Neural crest stem cell tracing system based on P75NTR-T2A-eGFP and application
By constructing the P75NTR-T2A-eGFP gene knock-in system in pluripotent stem cells, the stability and cost problems brought about by antibody markers are solved, efficient sorting and real-time monitoring of the differentiation process of neural crest stem cells are achieved, and the accuracy and economicality of the research are improved.
Patent Information
- Application Number
- CN202510533084.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-25
- Publication Date
- 2025-07-29
AI Technical Summary
The prior art has problems with the stability and repetition of antibody labels when sorting neural crest stem cells, and is expensive, affecting the research and application of cell biological functions.
By constructing the Crispr/Cas9 vector to target the stop codon region of the P75NTR gene expression box and inserting the T2A-eGFP gene, the P75NTR-T2A-eGFP gene knock-in is achieved in pluripotent stem cells by using electric shock transfection method to construct a neural crest stem cell tracer system.
It realizes efficient and stable cell sorting and real-time monitoring, avoids interference caused by antibody dependence, and improves the sorting purity and dynamic traceability of the differentiation process.
Smart Images

Figure CN120384102A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of genetic engineering, and particularly relates to a neural crest stem cell tracing system based on P75NTR-T2A-eGFP and its application. Background Art
[0002] In the field of biomedical research, neural crest stem cells (NCSCs) have attracted much attention. They are a group of pluripotent stem cells with unique biological characteristics during the embryonic development of vertebrates, originating from the neural crest structure at the stage of neural tube closure. This crucial transitional tissue endows NCSCs with extremely important trans-embryonic layer differentiation potential during the complex process of embryonic development. With this potential, NCSCs can migrate to multiple systems throughout the body in an orderly manner and successfully differentiate into various cells and tissues. In the peripheral nervous system, they can differentiate into sympathetic ganglia and Schwann cells; in the endocrine system, they can differentiate into chromaffin cells of the adrenal medulla; in addition, they can also differentiate into melanocytes and head and neck mesenchymal tissues, etc. It is precisely the multi-directional differentiation ability and migration characteristics of NCSCs that make them the core research object for deeply exploring the neural development mechanism, exploring new strategies for tissue regeneration and repair, and constructing accurate disease models, playing an irreplaceable role.
[0003] However, in the research journey of NCSCs, the problem of their source has become a major challenge for researchers. The traditional methods for obtaining NCSCs mainly rely on embryos or fetuses. Although this method can obtain neural crest stem cells with high biological activity, it has caused extremely difficult ethical controversies and has been widely questioned and examined at the social and ethical levels. In this context, in vitro induction and differentiation technology has emerged. In particular, the method of obtaining NCSCs by directed differentiation from embryonic stem cells or induced pluripotent stem cells has provided new ideas for solving the source dilemma to a certain extent and has broken through some bottlenecks to a certain extent. For example, the applicant has previously successfully established an in vitro induction and differentiation system for directed neural crest stem cells from human pluripotent stem cells (hPSCs). In this system, through the practice of sorting P75high neural crest stem cells by flow cytometry antibody labeling of P75NTR, it was found that the sorted cells showed typical biological characteristics of neural crest stem cells, not only having the ability to differentiate into neurons but also having the potential to differentiate into chondrocytes.
[0004] Despite the above-mentioned phased achievements in the research of NCSCs, there are still many drawbacks in the existing research methods that urgently need to be solved. Among them, flow cytometry, as a commonly used cell sorting method, although widely used in the field of cell sorting, exposes a series of problems that cannot be ignored when used for NCSCs sorting. This technology highly relies on antibody labeling, and there are often obvious batch differences in the quality and performance of antibodies from different batches, resulting in a significant reduction in the stability and repeatability of sorting results. At the same time, the antibody labeling process has certain damage to the cells themselves, which may interfere with the normal physiological functions of the cells and affect the subsequent research on cell biological characteristics. More importantly, the procurement cost of antibodies is high, which undoubtedly greatly increases the economic burden of research and limits the large-scale development of related research. In addition, with the increase in the number of sorting times and the extension of the culture time after sorting, the migration characteristics and neuron differentiation ability of neural crest stem cells sorted by flow cytometry gradually show a downward trend, which seriously affects the in-depth research and application exploration of the biological functions of NCSCs.
