagent.
[0012] The porcine epidemic diarrhea virus extraction reagent includes tris(hydroxymethyl)aminomethane (Tris), EDTA, Triton X-100 (Triton X-100), and Chelex 100 (chelating resin 100); The porcine epidemic diarrhea virus detection reagent includes a recombinase-mediated amplification reaction system; The recombinase-mediated amplification reaction system includes Buffer A, ddH2O, the aforementioned primer-probe combination, and Buffer B. Buffer A is a PEG solution with a volume percentage of 20%, and Buffer B is a magnesium acetate solution with a molar concentration of 280 mM.
[0013] Furthermore, the porcine epidemic diarrhea virus detection reagent further includes a recombinase-mediated amplification reagent, which includes recombinase, DNA polymerase, single-stranded DNA binding protein, dNTP, and exonuclease.
[0014] In a particular embodiment, the recombinase-mediated amplification reagent is purchased from AmpFuture (Changzhou) Biotechnology Co., Ltd., with a specification of 48T / box and a product catalog number of WLE8202KIT.
[0015] Furthermore, the porcine epidemic diarrhea virus extraction reagent includes tris(hydroxymethyl)aminomethane with a molar concentration of 10 mM, EDTA with a molar concentration of 25 mM, Triton-X100 with a volume percentage of 0.5%, and Chelex100 with a volume percentage of 0.5%.
[0016] Furthermore, the volume of the recombinase-mediated amplification reaction system is 50 µL. The porcine epidemic diarrhea virus detection reagent includes a recombinase-mediated amplification reaction system containing 29.4 µL of Buffer A, 11.3 µL of ddH2O, 2 µL of 10 µM forward primer, 2 µL of 10 µM reverse primer, 0.8 µL of 10 µM probe, 2 µL of template, and 2.5 µL of Buffer B. Mix well and transfer it to a recombinase-mediated amplification reaction unit containing the recombinase-mediated amplification reagent.
[0017] The fourth object of the present invention is to provide a kit for detecting porcine epidemic diarrhea virus by recombinase-mediated amplification. The kit includes the aforementioned reagent combination and a colloidal gold test strip.
[0018] Furthermore, the colloidal gold test strip includes a conjugate pad and an NC membrane; there are a control line and a test line on the NC membrane. The control line contains biotin conjugated with BSA, and the test line contains a monoclonal antibody against FAM; the conjugate pad is sprayed with streptavidin labeled with colloidal gold.
[0019] There are no special requirements for the other components of the colloidal gold test strip. For example, it may further include a PVC backplate, an absorbent pad, and a sample pad.
[0020] The fifth object of the present invention is to provide a method for detecting porcine epidemic diarrhea virus by recombinase-mediated amplification. The method includes the following steps: S1. Extract the tissue sample to be tested, mix the tissue sample to be tested with the aforementioned porcine epidemic diarrhea virus extraction reagent, incubate and centrifuge, and then take the supernatant as the template for subsequent detection; S2. Construction of the recombinant enzyme-mediated amplification reaction system to be tested: Add the aforementioned porcine epidemic diarrhea virus detection reagent to the template obtained in S1 to construct the recombinant enzyme-mediated amplification reaction system to be tested; S3. Recombinant enzyme-mediated amplification: Perform recombinant enzyme-mediated amplification detection on the recombinant enzyme-mediated amplification reaction system constructed in S2, dilute the reaction solution 10-fold with ddH2O, and drop the diluted reaction solution on the colloidal gold test strip for colloidal gold test strip determination.
[0021] Further, the tissue sample to be tested in S1 is selected from one or more combinations of feces, anal swab sampling specimens, intestinal contents or tissue grinding fluids; the tissue sample to be tested is mixed with the porcine epidemic diarrhea virus extraction reagent in an equal volume; the incubation is at room temperature for 5 min; the centrifugation is instantaneous centrifugation for 30 s.
[0022] Further, the system for recombinant enzyme-mediated amplification detection in S2 is 50 μL, including 29.4 µL Buffer A, 11.3 µL ddH2O, 2 µL 10µM upstream primer, 2 µL 10µM downstream primer, 0.8 µL 10µM probe, 2 µL template, 2.5 µL Buffer B. Buffer A is a PEG solution with a volume percentage of 20%, and Buffer B is a magnesium acetate solution with a molar concentration of 280 mM.
