Design and application of Escherichia coli shikimic acid kinase AroL and AroK protein Binder

Abstract

The invention discloses design and application of proteins Binder of shikimic acid kinase AroL and AroK of escherichia coli, and belongs to the technical field of bioengineering. The invention designs and screens a protein Binder for targeted inhibition of activity of shikimic acid kinase AroK and AroL of escherichia coli. When the antiAroL or antiAroK screened by the invention is expressed in escherichia coli, the enzyme activity of the AroL can be reduced by 89.5%, and the enzyme activity of the AroK can be reduced by 81.7%. According to the invention, antiAroL and antiAroK are expressed in shikimic acid production strains, so that the strains do not need to add aromatic amino acids in a fermentation culture medium, and the shikimic acid yield at a fermentation tank level reaches 120.6 g / L.

Description

Technical Field

[0001] The present invention relates to the design and application of protein binders for Escherichia coli shikimate kinases AroL and AroK, and belongs to the field of bioengineering technology. Background Art

[0002] Shikimic acid, with the chemical formula C7H 10 O5, chemically named (3R,4S,5R)-(-)-3,4,5-trihydroxy-1-cyclohexene-1-carboxylic acid, contains a six-carbon cyclic alcohol, three chiral carbons and a carboxylic acid functional group. The solubility of shikimic acid is 180 g / L, and it is poorly soluble in chloroform, benzene and petroleum ether. The melting point is 185 °C to 191 °C, and there is a strong absorption peak near 210 nm. The specific rotation is -180°. Shikimic acid is an important intermediate in the pharmaceutical and chemical industries. In the pharmaceutical field, it is the precursor for the chemical synthesis of the anti-influenza drug - Tamiflu.

[0003] Biomanufacturing is one of the important methods for shikimic acid synthesis. Compared with chemical synthesis and plant extraction, it has the advantages of environmental friendliness, being not restricted by regions and climates, and low production costs. Escherichia coli is an important host bacterium for biosynthesizing shikimic acid. Using glucose as a substrate, phosphoenolpyruvate (PEP) produced via the glycolysis pathway and erythrose-4-phosphate (E4P) produced via the pentose phosphate pathway condense to form the aromatic common precursor 3-deoxy-D-arabinoheptulosonate-7-phosphate (DAHP). Subsequently, it successively passes through 3-dehydroquinate synthase AroB, 3-dehydroquinate dehydratase AroD, and shikimate dehydrogenase AroE, and finally synthesizes shikimic acid. Shikimic acid is further converted to the downstream pathway by shikimate kinase I AroK and shikimate kinase II AroL to synthesize three aromatic essential amino acids (tyrosine, tryptophan, phenylalanine). In order to accumulate shikimic acid, the most commonly used method is to knockout AroK and AroL genes to block the degradation of shikimic acid. However, this requires adding a large amount of aromatic amino acids, increasing the production cost and limiting their industrial development.

[0004] Compared with gene knockout, directly targeting and inhibiting the activities of AroK and AroL enzymes is a rapid and controllable method. In recent years, AI protein design technology has developed rapidly, and various protein design methods have been developed based on the Rosetta and AlphaFold software. Among them, de novo designed protein Binder has made great breakthroughs and progress. For example, Cao et al. designed high-affinity Binders that can target and bind multiple human pathogenic proteins based only on the protein structure of the target protein using the Rosetta software. Pacesa et al. developed a simpler and more operable protein Binder design method, BindCraft, based on AlphaFold2. These technologies provide powerful tools for de novo designing protein inhibitors and their popularization in medicine and biomanufacturing. They also provide the possibility for de novo designing targeted Binders for AroK and AroL. Summary of the Invention

[0005] To solve the above technical problems, the present invention provides protein Binders, antiAroK and antiAroL, that can target and inhibit the activities of Escherichia coli shikimate kinases AroK and AroL; and co-express these two Binders with shikimate kinases AroK and AroL

[0006] The first object of the present invention is to develop protein Binders that can target and inhibit the activities of Escherichia coli shikimate kinases AroK and AroL.

[0007] In one embodiment, the amino acid sequence of the Binder antiAroL that targets and inhibits Escherichia coli shikimate kinase AroL is shown in SEQ ID NO.1.

[0008] In one embodiment, the amino acid sequence of the Binder antiAroK that targets and inhibits Escherichia coli shikimate kinase AroK is shown in SEQ ID NO.2.

[0009] The second object of the present invention is to provide genes encoding the active protein Binders.

[0010] In one embodiment, the nucleotide sequence of the Binder antiAroL is shown in SEQ ID NO.4.

[0011] In one embodiment, the nucleotide sequence of the Binder antiAroK is shown in SEQ ID NO.7.