[0005] In view of this, based on a profound insight into the problems of the existing technology and an accurate grasp of the research needs, the applicant boldly put forward a hypothesis: by means of endogenous expression of fluorescent proteins, it is expected to achieve label-free, real-time and stable tracing of NCSCs. Once this innovative idea is successfully implemented, it will fundamentally solve many defects faced by traditional methods, provide new research perspectives and technical means for researchers, make it possible to observe neural crest stem cells derived from pluripotent stem cells in real-time and dynamically, and add new impetus to the research in the field of neural crest stem cells. Summary of the Invention
[0006] To overcome the above-mentioned deficiencies of the existing technology, the present invention constructs a Crispr / Cas9 vector (SgRNA: CTCCCCGGTTGGGCTCACAC) targeting the stop codon region of the P75NTR gene expression frame, and at the same time constructs a gene knock-in vector containing a left homologous arm (LHA)-T2A-eGFP-right homologous arm (RHA). By using the method of electroporating pluripotent stem cells (hPSCs), a P75NTR-T2A-eGFP gene knock-in pluripotent stem cell line is obtained for tracing the in vitro differentiation of pluripotent stem cells into neural crest stem cells.
[0007] To achieve the above object, the technical solution adopted by the present invention is:
[0008] The present invention provides a method for constructing a neural crest stem cell tracing system based on P75NTR-T2A-eGFP, comprising the following steps:
[0009] S1. Design a homologous recombination donor vector containing a P75NTR-T2A-eGFP expression frame:
[0010] S11: Using the DNA of the human pluripotent stem cell line hPSCs (H9ES) as a template, the termination codon region of the human P75NTR gene and the sequences of 1 kb upstream and downstream of TGA were amplified by PCR with left and right homologous arm primers to obtain the left and right homologous arm sequences;
[0011] S12: The left homologous arm, eGFP expression cassette, selection marker gene, right homologous arm and linearized pUC57 vector were subjected to homologous recombination. In this process, to ensure the correct expression of the eGFP protein, T2A linker was used for ligation. After recombination, monoclonal colonies were picked and verified by sequencing, and then a homologous recombination donor vector containing the P75NTR-T2A-eGFP expression cassette was constructed;
[0012] S2: CRISPR-Cas9-mediated gene editing:
[0013] Design an sgRNA targeting the termination codon region of the P75NTR gene. The sgRNA, Cas9 protein and the homologous recombination donor vector containing the P75NTR-T2A-eGFP expression cassette in step S1 were co-transfected into pluripotent stem cells (hPSCs). After positive clone identification, a P75NTR-T2A-eGFP gene knock-in pluripotent stem cell line was obtained;
[0014] S3: Neural crest stem cell differentiation and tracing:
[0015] Induce the P75NTR-T2A-eGFP gene knock-in pluripotent stem cell line to differentiate into neural crest stem cells, and the expression of P75NTR can be traced by detecting eGFP fluorescence.
[0016] Preferably, in S11, the left and right homologous arm amplification primers are shown as SEQ ID NO.1-2 and SEQ ID NO.3-4 respectively, and the obtained left and right homologous arm sequences are shown as SEQ ID NO.5 and SEQ ID NO.6 respectively.
[0017] Preferably, in S12, using the plasmid Addgene#200910 as a template, PCR amplification was carried out with eGFP expression cassette amplification primers to obtain the eGFP expression cassette; the eGFP expression cassette amplification primers are shown as SEQ ID NO.9 and SEQ ID NO.10 respectively.
[0018] Preferably, in S12, the screening marker gene used is the Puro screening marker; the method for obtaining it is: using plasmid Addgene#195505 as a template, performing PCR amplification with Puro screening marker amplification primers to obtain a puromycin resistance gene fragment as shown in SEQ ID NO.13; the Puro screening marker amplification primers are respectively as shown in SEQ ID NO.11 and SEQ ID NO.12.
[0019] Preferably, in S12, pUC57 vector is digested with EcoR I and HindⅢ to obtain a linearized pUC57 vector.
[0020] Preferably, in S12, homologous recombination is carried out by HieffClone recombinase according to the one-step method.
[0021] Preferably, in S2, the sgRNA targeting the stop codon region of the P75NTR gene is as shown in SEQ ID NO.14.
[0022] Preferably, in S2, the primers used for identifying positive clones are respectively as shown in SEQ ID NO.15 and SEQ ID NO.16.
[0023] The present invention also provides a neural crest stem cell tracing system based on P75NTR-T2A-eGFP prepared by the above construction method.
