Detection kit capable of distinguishing porcine Senecavirus infection from vaccine immunity

Through the ELISA detection method of VP2-VP3-VP1 and 3AB-3C recombinant proteins, the problem of inability to distinguish between natural infection and vaccine immunity of pig Seneca virus in the prior art is solved, and accurate detection with high specificity and high sensitivity is achieved, which is suitable for distinguishing between Seneca virus infection and vaccine immunity of pig Seneca virus.

CN120369942AActive Publication Date: 2025-07-25YANGZHOU UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510513440.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-23
Publication Date
2025-07-25
Estimated Expiration
2045-04-23

AI Technical Summary

Technical Problem

The existing serological detection methods of pig Seneca virus (SVA) cannot effectively distinguish between natural infection and vaccine immunity, resulting in frequent false negative results, and insufficient specificity and sensitivity of existing methods.

Method used

VP2-VP3-VP1 and 3AB-3C recombinant proteins were used as coated antigens to distinguish the infection and vaccine immunity of pig Seneca virus through ELISA detection method. The dominant epitope region of VP2-VP3-VP1 protein and the dominant epitope region of 3AB-3C protein were used for tandem expression, and the specific dilution ratio and enzyme-labeled secondary antibody were combined to establish an accurate detection method.

Benefits of technology

It has achieved accurate distinction between Seneca virus infection and vaccine immunity from pigs, improved the specificity, sensitivity, repeatability and reproducibility of the detection, and has a wider range of application and has important application value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120369942A_ABST
    Figure CN120369942A_ABST
Patent Text Reader

Abstract

The invention discloses a detection kit capable of distinguishing porcine Senecavirus infection from vaccine immunity, and belongs to the technical field of animal virus antibody detection. The VP2-VP3-VP1 and 3AB-3C recombinant protein used in the application shows stronger antigenicity and diagnostic sensitivity when being used for detecting the porcine Senecavirus, and can effectively distinguish natural infection from vaccine immunity, thereby realizing accurate detection. Besides, the detection method also has good specificity, analysis sensitivity, repeatability and reproducibility, is wider in application range and has important application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a detection kit that can distinguish between porcine Seneca virus infection and vaccine immunization, belonging to the field of animal virus antibody detection technology. Background Technology

[0002] Seneca virus A (SVA) is a single-stranded positive-sense RNA virus belonging to the family Picornaviridae. SVA was initially thought to be associated with vesicular disease in pigs, and its clinical symptoms are similar to foot-and-mouth disease (FMD), including vesicles, lameness, and decreased appetite. The SVA genome encodes a polyprotein, which, after cleavage by proteases, forms structural proteins (VP1, VP2, VP3, etc.) and non-structural proteins (such as 3AB, 3C, etc.). Structural proteins are the main components of the viral capsid and can induce the host to produce neutralizing antibodies; while non-structural proteins play an important role in viral replication and usually induce antibody production only after natural infection.

[0003] Because the clinical symptoms of SVA are similar to those of other vesicular diseases (such as foot-and-mouth disease), accurate diagnosis is crucial for disease control. Currently, the diagnosis of SVA mainly relies on etiological testing (such as RT-PCR, virus isolation) and serological testing (such as ELISA, neutralization test). However, etiological testing can usually only detect the virus in the early stages of infection, while serological testing can reflect the host's persistent infection and immune status, and has a wider range of applications.

[0004] Currently, serological detection methods for SVA are mainly based on antibody detection of structural proteins. Most ELISA methods use single-protein coatings such as VP1 and VP2, which have fewer effective antigenic epitopes compared to SVA, making false negatives more likely. Furthermore, since structural proteins can induce antibody production in both vaccines and natural infections, existing methods cannot distinguish between vaccination and natural infection. Non-structural proteins are expressed during viral replication and are typically not found in inactivated vaccines. Therefore, the combined use of antibody detection for structural and non-structural proteins can be used to differentiate between natural infection and vaccination. Summary of the Invention

[0005] Purpose of the invention: The purpose of this invention is to provide a detection kit that can accurately distinguish between porcine Seneca virus infection and vaccine immunization.

[0006] Technical Solution: The present invention provides a detection kit for distinguishing between porcine Seneca virus infection and vaccine immunization. The kit contains recombinant VP2-VP3-VP1 protein coated with antigen and recombinant 3AB-3C protein coated with antigen. The recombinant VP2-VP3-VP1 protein comprises the dominant epitope regions of VP1 protein (5-100 aa, 145-177 aa, and 199-261 aa); the dominant epitope regions of VP2 protein (2-103 aa, 141-198 aa, and 211 aa). 284aa; the dominant epitope regions 7-32aa, 57-81aa, 135-153aa and 173-236aa of the VP3 protein are expressed by GGGGSGGGGS tandem; the recombinant 3AB-3C protein is the protein expressed by GGGGSGGGGS tandem of the dominant epitopes 1-36aa and 69-105aa of the 3AB protein and the dominant epitopes 4-29aa, 48-112aa and 138-174aa of the 3C protein.