[0012] The third object of the present invention is to provide an expression vector containing the encoding gene of the Binder.

[0013] In one embodiment, the expression vector is based on plasmid pEtrcQ; the nucleotide sequence of plasmid pEtrcQ is shown as SEQ ID NO.3.

[0014] In one embodiment, the resistance screening marker of the expression vector is AmpR, the replicon is pBR322, and the promoter is P trc , and the RBS is RBS0034.

[0015] The fourth object of the present invention is to provide a recombinant bacterium co-expressing the protein Binder and shikimate kinase.

[0016] In one embodiment, the recombinant bacterium uses Escherichia coli as the host.

[0017] In one embodiment, the recombinant bacterium uses Escherichia coli E.coli SA09 as the host, and the aroK and aroL genes are integratively expressed at the poxB locus on the genome of strain SA09; Escherichia coli E.coli SA09 has been disclosed in the paper "Systems engineering of Escherichia coli for high-level shikimate production".

[0018] The fifth object of the present invention is to provide a method for fermentatively producing shikimic acid, which uses the recombinant bacterium for fermentation, and the active protein Binder is induced to express by IPTG during the fermentation process.

[0019] In one embodiment, the application uses glucose as the reaction substrate, and the recombinant bacterium performs aerobic fermentation throughout to produce shikimic acid.

[0020] In one embodiment, during the application in the fermentation process, the pH is controlled at 7.0, the fermentation temperature is 32 - 34 °C, and the residual sugar is controlled at 5 - 10 g / L.

[0021] In one embodiment, during the fermentation process, it is induced with IPTG at a concentration of 0.5 - 1 mM, and the induction time is 15 - 17 h.

[0022] In one embodiment, the culture medium for fermentation contains: glucose 18 - 22 g / L, yeast powder 10 g / L, peptone 3 g / L, ferric ammonium citrate 1 g / L, dipotassium hydrogen phosphate 4 - 6 g / L, magnesium sulfate heptahydrate 1 g / L, metal ion solution 1 mL / L.

[0023] In one embodiment, the metal ion solution contains: (NH4)6Mo7O 24· 0.0037 g / L of 4H2O, 0.0029 g / L of ZnSO4·7H2O, 0.0247 g / L of H3BO3, 0.0025 g / L of CuSO4·5H2O, 0.0158 g / L of MnCl2·4H2O.

[0024] The present invention also provides the use of the recombinant bacterium or the method in the preparation of a product containing shikimic acid.

[0025] Beneficial effects:

[0026] The present invention designs a protein Binder that targets and inhibits the activities of Escherichia coli shikimate kinases AroK and AroL, for directly targeting and inhibiting the enzyme activities of AroL and AroK. The antiAroL of the present invention reduces the AroL enzyme activity by 89.5% in vivo, and the antiAroK reduces the AroK enzyme activity by 81.7% in vivo, enabling the fermentation medium to not require the addition of aromatic amino acids.

[0027] The present invention further realizes the rapid accumulation of shikimic acid by optimizing the induction conditions. Under the optimized fermentation conditions, the strain constructed by the present invention has high production intensity and high production stability in the preparation of shikimic acid, and reduces the use of three aromatic amino acids. The recombinant bacterium E. coli SA11 constructed has a shikimic acid production yield of 120.6 g / L at the fermentor level, greatly saving the industrial production cost. Description of the drawings

[0028] Figure 1 It is a binding diagram of de novo designed antiAroK and AroK.

[0029] Figure 2 It is a binding diagram of de novo designed antiAroL and AroL.

[0030] Figure 3 It is a structural diagram of plasmid pEtrcQ.

[0031] Figure 4 It is a diagram of the change of fermentation process parameters of recombinant Escherichia coli E. coli SA11. Detailed implementation manners

[0032] The following further illustrates the present invention with specific embodiments, so that those skilled in the art can better understand the present invention and be able to implement it, but the exemplified embodiments do not limit the present invention.

[0033] Materials and methods involved:

[0034] (1) Culture medium:

[0035] Solid medium: peptone 10 g / L, yeast powder 5 g / L, sodium chloride 10 g / L, agar powder 20 g / L.

[0036] Fermentation medium: glucose 18 - 22 g / L, yeast powder 10 g / L, peptone 3 g / L, ammonium ferric citrate 1 g / L, dipotassium hydrogen phosphate 4 - 6 g / L, magnesium sulfate heptahydrate 1 g / L, metal ion solution 1 mL / L.

[0037] Metal ion solution: (NH4)6Mo7O 24 ·4H2O 0.0037 g / L, ZnSO4·7H2O 0.0029 g / L, H3BO3 0.0247 g / L, CuSO4·5H2O 0.0025 g / L, MnCl2·4H2O 0.0158 g / L.