[0024] The present invention also provides the application of the above neural crest stem cell tracing system (NCSCs P75NTR-eGFP cells) in live cell imaging, and the live cell imaging is used for real-time monitoring of the differentiation process of neural crest stem cells.
[0025] In addition, in view of the fact that the constructed NCSCs P75NTR-eGFP cells have a higher differentiation efficiency into neurons and glial cells than the native NCSCs in the control group, they can also be used to repair the damaged nervous system. For example, in Parkinson's disease, dopaminergic neurons differentiated from these cells can be transplanted to supplement the missing nerve cells and improve nerve function; in the treatment of spinal cord injury, differentiated glial cells help to promote nerve regeneration, reduce glial scar formation, and create a favorable microenvironment for nerve repair.
[0026] Compared with the prior art, the beneficial effects of the present invention are:
[0027] The present invention focuses on the construction and application of a tracing system for the in vitro differentiation of pluripotent stem cells into neural crest stem cells. By constructing a Crispr / Cas9 vector, the stop codon region of the P75NTR gene expression cassette was precisely targeted. Meanwhile, a gene knock-in vector containing the left homologous arm (LHA)-T2A-eGFP-right homologous arm (RHA) was constructed. By means of electroporation transfection, these two vectors were introduced into pluripotent stem cells (hPSCs). Through this operation, a P75NTR-T2A-eGFP gene knock-in pluripotent stem cell line was successfully obtained, laying a solid foundation for the subsequent construction of the tracing system.
[0028] On the basis of not affecting the self-phenotype and neural differentiation ability of neural crest stem cells (NCSCs), the present invention successfully constructed a P75NTR-T2A-eGFP expression system by knocking in a fluorescent protein gene. This system has significant advantages. On the one hand, it enables the efficient sorting of P75NTR-positive neural crest stem cells derived from pluripotent stem cells in vitro by means of fluorescence-activated cell sorting (FACS) technology, greatly improving the sorting purity; on the other hand, it is suitable for live cell imaging and can monitor the differentiation process of neural crest stem cells in real time.
[0029] Specifically, the present invention has the following advantages:
[0030] (1) Precise knock-in positioning: The T2A-eGFP sequence was cleverly inserted after the expression cassette of the P75NTR gene to ensure the correct expression and function of the protein.
[0031] (2) Antibody-independent: The constructed P75NTR-T2A-eGFP labeling system belongs to an endogenous fluorescence signal, completely avoiding the common problem of exogenous antibody interference in flow cytometry monitoring, making the detection results more accurate and reliable.
[0032] (3) Dynamic tracing ability: The constructed P75NTR-T2A-eGFP labeling system has good dynamic tracing ability, is particularly suitable for live cell imaging, and can monitor the differentiation process of neural crest stem cells in real time.
[0033] (4) Efficient sorting: The constructed P75NTR-T2A-eGFP labeling system can directly sort P75NTR (CD271)-positive cells through the eGFP fluorescence intensity, improving the sorting purity. Description of the Drawings
[0034] Figure 1 It is a schematic design diagram of the P75NTR-T2A-eGFP vector system;
[0035] Figure 2 It is a bright-field image of hPSCs differentiating into NCSCs;
[0036] Figure 3For NCSCs P75NTR-eGFP mRNA overexpression detection;
[0037] Figure 4 For NCSCs P75NTR-eGFP Flow cytometry detection chart;
[0038] Figure 5 For NCSCs P75NTR-eGFP Expression detection of proliferation-related marker Ki67 compared with the control group;
[0039] Figure 6 For CCK-8 detection of NCSCs P75NTR-eGFP Proliferation status compared with the control group;
[0040] Figure 7 For NCSCs P75NTR-eGFP Immunofluorescence staining of neuronal differentiation of cells;
[0041] Figure 8 For NCSCs P75NTR-eGFP Immunofluorescence staining of glial cell differentiation of cells;
[0042] Figure 9 For NCSCs P75NTR-eGFP Chondrogenic differentiation of cells. Detailed implementation manners
[0043] The following further describes the detailed implementation manners of the present invention. It should be noted here that the description of these implementation manners is for helping to understand the present invention, but does not constitute a limitation to the present invention. In addition, the technical features involved in the various implementation manners of the present invention described below can be combined with each other as long as they do not conflict with each other.
[0044] The experimental methods in the following examples are all conventional methods unless otherwise specified, and the test materials used in the following examples are all commercially available through conventional channels unless otherwise specified.