[0007] Furthermore, the nucleotide sequence encoding the recombinant VP2-VP3-VP1 protein is shown in SEQ ID NO.1, and the nucleotide sequence encoding the recombinant 3AB-3C protein is shown in SEQ ID NO.2.

[0008] Furthermore, the recombinant VP2-VP3-VP1 protein / recombinant 3AB-3C protein is obtained by ligating the nucleotide fragment shown in SEQ ID NO.1 or SEQ ID NO.2 into a prokaryotic expression vector, followed by expression and purification using Escherichia coli.

[0009] Furthermore, the prokaryotic expression vector is pCold-Ⅰ.

[0010] Furthermore, the coating concentration of the recombinant VP2-VP3-VP1 protein after dilution is 200-400 ng / well.

[0011] Furthermore, the coating concentration of the recombinant 3AB-3C protein after dilution is 200–400 ng / well.

[0012] Furthermore, the kit also includes enzyme-labeled secondary antibody, PBST, PBS, and OD. 450 Serum samples from positive control pigs infected with the virus and immunized with the vaccine, with a nm value of 1.

[0013] Furthermore, when the kit is used to test samples, if only the antibodies against VP2-VP3-VP1 are detected as positive, but no antibodies against 3AB-3C are detected, it indicates that the sample is vaccine-immunized serum; if the antibodies against VP2-VP3-VP1 and 3AB-3C are both positive, it indicates that the sample is virus-infected serum.

[0014] Furthermore, a cut-off value greater than 0.6045 is considered positive when detecting antibodies against VP2-VP3-VP1, and a cut-off value greater than 0.248 is considered positive when detecting antibodies against 3AB-3C.

[0015] Beneficial Effects: Compared with existing technologies, this invention has the following significant advantages: The VP2-VP3-VP1 and 3AB-3C recombinant proteins used in this application exhibit stronger antigenicity when used to detect porcine Seneca virus, effectively distinguishing between natural infection and vaccine immunization, thereby achieving accurate detection. Furthermore, this detection method also possesses good specificity, sensitivity, repeatability, and reproducibility, has a wider range of applications, and has significant application value. Attached Figure Description

[0016] Figure 1 SDS-PAGE validation of recombinant protein expression of porcine Seneca virus VP1, VP2, VP3, 3AB, 3C, VP2-VP3-VP1, and 3AB-3C; M: protein marker; 1: elution and purification of VP1 protein; 2: elution and purification of VP2 protein; 3: elution and purification of VP3 protein; 4: elution and purification of 3AB protein; 5: elution and purification of 3C protein; 6: elution and purification of 3AB-3C protein; 7: elution and purification of VP2-VP3-VP1 protein.

[0017] Figure 2 Antigenicity verification of recombinant proteins of porcine Seneca virus VP1, VP2, VP3, 3AB, 3C, VP2-VP3-VP1, and 3AB-3C. Detailed Implementation

[0018] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0019] Example 1: Prokaryotic expression of recombinant proteins VP1, VP2, VP3, 3AB, and 3C

[0020] 1. Expression and purification of recombinant proteins VP1, VP2, VP3, 3AB, and 3C:

[0021] Based on the published strain sequence (GenBank: KT321458.1), the gene sequences of VP1, VP2, VP3, 3AB, and 3C were optimized for E. coli preference. The optimized sequences were synthesized by Shanghai Sangon Biotech Co., Ltd., and cloned into the pCold-Ⅰ or pCold-TF expression vectors, respectively, successfully constructing recombinant plasmids pCold-TF-VP1, pCold-VP2, pCold-VP3, pCold-TF-3AB, and pCold-3C. These recombinant plasmids were transformed into competent E. coli BL21(DE3) cells. Recombinant transformants were screened for kanamycin resistance. Single colonies were first activated overnight in LB medium, then transferred at a 1:1,000 ratio to fresh LB medium containing 50 mg / mL kanamycin and cultured until OD600. 600 When the pH reaches approximately 0.4-0.6, add 1 mM IPTG to induce expression. Incubate at 37°C with shaking at 220 rpm for 4-5 hours. Collect bacterial cells before and after induction. Sonicate the induced cells (200 W, 2 seconds sonication, 4 seconds interval, approximately 15 times). Centrifuge at 12000 rpm for 15 minutes and collect the supernatant. Resuspend the precipitate in 50 μL LE buffer and dissolve the inclusion bodies overnight at 4°C. Centrifuge the dissolved inclusion bodies at 12000 rpm for 20 minutes and collect the supernatant. Analyze the expression using SDS-PAGE. Finally, transfer the bacterial cells at a 1:100 ratio to a culture medium containing K. + The bacterial cells were shaken in 400 mL of resistant culture medium. After induction, the induced recombinant proteins VP1, VP2, VP3, 3AB and 3C were purified using a nickel column kit from Nanjing GenScript Biotech Co., Ltd.