[0023] Further, the reaction time of the recombinant enzyme-mediated amplification in S3 is 10 min to 30 min, and the reaction temperature is 38°C to 42°C.
[0024] Further, the reaction time of the recombinant enzyme-mediated amplification in S3 is 10 min, and the reaction temperature is 38°C.
[0025] Further, the judgment criterion for the colloidal gold test strip determination in S3 is: If red bands appear in both the quality control area and the detection area, the test result is positive; if only a red band appears in the quality control area, the test result is negative; if no band appears in the quality control area, the test result is invalid.
[0026] The beneficial effects of the present invention are as follows: 1. The present invention provides a method for rapidly extracting viral nucleic acid on-site. By applying this method, the extraction of viral nucleic acid from samples can be quickly completed through simple manual operations on-site, without relying on laboratory tools such as centrifuges, pipettors, and vortex mixers. Compared with other nucleic acid extraction reagents on the market, such as column-based nucleic acid extraction and magnetic bead nucleic acid extraction kits, this kit provides an efficient tool for the rapid on-site detection of PEDV virus.
[0027] 2. The present invention provides a method for instantaneously detecting PEDV virus nucleic acid. This method uses RT-RAA technology combined with colloidal gold test strips for detection, and it only takes 15 minutes to complete the in vitro amplification and detection of viral RNA. Compared with other nucleic acid detection reagents on the market, such as polymerase chain reaction (PCR) and loop-mediated isothermal amplification (LAMP) detection kits, this kit provides an efficient tool for the instant detection of PEDV virus.
[0028] 3. This kit can perform isothermal amplification at 38°C. Compared with the 94°C high-temperature denaturation of PCR and the 60°C reaction of LAMP, this method has a lower reaction temperature, less energy consumption, and lower requirements for instrument equipment. In addition, at a lower temperature, the probability of nucleic acid volatilization generating nucleic acid aerosols is lower, and the detection is safer. Description of the Drawings
[0029] Figure 1 It is the comparative detection result of extracting sample nucleic acid with different formulations in Example 1.
[0030] Figure 2 It is the comparison of the effects of three extraction methods: rapid extraction reagent, magnetic bead extraction, and column extraction in Example 1.
[0031] Figure 3 It is the primer screening result of the PEDV RT-RAA reaction system in Example 3, where: Figure 3 A in it is the screening result of the colloidal gold test strip; Figure 3 B in it is the analysis result of the gray value of the T line of the test strip.
[0032] Figure 4 It is the optimization result of the primer concentration of the PEDV RT-RAA reaction system in Example 4, where: Figure 4 A in it is the detection result of the colloidal gold test strip, Figure 4 B in it is the analysis result of the gray value of the T line of the test strip.
[0033] Figure 5 It is the optimization result of the probe concentration of the PEDV RT-RAA reaction system in Example 4, where: Figure 5A in it is the detection result of the colloidal gold test strip, Figure 5 B in it is the analysis result of the gray value of the T line of the test strip.
[0034] Figure 6 It is the optimization result of the reaction temperature of the PEDV RT-RAA reaction system in Example 4, where: Figure 6 A in it is the detection result of the colloidal gold test strip, Figure 6 B in it is the analysis result of the gray value of the T line of the test strip.
[0035] Figure 7 It is the optimization result of the reaction time of the PEDV RT-RAA reaction system in Example 4, where: Figure 7 A in it is the detection result of the colloidal gold test strip, Figure 7 B in it is the analysis result of the gray value of the T line of the test strip.
[0036] Figure 8 It is the optimization of the dilution degree of the reaction liquid sample of the PEDV RT-RAA reaction system in Example 4, where: Figure 8 A in it is the detection result of the colloidal gold test strip, Figure 8 B in it is the analysis result of the gray value of the T line of the test strip.
[0037] Figure 9 It is the specificity verification result of the PEDV RT-RAA reaction system in Example 5, where: Figure 9 A in it is the detection result of the colloidal gold test strip, Figure 9 B in it is the analysis result of the gray value of the T line of the test strip.