[0045] Example 1: Construction of P75NTR-T2A-eGFP neural crest stem cell tracing system
[0046] 1. Recombinant vector construction
[0047] (1) Amplification of left and right homologous arm sequences: Using the DNA extracted from hPSCs (human embryonic stem cell line H9ES, sourced from the Cell Bank of the Chinese Academy of Sciences) as a template, with the left homologous arm (LHA) amplification primers, the sequences of 1 kb upstream and downstream of the stop codon TGA of the human P75NTR gene (Gene ID in NCBI is 4804) were amplified by PCR to obtain the left homologous arm (LHA). Similarly, using this DNA as a template and the right homologous arm amplification primers, the right homologous arm (RHA) was amplified by PCR.
[0048] Among them, the left homologous arm amplification primers are: F: GACGGCCAGTGAATTAGCCTGCATGACCAGCAGCC (SEQ ID NO.1); R: cagacttcctctgccctcCACCGGGGATGTGGCAGTG (SEQ ID NO.2);
[0049] The right homologous arm amplification primers are: F: atacattatacgaagttatGCCCAACCGGGGAGCCCCC (SEQ ID NO.3); R: TGATTACGCCAAGCTTAGGCTGATTCTAGGGGCCA (SEQ ID NO.4).
[0050] The amplified LHA sequence (SEQ ID NO.5) is shown as follows:
[0051] AGCCTGCATGACCAGCAGCCCCACACGCAGACAGCCTCGGGCCAGGGTGAGCAGCGGCCCGCTGGGGAGCTGAGGCGGAGCTGAGGCTGAGGAAACAGAAGCAATTAAGATTAGACTCCAGGAAGGACTGTCGGGGGGGCGGCAGGGCTGGCTCAGCGGTGCCCCTGTAGATGGATGGAGAGGCTGGCCGAGGGGAATGGGAGGGAGAGGTCCTCTCTAGAGGAACGACTTGGGAAATGGAGGCTTTTACAAGTTGGAGCATCCAGACTCATCAAGCTAATTGTCCCCCCTGGGGGCTAATTATTGCCCAAAGTAGCTGCAATTAGCCTCTTGCCCTGGACTTCTGGGGAACAAGTAGTTAAGTGTGTACCCTAATTAGTGGCCCATAGCCCAGCTCCGGGACACTTGCTGTAGTTGTCTAGAACTGAGAAGCCCTATCTCCTCCTCTGCCATGATTAATTGCTGGGGGGGAAGAGAGGAGGGATGGGGATAGGGATTGGGCTGGAGTGACAGGAGGAAGGGACAACGAGTCCCCCCAGGTGCCTTCACTTCCTGGTGCCCCACCCAGGACCTTGTCTTGGCCCCAGGCCTCCAGATGGGGAGGAGCACTGCCTCGGCCCTTCTTGGGTCTCACCCCAGTGCCCACTGTTGGGGAAAGGAGTTCAGGGGTAGGACCTGACTCTCCTCTGGTTTCTCTGCAGCCCTCAAGGGTGACGGAGGCCTCTACAGCAGCCTGCCCCCAGCCAAGCGGGAGGAGGTGGAGAAGCTTCTCAACGGCTCTGCGGGGGACACCTGGCGGCACCTGGCGGGCGAGCTGGGCTACCAGCCCGAGCACATAGACTCCTTTACCCATGAGGCCTGCCCCGTTCGCGCCCTGCTTGCAAGCTGGGCCACCCAGGACAGCGCCACACTGGACGCCCTCCTGGCCGCCCTGCGCCGCATCCAGCGAGCCGACCTCGTGGAGAGTCTGTGCAGTGAGTCCACTGCCACATCCCCGGTG。
[0052] The amplified RHA sequence (SEQ ID NO.6) is shown as follows:
[0053] GCCCAACCGGGGAGCCCCCGCCCCGCCCCACATTCCGACAACCGATGCTCCAGCCAACCCCTGTGGAGCCCGCACCCCCACCCTTTGGGGGGGGCCCGCCTGGCAGAACTGAGCTCCTCTGGGCAGGACCTCAGAGTCCAGGCCCCAAAACCACAGCCCTGTCAGTGCAGCCCGTGTGGCCCCTTCACTTCTGACCACACTTCCTGTCCAGAGAGAGAAGTGCCCCTGCTGCCTCCCCAACCCTGCCCCTGCCCCGTCACCATCTCAGGCCACCTGCCCCCTTCTCCCACACTGCTAGGTGGGCCAGCCCCTCCCACCACAGCAGGTGTCATATATGGGGGGCCAACACCAGGGATGGTACTAGGGGGAAGTGACAAGGCCCCAGAGACTCAGAGGGAGGAATCGAGGAACCAGAGCCATGGACTCTACACTGTGAACTTGGGGAACAAGGGTGGCATCCCAGTGGCCTCAACCCTCCCTCAGCCCCTCTTGCCCCCCACCCCAGCCTAAGATGAAGAGGATCGGAGGCTTGTCAGAGCTGGGAGGGGTTTTCGAAGCTCAGCCCACCCCCCTCATTTTGGATATAGGTCAGTGAGGCCCAGGGAGAGGCCATGATTCGCCCAAAGCCAGACAGCAACGGGGAGGCCAAGTGCAGGCTGGCACCGCCTTCTCTAAATGAGGGGCCTCAGGTTTGCCTGAGGGCGAGGGGAGGGTGGCAGGTGACCTTCTGGGAAATGGCTTGAAGCCAAGTCAGCTTTGCCTTCCACGCTGTCTCCAGACCCCCACCCCTTCCCCACTGCCTGCCCACCCGTGGAGATGGGATGCTTGCCTAGGGCCTGGTCCATGATGGAGTCAGGTTTGGGGTTCGTGGAAAGGGTGCTGCTTCCCTCTGCCTGTCCCTCTCAGGCATGCCTGTGTGACATCAGTGGCATGGCTCCAGTCTGCTGCCCTCCATCCCGACATGGACCCGGAGCTAACACTGGCCCCTAGAATCAGCCTA。