[0022] SDS-PAGE results of purified protein are as follows Figure 1 As shown, VP1 showed a specific band at 77 kDa (lane 1); VP2 showed a specific band at 32 kDa (lane 2); VP3 showed a specific band at 27 kDa (lane 3); 3AB showed a specific band at 61 kDa (lane 4); and 3C showed a specific band at 24 kDa (lane 5), indicating that the target protein was expressed efficiently.

[0023] Example 2: Tandem expression of dominant epitope regions

[0024] 1. Tandem of the dominant epitope regions of VP1, VP2, and VP3:

[0025] Antigenic epitope prediction software predicted all possible antigenic epitope regions for the three structural proteins. The dominant epitope regions of VP1 (5-100aa, 145-177aa, and 199-261aa), VP2 (2-103aa, 141-198aa, and 211-284aa), and VP3 (7-32aa, 57-81aa, 135-153aa, and 173-236aa) were selected. The corresponding dominant epitope region gene sequences were tandemly linked, with a glycine linker (GGGGSGGGGS) added between each epitope. The designed gene sequences were synthesized by Shanghai Sangon Biotech Co., Ltd., and ligated into the prokaryotic expression vector pCold-Ⅰ to obtain the pCold-VP2-VP3-VP1 plasmid.

[0026]

[0027] 2. Induction and purification of VP2-VP3-VP1 recombinant tandem protein

[0028] The recombinant expression plasmid pCold-VP2-VP3-VP1 was transformed into competent E. coli BL21(DE3) cells. Recombinant transformants were screened for kanamycin resistance. Single colonies were picked and activated overnight in LB medium. The cells were then transferred to kanamycin-resistant LB medium at a volume ratio of 1:1,000 and cultured until OD600. 600 When the pH is approximately 0.4-0.6, add IPTG to a final concentration of 1 mM, and incubate at 220 rpm and 37°C with shaking for 4.5 h to induce growth.

[0029] Bacterial cells were collected before and after induction. The induced cells were sonicated (200W, 2s sonication, 4s interval, approximately 15 cycles), centrifuged at 12000 rpm for 15 min, and the supernatant was collected. The precipitate was resuspended in 50 μL of LE buffer and dissolved overnight at 4°C. The dissolved inclusion bodies were then centrifuged at 12000 rpm for 20 min, and the supernatant was collected. SDS-PAGE was used to detect inclusion body expression, confirming its expression. Finally, the cells were transferred at a 1:100 ratio to a culture medium containing K... + The bacterial cells were shaken in 300 mL of resistant culture medium. After induction, the induced VP2-VP3-VP1 recombinant protein was purified using a nickel column assay kit from Nanjing GenScript Biotech Co., Ltd. The results are as follows: Figure 1 As shown in lane 7.

[0030] 3. Tandem of the dominant epitope regions of antigens 3AB and 3C:

[0031] Antigenic epitope prediction software predicted all possible antigenic epitope regions for these two non-structural proteins. Dominant epitopes 1-36aa and 69-105aa for 3AB and 4-29aa, 48-112aa, and 138-174aa for 3C were selected. The gene sequences of the selected dominant epitope regions were tandemly linked, with glycine linkers (GGGGSGGGGS) added between each epitope. The designed gene sequences were synthesized by Shanghai Sangon Biotech Co., Ltd., and ligated into the prokaryotic expression vector pCold-Ⅰ to obtain the pCold-3AB-3C plasmid.

[0032] The tandem 3AB-3C sequence is shown in SEQ ID NO.2 (agccctaacgagaatgatgacacccccgtcgacgaggcgctgggtagagttctcactcccgctgcggtcgacgaggcgcttgtcg).

[0033] 4. Induction and purification of 3AB-3C recombinant tandem protein

[0034] The recombinant expression plasmid pCold-3AB-3C was transformed into competent E. coli BL21(DE3) cells. Recombinant transformants were screened for kanamycin resistance. Single colonies were picked and activated overnight in LB medium, then transferred at a volume ratio of 1:1,000 to kanamycin-resistant LB medium and cultured until OD600. 600When the pH is approximately 0.4-0.6, add IPTG to a final concentration of 1 mM, and incubate at 220 rpm and 37°C with shaking for 4.5 h to induce growth.