[0038] Figure 10 It is the sensitivity verification result of the PEDV RT-RAA reaction system in Example 6, where: Figure 10 A in it is the detection result of the colloidal gold test strip, Figure 10 B in it is the analysis result of the gray value of the T line of the test strip.
[0039] Figure 11 It is the repeatability verification result of the PEDV RT-RAA reaction system in Example 7, where: Figure 11 A in it is the detection result of the colloidal gold test strip, Figure 11 B in it is the analysis result of the gray value of the T line of the test strip.
[0040] Figure 12 This is the result diagram of the on-site rapid extraction and detection technology of PEDV nucleic acid for detecting clinical samples in Example 8, where: Figure 12 A in it is the detection result of negative clinical samples, Figure 12 B in it is the detection result of positive clinical samples. Specific implementation manners
[0041] The present invention will be further explained below in conjunction with embodiments, but the embodiments do not impose any form of limitation on the present invention.
[0042] Example 1 Establishment of rapid nucleic acid extraction technology
[0043] 1. Prepare a rapid nucleic acid extraction solution, and the specific formula is as follows: The components of solution A are: Tris with a molar concentration of 10 mM, EDTA with a molar concentration of 25 mM, Triton-X100 with a volume percentage of 0.5%, and Chelex100 with a volume percentage of 0.5%; The components of solution B are: Tris with a molar concentration of 10 mM, EDTA with a molar concentration of 25 mM, Triton-X100 with a volume percentage of 0.5%, and Tween-20 with a volume percentage of 0.5%; The components of solution C are: Tris with a molar concentration of 10 mM, EDTA with a molar concentration of 1 mM, and Chelex100 with a volume percentage of 5%; The components of solution D are: Tris with a molar concentration of 10 mM, EDTA with a molar concentration of 1 mM, and Triton-X100 with a volume percentage of 0.2%.
[0044] 2. Sample pretreatment Cell samples: Transfer the samples to a 1.5 mL sterile centrifuge tube, centrifuge at 8000 rpm for 2 min, and take 100 μL of the supernatant into a 1.5 mL sterile centrifuge tube; Anal swab samples: Moisten the cotton swab in physiological saline and smear it by turning over at the sampling site. After collection, break off the swab head and put it into a centrifuge tube containing 5 mL of physiological saline.
[0045] Operation steps: Take 100 μL of the sample supernatant, add 100 μL of the rapid nucleic acid extraction solution, mix well, incubate at room temperature for 5 min, centrifuge instantaneously for 30 s, and take the supernatant as the template for subsequent detection. Use a fluorescence quantitative PCR instrument to perform one-step RT-qPCR detection on the samples.
[0046] Using the HiScript® II One Step qRT-PCR Probe Kit, add the extracted PEDV nucleic acid as a template into the PCR reaction tube. The total reaction volume in each tube is 20 μL, and centrifuge briefly. Perform the One Step qRT-PCR reaction using the rapid program.
[0047] The real-time fluorescence quantitative PCR reaction system is as follows: 3 μL of RNase-free ddH2O; 10 μL of 2 × One Step QProbe Mix; 1 μL of One Step Q Probe Enzyme Mix; 0.4 μL of the upstream primer (0.4 μM); 0.4 μL of the downstream primer (0.4 M); 0.2 μL of the probe (0.16 μM); 5 μL of the template RNA.
[0048] The amplification program of the One Step qRT-PCR reaction is as follows.
[0049] The first stage is reverse transcription, with 1 cycle at 50 °C for 15 minutes.
[0050] The second stage is pre-denaturation, with 1 cycle at 95 °C for 30 seconds.
[0051] The third stage is the cycling reaction, with 45 cycles at 95 °C for 10 seconds; 60 °C for 30 seconds.
[0052] Take 5 μL of the nucleic acid extracted with different formulations, add them to a 20 μL PCR reaction system respectively, and perform fluorescence quantitative PCR amplification. The comparative detection results of the nucleic acid of the samples extracted with different formulations are shown in Figure 1 , and the results show that the Ct value of the extraction reagent of component A is 10 - 12 cycles earlier than that of the extraction reagents of other components. Therefore, it is determined that the subsequent optimized reagent is solution A, that is, 10 mM Tris, 25 mM EDTA, 0.5% Triton-X100, 0.5% Chelex100.