[0054] (2) Amplification of eGFP expression cassette: Using the plasmid (Addgene #200910) as a template, PCR amplification was performed with primers for amplifying the eGFP expression cassette. When designing the primers, sequences homologous to the region downstream of the stop codon of the P75NTR gene were introduced at both ends of the amplification product, so that subsequently through homologous recombination, the eGFP cDNA could be inserted downstream of the stop codon of the P75NTR gene, while removing the original stop codon.The T2A linker (base sequence (SEQ ID NO.7): gagggcagaggaagtct gctaacatgcggtgacgtcgaggagaatcctggccca) is linked to eGFP (base sequence (SEQ ID NO.8): gtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaaggagttctaa) to ensure the correct expression of the eGFP protein. Among them, the amplification primers for the eGFP expression cassette are: F: GCCACATCCCCGGTGgagggcagaggaagtc (SEQ ID NO.9); R: gctatacgaagttatttagaactccttgtacagctc (SEQ ID NO.10).
[0055] (3) Puro Selection Marker Amplification: Using the plasmid (Addgene #195505) as a template, PCR amplification was performed with Puro selection marker amplification primers to obtain the puromycin resistance gene fragment (Loxp-PGK-Puro-Loxp). Among them, the Puro selection marker amplification primers were: F: ataacttcgtatagcatacatta (SEQ ID NO.11); R: ataacttcgtataatgtatg (SEQ ID NO.12).
[0056] The amplified LoxP-PGK-puro-Loxp sequence (shown in SEQ ID NO.13, the underlined straight line indicates the Loxp sequence, and the underlined wavy line indicates the Puro selection marker sequence) is as follows:
[0057]
[0058] (4) The pUC57 vector was double-digested with EcoR I and HindⅢ, and the digested product was recovered by gel to obtain the linearized pUC57 vector;
[0059] (5) Through the HieffClone recombinase, in the order of the left homologous arm, eGFP expression cassette, Puro selection marker, and right homologous arm, these amplified gene fragments were recombinantly ligated with the linearized pUC57 vector in one step, and these fragments were constructed onto the pUC57 vector (between the restriction enzyme sites EcoR1 and HindⅢ). Then the ligation product was transformed into DH5α competent cells, and the transformed cells were spread on an LB plate containing antibiotics and cultured at 37°C until single colonies formed.
[0060] (6) Single colonies were picked for sequencing to verify whether the left homologous arm, eGFP expression cassette, Puro selection marker, and right homologous arm were correctly inserted into the pUC57 vector, thereby successfully constructing the recombinant vector pUC57-LHA-P75NTR-T2A-eGFP-Loxp-PGK-Puro-Loxp-RHA.