[0035] Collect bacterial cells before and after induction. After induction, sonicate the cells (200W, 2s sonication, 4s interval, approximately 15 cycles), centrifuge at 12000 rpm for 15 min, and collect the supernatant. Resuspend the precipitate in 50 μL of LE buffer and dissolve the inclusion bodies overnight at 4°C. Centrifuge the dissolved inclusion bodies at 12000 rpm for 20 min, collect the supernatant, and analyze the expression using SDS-PAGE. Confirmed inclusion body expression, the cells were then transferred at a 1:100 ratio to a culture medium containing K. + The bacterial cells were shaken in 300 mL of resistant culture medium. After induction, the induced 3AB-3C recombinant protein was purified using a nickel column assay kit from Nanjing GenScript Biotech Co., Ltd. The results are as follows: Figure 1 As shown in lane 6.

[0036] Example 3: Establishment and optimization of ELISA conditions

[0037] In this embodiment, both SVA antibody-positive and SVA antibody-negative pig serum were provided by the Animal Emerging and Major Disease Prevention and Control Team of the College of Veterinary Medicine, Yangzhou University, and their antibody positivity and positivity were verified by virus neutralization test.

[0038] (1) The establishment of the VP2-VP3-VP1 indirect ELISA procedure is as follows:

[0039] 1. VP2-VP3-VP1 recombinant protein was serially diluted to 50, 100, 150, 200, 300, and 500 ng / well (diluent: pH 9.6 carbonate buffer). Horseradish peroxidase-labeled goat anti-pig antibody was diluted to 1:10,000, 1:20,000, and 1:40,000 (diluent: pH 7.2 PBST). Serum samples were diluted 1:100 (diluent: pH 7.2 PBS). Using 5 SVA antibody-positive swine sera and 3 SVA antibody-negative swine sera validated by virus neutralization assays, the optimal antigen coating concentration and optimal enzyme-labeled secondary antibody dilution ratio were screened using a checkerboard method.

[0040] 2. Coat an ELISA plate with carbonate coating buffer containing recombinant VP2-VP3-VP1 protein at a volume of 100 μL / well and incubate at 4°C for 24 h. The coating buffer is 1× carbonate buffer (20× carbonate buffer ratio: 29 g NaHCO3 + 16 g NaCO3, adjusted to 1 L, thoroughly dissolved and filtered).

[0041] 3. Wash the plate once with PBST (PBS buffer containing 0.05% Tween-20) at a volume of 300 μL / well, then add 150 μL of 2.5% BSA to each well and block at 4°C for 24 h.

[0042] 4. Incubate the diluted serum samples at 37°C for 30 min. After washing four times with PBST, add diluted HRP-goat anti-pig secondary antibody and incubate at 37°C for 30 min. After washing four times with PBST, add 100 μL TMB to each well to begin the colorimetric reaction.

[0043] 5. Add 50 μL of 2M H2SO4 stop solution to each well, and stop the reaction at 37℃ for 15 min. Then measure the OD. 450 The absorbance value at nm is used to calculate the absorbance value of the positive sample / the absorbance value of the negative sample (P / N value). Based on the principle that the maximum P / N value is the optimal condition, the optimal antigen coating amount and the optimal dilution ratio of the enzyme-labeled secondary antibody are selected.

[0044] 6. Based on the results shown in Table 1, the coating amount of the universal VP2-VP3-VP1 protein was set at 300 ng / well, the serum dilution was 1:100, and the optimal dilution ratio of the enzyme-labeled antibody was set at 1:10,000.

[0045] Table 1. Optimal VP2-VP3-VP1 coating amounts and enzyme-labeled secondary antibody dilutions using the checkerboard method.

[0046]

[0047] In this invention, 300 ng / well of VP2-VP3-VP1 protein was used for coating. When the serum sample dilution was set to 1:100 and the enzyme-labeled secondary antibody dilution was set to 1:10,000, the optimal sample reaction time and enzyme-labeled reagent reaction time were both 30 min, and the optimal TMB color development time was 15 min.

[0048] The optimized ELISA conditions are as follows:

[0049] 1. Coating: VP2-VP3-VP1 recombinant protein was used as the coating antigen, with a coating amount of 300 ng / well; coating was carried out in carbonate coating buffer at 4°C for 24 h.

[0050] 2. Washing: Wash once with phosphate-buffered saline (PBST) containing 0.05% Tween-20 at pH 7.2, gently shake for 1 min and then discard.