[0053] Comparative Example 1
[0054] Use the rapid nucleic acid extraction solution A prepared in Example 1, a commercially available magnetic bead virus DNA / RNA extraction kit, and a column-type virus DNA / RNA extraction kit (Beijing TransGen Biotech Co., Ltd.) to detect the nucleic acid of the PEDV sample in Example 1 respectively.
[0055] The nucleic acid extraction method in this application is as follows: Take 100 μL of the sample supernatant, add 100 μL of the rapid nucleic acid extraction solution A, mix well, incubate at room temperature for 5 min, centrifuge briefly for 30 s, and take the supernatant as the template for subsequent detection. The specific operation of the commercially available product is carried out according to the instructions for extraction.
[0056] Take 5 μL of each nucleic acid sample to be tested and add them into 20 μL of the RT-qPCR reaction system respectively. After mixing and centrifuging, perform One Step qRT-PCR reaction using the rapid program and collect fluorescence signals at 60 °C. The detection results are as Figure 2 shown.
[0057] According to the amplification results, all three extraction methods can effectively extract the PEDV virus liquid samples with a dilution ratio of 1:10 8 , and as the dilution ratio increases, the amplified Ct value increases. At low dilution ratios from 1:10 to 1:10 3 , the Ct values of the three extraction methods are similar and the extraction efficiencies are comparable; while at high dilution ratios from 1:10 4 to 1:10 8 , the effects of magnetic bead extraction and column extraction are close, and the extraction effect of the rapid nucleic acid extraction solution in Example 1 is slightly lower, but there is no significant difference in extraction efficiency.
[0058] However, the average time required for magnetic bead extraction and column extraction is 50 min and 60 min respectively, and a vortex mixer, a micro centrifuge and a metal bath are required during the extraction process. While the average time required for using the rapid extraction reagent provided in Example 1 is less than 10 min. In addition, comparing the operation steps of the three methods, both magnetic bead extraction and column extraction are more complex than rapid extraction.
[0059] The parameters of the three extraction methods are as follows.
[0060] Method 1: Rapid extraction method, time less than 10 minutes, experimental equipment is a palm centrifuge and a metal bath, simple operation steps, low economic cost.
[0061] Method 2: Magnetic bead extraction method, time is 50 minutes, experimental equipment is a vortex mixer and a metal bath, complex operation steps, high economic cost.
[0062] Method 3: Column extraction method, time is 60 minutes, experimental equipment is a micro centrifuge and a metal bath, complex operation steps, high economic cost.
[0063] Establishment of PEDV standard positive plasmid in Example 2
[0064] The PEDV N gene (GenBank: MW981422.1) was synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the cloning site was EcoRV, which was cloned between the EcoRI / HindIII restriction enzyme sites of the pMD18-T vector. After extracting the positive plasmid, use a ultra-micro nucleic acid and protein concentration analyzer to determine the concentration of the extracted plasmid. According to the formula: copy number (copies / μL) = 6.02×10 23Calculate the plasmid copy number by (copies / mol) × plasmid concentration (ng / μL) / (plasmid length × 660). Dilute the plasmid into PEDV standard positive plasmids with copy number concentrations of 10 7 copies / μL, 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 copy / μL.
[0065] Example 3 Design and Screening of RT-RAA Primers and Probes for PEDV
[0066] Download the conserved regions of the N gene of multiple strains such as PEDV CV777 (GenBank accession number AF353511.1), BJ2015 (GenBank accession number KX168410.1), and JX2020 (GenBank accession number OL762460.1) from GenBank. According to the design principles of RAA primers and probes, use Primer Premier 5.0 software and SnapGene Viewer software to design multiple primers and probes, and synthesize them by Sangon Biotech (Shanghai) Co., Ltd.
[0067] The sequences of PEDV primers and probes are as follows.
[0068] Forward primer: 5'-TCACAGAATCGTGGAAATAACCAGGGTCG-3' (SEQ ID NO.1); Reverse primer 1: 5'-Biotin-CCCAAAGATTTAAGGGCATCCTTGACAGC-3' (SEQ ID NO.5), with an amplified length of 178bp.