[0061] 2. CRISPR-Cas9 Mediated Gene Editing
[0062] (1) Mix Cas9 protein (10 μg), sgRNA (5 μg), and the donor recombinant vector from step 1 (20 μg) to construct a transfection system. Using electroporation with the set parameters (1100 V, 20 ms, 3 pulses), co-transfect the above transfection system into hPSCs with a cell density of 80%. Among them, the sgRNA is the sgRNA targeting the TGA region of the P75NTR gene, and the sequence is CTCCCCGGTTGGGCTCACAC (SEQ ID NO.14).
[0063] (2) After transfection, screen the cells with puromycin at a concentration of 2 μg / mL for 72 hours to enrich the cells that have integrated the recombinant vector and express puromycin resistance. Then transfect the cells after puromycin screening with Cre protein, and use the Cre-Loxp system to delete the Loxp-PGK-Puro-Loxp sequence in the vector to remove the puromycin resistance gene.
[0064] (( (3) Dilute the cells by the limited dilution method and seed them in 96-well plates to obtain monoclonal cells. Then identify them by PCR, and perform PCR amplification using the forward primer 5’-gctgggctaccagcccgagca-3’ (SEQ ID NO.15) and the reverse primer 5’-ttcagggtcagcttgccgtagg-3’ (SEQ ID NO.16). Sequence the PCR amplification products to verify the knock-in efficiency of the P75NTR gene and determine the positive clones that have been successfully edited.
[0065] As Figure 1 shown, the construction of the P75NTR-T2A-eGFP tracing system is finally achieved in the hPSCs cell line.
[0066] 3. Neural crest stem cell differentiation and tracing
[0067] (1) Inductive differentiation: Add 1% N2 additive, 1 μM Chir99021 and 0.5 μM SB431542 small molecule compounds to the DMEM / F-12 basal medium. The former activates the WNT pathway, and the latter inhibits the BMP pathway to simulate the signals affecting neural crest development in vivo and promote the differentiation of pluripotent stem cells into neural crest as monolayer cells. Seed the hPSCs obtained in step 2 at 1.0×10 5 cells / cm 2For density seeding, induction was carried out for 7 days. Under a light microscope, it was observed that after cell seeding, the cells first aggregated and grew in a clone-like manner, and then single, scattered cells appeared at the edge of the clone and continued to proliferate. These cells presented neural crest stem cell-like characteristics of multipolarity and having filamentous / plate-like pseudopodia. Further, hPSCs were cultured in a neural crest induction medium containing 10 μM ROCK inhibitor, 100 ng / mL BMP4, and 50 ng / mL EGF for 14 days. During this period, cell changes were observed by morphology, and at the same time, their proliferation ability differences were detected, and the expressions of P75NTR and eGFP were detected by flow cytometry. See the specific steps (2)-(4) shown later.
[0068] (2) Cell imaging: The cells were monitored using a confocal microscope (excitation wavelength 488 nm) to observe cell migration and changes in fluorescence intensity. As Figure 2 shown, after hPSCs differentiated into NCSCs, the cells were spindle-shaped and had enhanced migration ability.
[0069] (3) Molecular biology verification:
[0070] 1) mRNA expression analysis: qPCR was used to detect the mRNA levels of P75NTR and eGFP. The primers used were as follows:
[0071] P75NTR-qPCR-F: 5’-gaacaagacctcatagccag-3’ (SEQ ID NO.17), P75NTR-qPCR-R: 5’-gtcgctgtggagtttttctccct-3’ (SEQ ID NO.18);
[0072] eGFP-qPCR-F: 5’-cggcaagctgcccgtgccct-3’ (SEQ ID NO.19), eGFP-qPCR-R: 5’-ccttcagctcgatgcggtt-3’ (SEQ ID NO.20).
[0073] As Figure 3 shown, the qPCR detection results showed that compared with the control group, NCSCs P75NTR-eGFP highly expressed eGFP mRNA.
[0074] 2) Protein expression verification: The expression of P75NTR-T2A-eGF protein was detected by flow cytometry. As Figure 4 shown, the flow cytometry detection results of NCSCs P75NTR-eGFP showed that the P75NTR antibody and eGFP could be co-labeled, indicating that NCSCs P75NTR-eGFP were successfully obtained.