[0051] 3. Blocking: Block with blocking solution containing 2.5% BSA in PBST buffer at pH 7.2, and block at 4°C for 24 hours;

[0052] 4. Serum reaction conditions: Add the serum dilution mixture (serum:PBS = 1:100) to each well, incubate at 37°C for 30 min, then spin dry and wash 4 times with PBST;

[0053] 5. Enzyme-labeled antigen incubation conditions: Dilute HRP-goat anti-mouse secondary antibody 1:10,000 with PBST at pH 7.2, add 100 μL to each well, incubate at 37℃ for 30 min, then spin dry and wash 4 times with PBST.

[0054] 6. Substrate color development: 100 μL of TMB substrate color development solution per well, develop color for 15 min at 37℃ in the dark;

[0055] 7. Termination of reaction: Add 50 μL of 2M H2SO4 stop solution to each well to terminate the colorimetric reaction; read the data using an ELISA reader at 450 nm absorbance.

[0056] (2) The establishment of the 3AB-3C indirect ELISA procedure is as follows:

[0057] 1. The 3AB-3C recombinant protein was serially diluted to 100, 150, 200, 300, and 500 ng / well (diluent: pH 9.6 carbonate buffer). Horseradish peroxidase-labeled goat anti-pig antibody was diluted to 1:10,000, 1:20,000, and 1:40,000 (diluent: pH 7.2 PBST). Serum samples were diluted 1:100 (diluent: pH 7.2 PBS). Using 5 SVA antibody-positive swine sera and 3 SVA antibody-negative swine sera validated by virus neutralization assays, the optimal antigen coating concentration, optimal serum dilution, and optimal enzyme-labeled secondary antibody dilution ratio were screened using a checkerboard method.

[0058] 2. Coat an ELISA plate with carbonate coating buffer containing 3AB-3C recombinant protein at a volume of 100 μL / well and incubate at 4°C for 24 h. The coating buffer is 1× carbonate buffer (20× carbonate buffer ratio: 29 g NaHCO3 + 16 g NaCO3, bring to a final volume of 1 L, dissolve thoroughly, and then filter).

[0059] 3. Wash the plate once with PBST (PBS buffer containing 0.05% Tween-20) at a volume of 300 μL / well, then add 150 μL of 2.5% BSA to each well and block at 4°C for 24 h.

[0060] 4. Incubate the diluted serum samples at 37°C for 30 min. After washing four times with PBST, add diluted HRP-goat anti-pig secondary antibody and incubate at 37°C for 30 min. After washing four times with PBST, add 100 μL TMB to each well to start the colorimetric reaction.

[0061] 5. Add 50 μL of 2M H2SO4 stop solution to each well, and stop the reaction at 37℃ for 15 min. Then measure the OD. 450 The absorbance value at nm is used to calculate the absorbance value of the positive sample / the absorbance value of the negative sample (P / N value). Based on the principle that the maximum P / N value is the optimal condition, the optimal antigen coating amount and the optimal dilution ratio of the enzyme-labeled secondary antibody are selected.

[0062] 6. Based on the results shown in Table 2, the coating amount of 3AB-3C protein was set at 300 ng / well, the serum dilution was 1:100, and the optimal dilution ratio of enzyme-labeled antibody was set at 1:20,000.

[0063] Table 2. Optimal 3AB-3C coating amount and enzyme-labeled secondary antibody dilution for screening using the checkerboard method.

[0064]

[0065] In this invention, when 300 ng / well of 3AB-3C protein was used for coating, the serum sample dilution was set to 1:100, the enzyme-labeled secondary antibody dilution was set to 1:20,000, the optimal sample reaction time and enzyme-labeled reagent reaction time were both 30 min, and the optimal TMB color development time was 15 min.

[0066] The optimized ELISA conditions are as follows:

[0067] 1. Coating: 3AB-3C recombinant protein was used as the coating antigen, with a coating amount of 300 ng / well; coating was carried out in carbonate coating buffer at 4°C for 24 h.

[0068] 2. Washing: Wash once with phosphate-buffered saline (PBST) containing 0.05% Tween-20 at pH 7.2, gently shake for 1 min and then discard.

[0069] 3. Blocking: Block with blocking solution containing 2.5% BSA in PBST buffer at pH 7.2, and block at 4°C for 24 hours;

[0070] 4. Serum reaction conditions: Add the serum dilution mixture (serum:PBS = 1:100) to each well, incubate at 37°C for 30 min, then spin dry and wash 4 times with PBST;

[0071] 5. Enzyme-labeled antigen incubation conditions: Dilute HRP-goat anti-mouse secondary antibody with PBST at pH 7.2 at a ratio of 1:20,000, add 100 μL to each well, incubate at 37℃ for 30 min, then spin dry and wash 4 times with PBST.