[0069] Reverse primer 2: 5'-Biotin-CATCCTTGACAGCAGCCACCAGATCATCGC-3' (SEQ ID NO.2), with an amplified length of 163bp.
[0070] Reverse primer 3: 5'-Biotin-TGACAGCAGCCACCAGATCATCGCGTGATG-3' (SEQ ID NO.6), with an amplified length of 156bp.
[0071] Probe: 5'-FAM-AACAGAGGAGGCAATAATAATAACAATAACAAG (SEQ ID NO.3)-dSpacer-CGTAACCAGTCCAAG (SEQ ID NO.4)-C3 Spacer-3' The 5'-end of the reverse primer is labeled with biotin, so that the double-stranded DNA amplified by the forward primer and the reverse primer will be labeled with biotin. A dSpacer is labeled between the 30th and 31st bases of the probe, the 5'-end is labeled with FAM, and a blocking group C3-Spacer is labeled at the 3'-end. In this way, when the probe anneals to the biotin-labeled DNA after amplification, the nfo enzyme in the RT-RAA system will cut the probe at the dSpacer site, enabling the probe to continue to extend at the 3'-end under the action of polymerase, and finally obtaining an amplification product double-labeled with fluorescein FAM and biotin.
[0072] The three groups of primers were respectively subjected to RT-RAA amplification at 38 °C for 10 min, and the results of the colloidal gold test strip were observed. The optimal primers were determined by analyzing the gray value of the T line for subsequent experiments.
[0073] Use the AmpFuture RNA isothermal rapid amplification kit (colloidal gold test strip type) to establish a reaction system. The single-tube reaction system is 50 μL, including 29.4 µL Buffer A, 11.3 µL ddH2O, 2 µL 10 µM forward primer, 2 µL 10 µM reverse primer, 0.8 µL 10 µM probe, 2 µL template, and 2.5 µL Buffer B; mix well, add the above solution to the recombinase-mediated amplification reaction tube containing the recombinase-mediated amplification reagent and gently pipette and shake to mix evenly. Since Buffer B is the initiator of the amplification reaction, Buffer B can be added to the inner side of the reaction tube cap. After gently covering the tube cap, mix evenly. After mixing, centrifuge the reaction tube briefly and immediately place it in a preheated metal bath, maintain a constant temperature of 38 °C, and the reaction time is 10 min. After the reaction is completed, take 10 μL of the reaction solution and add it to 190 μL of ultrapure water, mix well, and then drop it into the sample well of the colloidal gold test strip. Observe the results after 5 min.
[0074] Among them, the recombinase-mediated amplification reagent is purchased from AmpFuture (Changzhou) Biotechnology Co., Ltd., specification: 48T / box, product number: WLE8202KIT. The usage amount of the recombinase-mediated amplification reagent in the 50 μL system of this experiment is 50 μL reaction system / tube; Buffer A is a PEG solution with a volume percentage of 20%; Buffer B is magnesium acetate with a molar concentration of 280 mM.
[0075] The results are as Figure 3As shown, when R2 was selected as the downstream primer for the amplification reaction, the difference in the gray scale value of the T line between the positive control and the negative control was the largest. Therefore, the upstream primer F and the downstream primer R2 were the optimal primer combination.
[0076] Example 4 Optimization of the RT-RAA Reaction System and Conditions for PEDV
[0077] (1)Optimization of primer concentration Using the established 50 μL reaction system, the plasmid constructed in Example 2 at 10 4 copies / μL was used as the positive detection sample, and nuclease-free water was used as the negative control sample. Four primer concentrations were set, and subsequent analysis operations were carried out according to the aforementioned operation steps. The primer concentrations were set as: 0.4 μM, 0.3 μM, 0.2 μM, 0.1 μM, and each sample was repeated 3 times. Observe the results of the test strip, and determine the optimal primer concentration by analyzing the gray scale value of the T line.
[0078] The detection results of the four groups of primer concentrations are as Figure 4 shown. As the primer concentration increased, the gray scale value of the T line increased, indicating an enhanced RT-RAA amplification ability. The gray scale value was the highest at 0.4 μM. Therefore, the optimal primer concentration was determined to be 0.4 μM.