[0075] (4) Proliferation function verification: The proliferation ability differences between NCSCs and the control group were detected by Ki67 antibody immunofluorescence staining and CCK-8 assay. P75NTR-eGFP As Figure 5 shown, compared with the control group, the expression of the proliferation-related marker Ki67 in NCSCs was significantly increased; P75NTR-eGFP The CCK-8 assay Figure 6 showed that NCSCs P75NTR-eGFP had stronger proliferation ability than the control group.
[0076] Example 2: In vitro neural differentiation ability of P75NTR-T2A-eGFP neural crest stem cells
[0077] (1) Differentiation potential test: To evaluate the neural differentiation ability of the cells, induction differentiation experiments of eGFP-positive cells into neurons (using β-III tubulin staining, i.e., TUBB3 staining) and glial cells (using GFAP staining) were carried out.
[0078] The specific operations were as follows:
[0079] After flow cytometry sorting, the control group NCSCs and NCSCs P75NTR-eGFP group were cultured in NCCM medium for 3-5 days. When the cell density exceeded 60%, the medium was replaced with neuron induction medium, and the formula was: DMEM / F-12 medium as the basic solution, adding 1% N2 additive, 10 ng / mL BDNF, 10 ng / mL GDNF and 10 ng / mL NGF neurotrophic factors. After continuous culture for 3-4 weeks, the cells were fixed with 4% paraformaldehyde fixative for 30 minutes. After fixation, the cells were soaked in 1×TBS and temporarily stored in a 4°C refrigerator for subsequent immunofluorescence detection.
[0080] (2) Result observation: During the process of inducing cells to differentiate into neurons, it was found by microscopic observation that the cell morphology changed significantly, showing typical neuron-like characteristics with multipolarity and accompanied by slender protrusions. To further clarify the differentiation situation, immunofluorescence staining technology was used to detect the expression of the neuron surface marker TUBB3 and the glial cell marker GFAP.
[0081] From Figure 7 the immunofluorescence staining results, it could be seen that: the immunofluorescence staining results showed that the neuron differentiation efficiency of NCSCs P75NTR-eGFP cells was higher than that of the control group; Figure 8 the immunofluorescence staining results P75NTR-eGFP showed that the glial cell differentiation efficiency of NCSCs
[0082] Example 3: In vitro chondrogenic induction culture of P75NTR-T2A-eGFP neural crest stem cells
[0083] (1) Medium preparation: Prepare MesenCult-ACF Chondrogenic Differentiation Kit (purchased from STEMCELL Technologies, #05455).
[0084] (2) Induction and staining steps: Digest the cells (NCSCs P75NTR -eGFP ) that have adhered and grown to 90% confluence in a T25 culture flask, then transfer them to a centrifuge tube for centrifugation to precipitate the cells. Resuspend the cells with complete chondrogenic medium and count them. Pipette 3.0×10 5 cells into a new centrifuge tube, supplement the complete chondrogenic culture medium to 1 mL, and centrifuge at 250×g for 5 min. Then loosen the cap of the centrifuge tube and place it in an incubator at 37°C and 5% CO2 for culture. During this period, replace 1 / 2 of the culture medium with fresh medium every 3 days and continuously induce for 3 - 4 weeks until chondrospheres are formed. Then take out the induced chondrospheres, wash them twice with 1×PBS, fix them in 4% PFA for 12 hours, and then perform routine paraffin embedding and sectioning. Next, dewax and hydrate the sections with xylene and ethanol of different concentrations to enable the sections to better bind to the staining solution. Drop toluidine blue staining solution on the dewaxed glass slides, let it stand for 30 minutes for staining. After staining, wash off the excess staining solution with distilled water, differentiate with acetone until the cells turn blue-violet, then wash off the excess acetone with distilled water and air dry. After dehydration with absolute ethanol, replace the dehydrating agent with xylene as a clearing agent, and finally mount the slides and observe the staining results under a microscope.
[0085] (3) Test results: It can be seen from Figure 9 that NCSCs P75NTR-eGFP cells have significant chondrogenic differentiation ability.
[0086] In summary, with the help of precise gene editing technology, the present invention successfully constructs a P75NTR-T2A-eGFP labeling system. Using this system, an efficient and stable fluorescence labeling effect is achieved in neural crest stem cells derived from hPSCs. Verified by experiments, compared with traditional technologies, this method has higher flow sorting efficiency, stronger tracing sensitivity, and more convenient operation. Moreover, the cells sorted by this method have higher proliferation activity and neuronal differentiation ability than the traditional flow antibody-dependent sorting technology, creating a more efficient and powerful tool for neural crest stem cell research and regenerative medicine applications.