[0072] 6. Substrate color development: 100 μL of TMB substrate color development solution per well, develop color for 15 min at 37℃ in the dark;

[0073] 7. Termination of reaction: Add 50 μL of 2M H2SO4 stop solution to each well to terminate the colorimetric reaction; read the data using an ELISA reader at 450 nm absorbance.

[0074] (3) Determination of the critical value of VP2-VP3-VP1 as the coating source

[0075] Determination of the cutoff value: 122 antibody-positive serum samples and 107 antibody-negative serum samples from clinically infected SVA pigs were stored in the laboratory. The optimized ELISA conditions were used for detection, ROC curves were plotted, and the Youden index (sensitivity + specificity - 1) was calculated to obtain an optimal cutoff value of 0.6045. When OD... 450 A value above 0.6045 was considered positive. ROC curve analysis showed that the diagnostic sensitivity of this method was 99.7% and the diagnostic specificity was 96.72% at this level.

[0076] (4) Determination of the critical value of 3AB-3C as the coating source

[0077] Determination of the cut-off value: The method is the same as above. The cut-off value of porcine serum coated with 3AB-3C recombinant protein is 0.248. According to ROC curve analysis, the diagnostic sensitivity of this method is 100% and the diagnostic specificity is 99.17%. (5) Establishment of indirect ELISA method using VP1, VP2, VP3, 3AB and 3C recombinant proteins as coating sources

[0078] This invention establishes an indirect ELISA detection method based on recombinant proteins VP1, VP2, VP3, 3AB, and 3C (prepared in Example 1). The steps and reagents used in establishing this method are consistent with the indirect ELISA methods for VP2-VP3-VP1 and 3AB-3C tandem proteins in Examples (1) and (2). The optimal antigen coating concentration, optimal serum dilution, and optimal enzyme-labeled secondary antibody dilution ratio for each recombinant protein were determined using a checkerboard method.

[0079] After screening, the optimal coating amount for VP1 and VP2 proteins was 500 ng / well, the optimal serum dilution was 1:100, and the optimal dilution ratio for enzyme-labeled antibody was 1:10,000; the optimal coating amount for VP3 and 3AB proteins was 500 ng / well, the optimal serum dilution was 1:50, and the optimal dilution ratio for enzyme-labeled antibody was 1:10,000; the optimal coating amount for 3C protein was 500 ng / well, the optimal serum dilution was 1:25, and the optimal dilution ratio for enzyme-labeled antibody was 1:5,000.

[0080] After method optimization, the cut-off values ​​for VP2-VP3-VP1 and 3AB-3C tandem proteins were further determined using ELISA methods coated with VP2 protein (the structural protein with the best antigenicity) and 3AB protein (the non-structural protein with the best antigenicity). The results showed that the cut-off value for porcine serum coated with recombinant VP2 protein was 0.5775, and ROC curve analysis indicated a diagnostic sensitivity of 94.21% and a diagnostic specificity of 98.04%. The cut-off value for porcine serum coated with recombinant 3AB protein was 0.5355, and ROC curve analysis indicated a diagnostic sensitivity of 98.31% and a diagnostic specificity of 96.23%.

[0081] Example 4: Evaluation of ELISA conditions

[0082] (1) Sensitivity analysis

[0083] Using the detection methods established in Examples 3(1) and (2), SVA antibody-positive swine serum sample 001 and two negative swine serum samples were tested through serially diluted assays. According to the established criteria, a cut-off value greater than 0.6045 for the VP2-VP3-VP1 coated plate and a cut-off value greater than 0.248 for the 3AB-3C coated plate were considered positive. Based on the results in Table 3, the detection limit for serum sample 001 was 8-fold diluted in the VP2-VP3-VP1 coated plate and 1:16 diluted in the 3AB-3C coated plate. This indicates that the two antigen-coated ELISA detection methods established in this invention have high sensitivity.

[0084] Table 3 Detection Limits

[0085]

[0086]

[0087] (2) Analytical specificity

[0088] The antibody-positive serum samples of common swine diseases (PCV2 / PCV3 / PRRSV / ASFV / PEDV / CSFV / FMDV / SVA-) were jointly detected using the method established in Examples 3(1)(2). The serum samples were provided by the Animal Emerging and Major Diseases Comprehensive Prevention and Control Team of the College of Veterinary Medicine, Yangzhou University. The test results showed that the established method had good specificity and no cross-reaction occurred with antibody-positive serum samples of other pathogens.