[0079] (2)Optimization of probe concentration Using the established 50 μL reaction system, the plasmid at 10 4 copies / μL was used as the positive detection sample, and nuclease-free water was used as the negative control sample. Four probe concentrations were set, and subsequent analysis operations were carried out according to the aforementioned operation steps. The probe concentrations were set as: 0.16 μM, 0.12 μM, 0.08 μM, 0.04 μM, and each sample was repeated 3 times. Observe the results of the test strip, and determine the optimal probe concentration by analyzing the gray scale value of the T line.
[0080] The detection results of the four groups of probe concentrations are as Figure 5 shown. When the final probe concentration was 0.16 μM, the gray scale value of the T line was the highest. Therefore, the optimal probe concentration was determined to be 0.16 μM.
[0081] (3)Optimization of reaction temperature Using the established 50 μL reaction system, the plasmid at 10 4 copies / μL was used as the positive detection sample, and nuclease-free water was used as the negative control sample. Five gradients of reaction temperature were set, and subsequent analysis operations were carried out according to the aforementioned operation steps. The RT-RAA reaction temperature was set as: 34 °C, 36 °C, 38 °C, 40 °C, 42 °C, and each sample was repeated 3 times. Observe the results of the test strip, and determine the optimal reaction temperature by analyzing the gray scale value of the T line.
[0082] The detection results are as follows Figure 6 shown. At 38 °C, 40 °C and 42 °C, there were no significant differences in the T-line values. Here, the lower temperature of 38 °C was selected as the optimal reaction temperature.
[0083] (4)Optimization of reaction time Using the established 50 μL reaction system, with plasmid at 10 4 copies / μL as the positive detection sample and nuclease-free water as the negative control sample, six gradients of reaction time were set, and subsequent analysis operations were carried out according to the aforementioned operation steps. The RT-RAA reaction time was set to: 5 min, 10 min, 15 min, 20 min, 25 min, 30 min, and each sample was repeated 3 times. Observe the results of the test strip, and determine the optimal reaction time by analyzing the gray value of the T-line.
[0084] The detection results are as follows Figure 7 shown. As the RT-RAA reaction time increased from 5 min to 10 min, the gray value of the T-line showed an upward trend. From 10 min to 30 min, the gray value of the T-line remained stable. Therefore, the optimal reaction time of RT-RAA was determined to be 10 min.
[0085] (5)Optimization of the dilution degree of the reaction solution sample Using the established 50 μL reaction system, with plasmid at 10 7 copies / μL as the positive detection sample and nuclease-free water as the negative control sample, RAA amplification reaction was carried out. The reaction solution was diluted with ultrapure water, and the dilution degree of the reaction solution sample was set to: 5-fold, 10-fold, 20-fold. Observe the results of the test strip and analyze through the gray value.
[0086] The detection results are as follows Figure 8 shown. When the dilution degree of the reaction solution was 10-fold, the gray value of the T-line was the highest. Therefore, the optimal dilution degree of the reaction solution sample was determined to be 10-fold.
[0087] Example 5 Specificity evaluation of the PEDV on-site rapid detection technology
[0088] Using the established 50 μL reaction system, nucleic acids extracted from clinical samples of porcine reproductive and respiratory syndrome virus (PRRSV), classical swine fever virus (CSFV), pseudorabies virus (PRV), porcine circovirus type 2 (PCV2), porcine deltacoronavirus (PDCoV), porcine oral herpesvirus (PoRV), and transmissible gastroenteritis virus of swine (TGEV) were used as templates for amplification detection, and PEDV plasmid at 10 4 copies / μL was used as the positive control sample.
[0089] The viral nucleic acid used was obtained by extracting clinical tissue samples with the rapid nucleic acid extraction solution A prepared in Example 1.
[0090] The results were as Figure 9 shown. Except for an obvious red band appearing in the detection area of the PEDV plasmid, no red bands were observed in the detection areas of the other 7 samples. This proved that the method had good specificity and no cross-reaction with the other 7 porcine disease viruses, and could specifically detect PEDV positive samples.
[0091] Example 6 Sensitivity evaluation of the PEDV on-site rapid detection technology
[0092] Using the constructed PEDV positive standard plasmids at 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 copy / μL as templates, and using nuclease-free water as a negative control sample, the RT-RAA system of PEDV was used for amplification detection.