[0087] The above has described the embodiments of the present invention in detail, but the present invention is not limited to the described embodiments. For those skilled in the art, without departing from the principle and spirit of the present invention, various changes, modifications, substitutions, and variations made to these embodiments still fall within the protection scope of the present invention.
Claims
1. A method for constructing a neural crest stem cell tracing system based on P75NTR-T2A-eGFP, characterized in that, It includes the following steps: S1. Design a homologous recombination donor vector containing the P75NTR-T2A-eGFP expression cassette: S11. Using the DNA of human pluripotent stem cell line hPSCs as a template, amplify the sequence of the stop codon region of the human P75NTR gene and 1 kb of the sequence upstream and downstream of TGA on both sides by PCR with left and right homologous arm primers to obtain the left and right homologous arm sequences; S12. Recombine the left homologous arm, eGFP expression cassette, selection marker gene, right homologous arm with the linearized pUC57 vector. In this process, to ensure the correct expression of eGFP protein, T2A linker is used for ligation. After recombination, pick monoclonal colonies for sequencing verification and then construct a homologous recombination donor vector containing the P75NTR-T2A-eGFP expression cassette; S2. CRISPR-Cas9-mediated gene editing: Design an sgRNA targeting the stop codon region of the P75NTR gene, co-transfect the sgRNA, Cas9 protein and the homologous recombination donor vector containing the P75NTR-T2A-eGFP expression cassette in step S1 into pluripotent stem cells (hPSCs). After positive clone identification, obtain a P75NTR-T2A-eGFP gene knock-in pluripotent stem cell line; S3. Neural crest stem cell differentiation and tracing: Induce the P75NTR-T2A-eGFP gene knock-in pluripotent stem cell line to differentiate into neural crest stem cells, and then the expression of P75NTR can be traced by detecting eGFP fluorescence.
2. The construction method of a neural crest stem cell tracing system based on P75NTR-T2A-eGFP according to claim 1, characterized in that, In S11, the left and right homologous arm amplification primers are shown as SEQ ID NO.1-2 and SEQ ID NO.3-4 respectively, and the obtained left and right homologous arm sequences are shown as SEQ ID NO.5 and SEQ ID NO.6 respectively.
3. The construction method of a neural crest stem cell tracing system based on P75NTR-T2A-eGFP according to claim 1, characterized in that, In S12, using plasmid Addgene#200910 as a template, perform PCR amplification with eGFP expression cassette amplification primers to obtain the eGFP expression cassette; the eGFP expression cassette amplification primers are shown as SEQ ID NO.9 and SEQ ID NO.10 respectively.
4. The construction method of a neural crest stem cell tracing system based on P75NTR-T2A-eGFP according to claim 1, characterized in that, In S12, the used selection marker gene is the Puro selection marker; the acquisition method is: using plasmid Addgene#195505 as a template, perform PCR amplification with Puro selection marker amplification primers to obtain a puromycin resistance gene fragment shown as SEQ ID NO.13; The Puro selection marker amplification primers are shown as SEQ ID NO.11 and SEQ ID NO.12 respectively.
5. The construction method of a neural crest stem cell tracing system based on P75NTR-T2A-eGFP according to claim 1, characterized in that, In S12, perform double digestion of the pUC57 vector with EcoR I and HindⅢ to obtain a linearized pUC57 vector.
6. The construction method of a neural crest stem cell tracing system based on P75NTR-T2A-eGFP according to claim 1, characterized in that, In S12, perform homologous recombination by the HieffClone recombinase according to the one-step method.
7. The construction method of a neural crest stem cell tracing system based on P75NTR-T2A-eGFP according to claim 1, wherein In S2, the sgRNA targeting the stop codon region of the P75NTR gene is shown as SEQ ID NO.
14.
8. The construction method of a neural crest stem cell tracing system based on P75NTR-T2A-eGFP according to claim 1, characterized in that In S2, the primers used for positive clone identification are shown as SEQ ID NO.15 and SEQ ID NO.16 respectively.
9. A neural crest stem cell tracing system based on P75NTR-T2A-eGFP prepared by using the construction method according to any one of claims 1-8.
10. Use of the neural crest stem cell tracing system based on P75NTR-T2A-eGFP in live cell imaging according to claim 9, characterized in that, The live cell imaging is used for real-time monitoring of the differentiation process of neural crest stem cells.