[0089] (3) Verification of repeatability and reproducibility

[0090] To evaluate the accuracy of the established ELISA for detecting SVA antibodies, this study assessed its repeatability in a single experiment (intra-plate repeatability) and its reproducibility across different experiments (inter-batch repeatability). For repeatability assessment, three porcine serum samples with strong, moderate, and weak positive reactions were selected and tested eight times on a single ELISA plate to evaluate intra-plate repeatability. Simultaneously, in different experiments, three ELISA plates from the same batch (manufactured by Xiamen Yijiamei Experimental Equipment Co., Ltd.) were used to test each serum sample eight times to evaluate inter-batch repeatability. The OD values ​​for each serum sample were calculated. 450 The coefficient of variation (CV) is the ratio of the standard deviation (SD) to the mean (x-) of the nm values, used to quantify the accuracy of the detection results. As shown in Table 4, the detection method exhibits good intra-assay and inter-assay repeatability, with intra-assay CVs less than 10% and inter-assay CVs less than 15%. This indicates that the ELISA detection method of this invention has high accuracy and stability.

[0091] Table 4. Intra-plate and inter-batch repeatability verification

[0092]

[0093] Example 5: P / N ratio analysis and antigenicity advantage verification of SVA virus tandem protein and monomer protein

[0094] The serum used in this embodiment was provided by the Animal Emerging and Major Disease Prevention and Control Team of the College of Veterinary Medicine, Yangzhou University. The antibody positivity and positivity were determined by the virus neutralization test.

[0095] In this embodiment, the ELISA method established in Examples 3 and 4 was used to test five SVA antibody-positive serum samples and three SVA antibody-negative serum samples prepared after challenge treatment. During the detection process, the corresponding P / N values ​​were measured for different protein antigens. By comparing these P / N values, the antigenicity of each protein was analyzed. The results are as follows: Figure 2 As shown, the tandem protein VP2-VP3-VP1 is more reactive than the individual VP1, VP2, and VP3 proteins; similarly, the 3AB-3C protein is also more reactive than the individual 3AB and 3C proteins.

[0096] To further verify the diagnostic sensitivity of tandem proteins, this invention selected VP2-VP3-VP1 protein, 3AB-3C protein, and... Figure 2The structural protein VP2 and the non-structural protein 3AB, which showed the best reactivity, were analyzed in 35 clinical serum samples. Neutralizing antibody titers were also measured in these clinical serum samples. Comparative analysis was performed, comparing the detection results of VP2-VP3-VP1 and VP2 proteins with the neutralizing antibody titer values; similarly, the detection results of 3AB-3C and 3AB proteins were compared with the neutralizing antibody titer values. Relevant data are shown in Tables 5 to 8. Statistical analysis showed that the concordance rate between the tandem proteins VP2-VP3-VP1 and neutralizing antibodies was 88.6%, higher than the 82.8% concordance rate between VP2 and neutralizing antibodies; the concordance rate between the tandem proteins 3AB-3C and neutralizing antibodies was 80.0%, higher than the 77.1% concordance rate between 3AB and neutralizing antibodies.

[0097] Table 5. Diagnostic sensitivity analysis of VP2-VP3-VP1

[0098]

[0099] Table 6. Sensitivity analysis for VP2 diagnosis

[0100]

[0101] Table 73 AB-3C Diagnostic Sensitivity Analysis

[0102]

[0103]

[0104] Table 83 AB Diagnostic Sensitivity Analysis

[0105]

[0106] Through comparisons of antigenicity analysis and diagnostic sensitivity analysis, this embodiment fully demonstrates that the reactivity of tandem proteins is superior to that of individual proteins. This result indicates that tandem proteins offer higher accuracy and reliability in detecting antibody levels in clinical serum samples, and can more effectively reflect the neutralizing antibody titers in the samples.

[0107] Example 6: Establishing the application of the ELISA method

[0108] The serum used in this embodiment was provided by the Animal Emerging and Major Disease Prevention and Control Team of the College of Veterinary Medicine, Yangzhou University. The antibody positivity and positivity were determined by the virus neutralization test.

[0109] 1. Detection of SVA-infected serum using established methods.

[0110] This invention utilizes VP2-VP3-VP1 and 3AB-3C as coating sources to establish an antibody detection method, which was used to detect 23 positive sera infected with SVA. Based on the criteria that a cut-off value greater than 0.6045 for VP2-VP3-VP1 and a cut-off value greater than 0.248 for 3AB-3C are considered positive, the results showed that all 23 positive sera exhibited positive antibody reactions in the detection using VP2-VP3-VP1 and 3AB-3C coated plates. Specific results are shown in Table 9.

[0111] Table 9. Detection of SVA-infected serum

[0112]

[0113]

[0114] 2. Detection of SVA immune serum using established methods.