[0093] The results were as Figure 10 shown. When the template amount was 10 1 copies / μL and higher concentrations, obvious bands were observed in the detection area by the naked eye. Therefore, this method had good sensitivity, and the lowest detection limit was 10 1 copies / μL.
[0094] Example 7 Repeatability evaluation of the PEDV on-site rapid detection technology
[0095] Using the constructed PEDV positive standard plasmids at 10 6 copies / μL, 10 4 copies / μL and 10 2 copies / μL as templates, the RT-RAA system of PEDV was used for three repeated amplification detections. The results of the test strips were observed, and the coefficient of variation was determined by analyzing the gray value of the T line.
[0096] The results were as Figure 11 shown. The detection lines could be stably shown in all three repetitions, and the coefficients of variation were 1.58%, 2.13% and 2.72% respectively, indicating that the method had good repeatability.
[0097] Example 8 Application analysis of clinical detection
[0098] The established on-site rapid extraction and detection technology of PEDV nucleic acid was used to detect 20 clinical samples of PEDV-negative anal swabs and 20 clinical samples of PEDV-positive anal swabs preserved in this laboratory. At the same time, fluorescence quantitative RT-PCR technology was used for control detection.
[0099] The results are as Figure 12 shown. The detection method established in this study can successfully distinguish between PEDV-positive and PEDV-negative in anal swabs. Comparing the detection results of this method with those of fluorescence quantitative PCR method (Tables 1 and 2), the coincidence rate is 100%. At the same time, the detection steps of the present invention can be completed within 20 minutes, without the need for large-scale instrument equipment, and a small metal bath can meet the on-site detection requirements. These practical applications indicate that the technology of the present invention is applicable to the on-site rapid detection of PEDV.
[0100] The qPCR detection results of positive clinical samples are shown in Table 1 below.
[0101] Table 1 .
[0102] The comparison between the RAA nucleic acid test strip reaction system and the qPCR detection results is shown in Table 2.
[0103] Table 2 .
[0104] The above is only the preferred embodiment of the present invention and is not intended to limit the present invention. This kit is applicable to the rapid extraction of nucleic acids of general viruses and the on-site rapid detection of PEDV. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.
[0105] The above is only the preferred implementation manner of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.
Claims
1. A primer-probe combination for recombinase polymerase amplification detection of porcine epidemic diarrhea virus, characterized in that, The primer-probe combination described above includes: Forward primer F: 5'-TCACAGAATCGTGGAAATAACCAGGGTCG-3'; Reverse primer R: 5'-Biotin-CATCCTTGACAGCAGCCACCAGATCATCGC-3'; Probe P: 5'-6-FAM-AACAGAGGAGGCAATAATAATAACAATAACAAG-dSpacer-CGTAACCAGTCCAAG-C3-Spacer-3'; wherein Biotin is biotin, 6-FAM is a fluorophore, dSpacer is a base deletion, and C3-spacer is a blocking gene.
2. Use of the primer-probe combination according to claim 1 in the preparation of a reagent or kit for recombinase-mediated amplification detection of porcine epidemic diarrhea virus.
3. A reagent combination for detecting porcine epidemic diarrhea virus by recombinase-mediated amplification, characterized in that, The reagent combination includes the primer-probe combination according to claim 1.
4. The reagent combination according to claim 3, wherein The reagent combination includes a porcine epidemic diarrhea virus extraction reagent and a porcine epidemic diarrhea virus detection reagent; The porcine epidemic diarrhea virus extraction reagent includes tris(hydroxymethyl)aminomethane, EDTA, Triton X-100, and Chelex 100; The porcine epidemic diarrhea virus detection reagent includes a recombinase-mediated amplification reaction system; The recombinase-mediated amplification reaction system includes Buffer A, ddH2O, the primer-probe combination according to claim 1, and Buffer B. Buffer A is a PEG solution with a volume percentage of 20%, and Buffer B is a magnesium acetate solution with a molar concentration of 280 mM.
5. The reagent combination according to claim 4, wherein The porcine epidemic diarrhea virus extraction reagent includes tris(hydroxymethyl)aminomethane with a molar concentration of 10 mM, EDTA with a molar concentration of 25 mM, Triton-X100 with a volume percentage of 0.5%, and Chelex 100 with a volume percentage of 0.5%; The porcine epidemic diarrhea virus detection reagent is to mix the recombinase-mediated amplification reaction system including 29.4 µL of Buffer A, 11.3 µL of ddH2O, 2 µL of 10 µM forward primer, 2 µL of 10 µM reverse primer, 0.8 µL of 10 µM probe, 2 µL of template, and 2.5 µL of Buffer B, and transfer it to a recombinase-mediated amplification reaction unit containing a recombinase-mediated amplification reagent.
6. A kit for detecting porcine epidemic diarrhea virus by recombinase polymerase amplification, characterized in that, The kit includes the reagent combination according to any one of claims 3 to 5 and a colloidal gold test strip.
7. The kit according to claim 6, wherein, The colloidal gold test strip includes a conjugate pad and an NC membrane; there are a quality control line and a detection line on the NC membrane. The quality control line contains biotin conjugated with BSA, and the detection line contains a monoclonal antibody against FAM; the conjugate pad is sprayed with streptavidin labeled with colloidal gold.
8. A recombinase polymerase amplification (RPA) assay for detecting porcine epidemic diarrhea virus, characterized in that, The method includes the following steps: S1. Extract the tissue sample to be tested, mix the tissue sample to be tested with the porcine epidemic diarrhea virus extraction reagent according to claim 4 or 5, incubate and centrifuge, and take the supernatant as the template for subsequent detection; S2. Construction of the recombinant enzyme-mediated amplification reaction system to be tested: Add the porcine epidemic diarrhea virus detection reagent described in Claim 4 or 5 to the template obtained in S1 to construct the recombinant enzyme-mediated amplification reaction system to be tested; S3. Recombinant enzyme-mediated amplification: Perform recombinant enzyme-mediated amplification detection on the recombinant enzyme-mediated amplification reaction system constructed in S2. Dilute the reaction solution 10-fold with ddH2O, and add the diluted reaction solution dropwise onto a colloidal gold test strip for colloidal gold test strip determination.
9. The detection method according to claim 8, wherein The tissue sample to be tested described in S1 is selected from one or a combination of more than one of feces, anal swab sampling specimens, intestinal contents or tissue grinding fluids; the tissue sample to be tested is mixed with the porcine epidemic diarrhea virus extraction reagent in an equal volume; the incubation is at room temperature for 5 min; the centrifugation is instantaneous centrifugation for 30 s.
10. The detection method according to claim 8, characterized in that The system for the recombinant enzyme-mediated amplification detection described in S2 is 50 μL, including 29.4 µL Buffer A, 11.3 µL ddH2O, 2 µL of 10 µM forward primer, 2 µL of 10 µM reverse primer, 0.8 µL of 10 µM probe, 2 µL of template, and 2.5 µL of Buffer B. Buffer A is a PEG solution with a volume percentage of 20%, and Buffer B is a magnesium acetate solution with a molar concentration of 280 mM.
11. The detection method according to claim 8, characterized in that The reaction time for the recombinant enzyme-mediated amplification described in S3 is 10 min to 30 min, and the reaction temperature is 38°C to 42°C.
12. The detection method according to claim 11, characterized in that, The reaction time for the recombinant enzyme-mediated amplification described in S3 is 10 min, and the reaction temperature is 38°C.
13. The detection method according to claim 8, wherein, The judgment criteria for the colloidal gold test strip determination described in S3 are: If red bands appear in both the quality control area and the detection area, the test result is positive; if only a red band appears in the quality control area, the test result is negative; if no band appears in the quality control area, the test result is invalid.
Citation Information
Patent Citations
Treponema pallidum (TP) nucleic acid testing kit
CN102816857A
RPA-LED visualized reagent kit for detecting porcine epidemic diarrhea viruses
CN109609695A
RT-RAA-LFD primer pair, probe, test strip and kit for detecting PDCoV and application of RT-RAA-LFD primer pair, probe, test strip and kit
CN114703179A
Cited By
Colloidal carbon test strip for detecting swine transmissible gastroenteritis virus based on nano antibody and application of colloidal carbon test strip
CN120971729A