[0115] This invention establishes an SVA antibody detection method using VP2-VP3-VP1 and 3AB-3C as coating antigens, and tests 15 positive serum samples immunized with inactivated SVA vaccine. The results show that, using a cut-off value greater than 0.6045 for the VP2-VP3-VP1 coated plate as the positive criterion, all 15 positive serum samples showed a positive antibody reaction; while using a cut-off value greater than 0.248 for the 3AB-3C coated plate as the positive criterion, all 15 positive serum samples showed a negative antibody reaction. Detailed test results are shown in Table 10.

[0116] Table 10 Detection of SVA immune serum

[0117]

[0118] This invention establishes a detection method for porcine Seneca virus (SVA) antibodies using VP2-VP3-VP1 and 3AB-3C as coating antigens, and tests were performed on naturally infected serum and inactivated strain immune serum. Results showed that both coating antigens effectively detected antibodies produced in naturally infected serum. However, when detecting inactivated strain immune serum, only antibodies against VP2-VP3-VP1 were detected, and antibodies against 3AB-3C were not detected. This result indicates that the detection method of this invention, through the combined use of the two coating antigens, can effectively distinguish between natural infection and vaccine immunization of porcine Seneca virus, and has significant application value.

Claims

1. A detection kit for differentiating porcine Seneca virus infection or vaccine immunization, characterized in that, The kit contains the coated antigen recombinant VP2-VP3-VP1 protein and the coated antigen recombinant 3AB-3C protein; the recombinant VP2-VP3-VP1 protein is the protein expressed by linking the dominant epitope regions 5-100aa, 145-177aa and 199-261aa of the VP1 protein, the dominant epitope regions 2-103aa, 141-198 and 211-284aa of the VP2 protein, and the dominant epitope regions 7-32aa, 57-81aa, 135-153aa and 173-236aa of the VP3 protein through GGGGSGGGGS in series; the recombinant 3AB-3C protein is the protein expressed by linking the dominant epitopes 1-36aa, 69-105aa of the 3AB protein and the dominant epitopes 4-29aa, 48-112aa and 138-174aa of the 3C protein through GGGGSGGGGS in series.

2. The detection kit for differentiating porcine Seneca virus infection or vaccine immunization according to claim 1, wherein The nucleotide sequence encoding the recombinant VP2-VP3-VP1 protein is shown as SEQ ID NO.1, and the nucleotide sequence encoding the recombinant 3AB-3C protein is shown as SEQ ID NO.

2.

3. The detection kit for differentiating porcine Seneca virus infection or vaccine immunity according to claim 2, characterized in that, The recombinant VP2-VP3-VP1 protein / recombinant 3AB-3C protein is obtained by ligating the nucleotide fragment shown as SEQ ID NO.1 or SEQ ID NO.2 into a prokaryotic expression vector, and then expressing and purifying it using Escherichia coli.

4. The detection kit for differentiating porcine Seneca virus infection or vaccine immunization according to claim 3, wherein The prokaryotic expression vector is pCold-Ⅰ.

5. The detection kit for differentiating porcine Seneca virus infection or vaccine immunity according to claim 1, characterized in that, The coated concentration of the diluted recombinant VP2-VP3-VP1 protein is 200-400 ng / well.

6. The detection kit for differentiating porcine Seneca virus infection or vaccine immunity according to claim 1, wherein The coated concentration of the diluted recombinant 3AB-3C protein is 200-400 ng / well.

7. The detection kit for differentiating porcine Seneca virus infection or vaccine immunity according to claim 1, wherein The kit also includes an enzyme-labeled secondary antibody, PBST, PBS, and a porcine serum sample that is a positive control for virus infection and vaccine immunization with OD 450 nm being 1.

8. The detection kit for differentiating porcine Seneca virus infection or vaccine immunity according to claim 1, wherein When the kit is used to detect a sample, if only the antibody against VP2-VP3-VP1 is positive and the antibody against 3AB-3C is not detected, it indicates that the sample is vaccine immune serum; if the antibodies against both VP2-VP3-VP1 and 3AB-3C are positive, it indicates that the sample is virus-infected serum.

9. The detection kit for differentiating porcine Seneca virus infection or vaccine immunity according to claim 8, wherein When detecting the antibody against VP2-VP3-VP1, a cut-off value greater than 0.6045 is positive, and when detecting the antibody against 3AB-3C, a cut-off value greater than 0.248 is positive.

Citation Information

Patent Citations

  • Seneca virus type A genetic engineering composite epitope protein, vaccine and application of Senecavirus type A genetic engineering composite epitope protein and vaccine

    CN113527516A