[0038] (2) Determination of glucose:

[0039] Pretreatment of fermentation broth: Take 12000 rpm centrifugation of the fermentation broth for 5 min and take the supernatant. Dilute to an appropriate multiple, and use an M - 100 biosensor analyzer to detect the glucose concentration in the fermentation broth.

[0040] (3) Determination of shikimic acid:

[0041] High - performance liquid chromatography method: Prepare a 1 g / L concentration shikimic acid solution, and dilute it to 0.1, 0.2, 0.4, 0.6, and 0.8 g / L respectively. At the same time, prepare a 0.1 g / L concentration 3 - dehydroshikimic acid solution and dilute it to 0.01, 0.02, 0.04, 0.06, and 0.08 g / L. Use a high - performance liquid chromatograph (HPLC) for detection to obtain the peak time and the peak areas corresponding to different concentrations of shikimic acid and 3 - dehydroshikimic acid. Take the concentrations of shikimic acid and 3 - dehydroshikimic acid solutions as the abscissa and the peak area as the ordinate to draw a standard curve and obtain a linear regression equation. The regression coefficient of the linear regression equation should be above 0.990 to be usable. The instrument is an Agilent high - performance liquid chromatograph, the chromatographic column uses an Aminex HPX - 87H column; the mobile phase is 5 mM dilute sulfuric acid; the flow rate is set at 0.6 mL / min; the detector is an ultraviolet detector, the detection wavelength is 210 nm, and the column temperature is 55 °C.

[0042] Pretreatment of fermentation broth: Take 12000 rpm centrifugation of the fermentation broth for 10 min and take the supernatant. After diluting to an appropriate multiple, filter the sample through a membrane, use HPLC for detection, substitute the obtained peak area into the linear regression equation, and the result multiplied by the dilution multiple is the shikimic acid concentration in the fermentation broth.

[0043] Production intensity: Production intensity = highest yield of shikimic acid (g / L) / fermentation duration (h)

[0044] Yield: Yield = Total amount of shikimic acid in the fermenter (g) / Total amount of sugar supplemented (g)

[0045] Example 1: De novo design of antiAroL and antiAroK libraries based on Rosetta

[0046] The computational design of binders is divided into three steps: (i) Select the binding interface: Select a suitable binding interface for the guide protein on the surface of the target protein; (ii) Calculate the guide protein library: The specific process includes: First, use RifGene to calculate the interacting residue library, then perform protein backbone docking through Patchdock, then use Rifdock to adjust the conformation of the bound protein backbone, and finally maximize the interaction ability through Interface Design to obtain the guide protein library; (iii) Scoring and screening: According to indicators such as Rosetta binding energy, shape complementarity, interface buried solvent accessible surface area, and contact molecular surface, screen out the best candidate guide proteins. In addition, only hydrophobic amino acids (Ala, Val, Thr, Ile, Pro, Leu, Met, Phe, Tyr, Trp) are selected at the binding interface to improve the design success rate.

[0047] First, the three-dimensional protein structures of AroL and AroK were predicted by Alphafold2, showing high confidence. Subsequently, the surfaces enriched with hydrophobic amino acids on the surfaces of AroK and AroL proteins were selected as the binding interfaces, and the surface hydrophobic amino acids in the binding interfaces were selected as hot spot residues (Table 1). A candidate library containing 60,000 members was constructed using RifGene, Rifdock, and two rounds of interface design. Subsequently, based on 6 recommended parameters (ddG, contact_molecular_surface, score_per_res, mismatch_probability, sap_score, binder_delta_sap), the candidate library was preliminarily filtered and screened to obtain a first-round candidate library. Subsequently, in order to quickly obtain effective binders, the first-round candidate library was ranked based on 4 key indicators (ddG, contact_patch, target_delta_sap, contact_molec_sq5_apap_target), and the top 10 binders were selected as candidate binders for the next screening.

[0048] Table 1 Hot spot residues selected on the surfaces of AroK and AroL

[0049]

[0050]

[0051] Example 2: Construction of recombinant Escherichia coli expressing shikimate kinase

[0052] Select the high-yield shikimate Escherichia coli E. coli SA09 strain (published in the paper "Systems engineering of Escherichia coli for high-level shikimate production") constructed by the inventors in the early stage as the chassis, and integrate the aroK and aroL genes into the poxB locus on the genome. The nucleotide sequences of aroK and aroL are shown in SEQ ID NO.9 and SEQ ID NO.10. The strain with correct verification was named E. coli SA10.

[0053] Example 3: Screening of target Binder

[0054] In order to effectively obtain a Binder that can target and inhibit AroL and AroK, based on the PopZ co-localization experiment and in vivo enzyme activity test, an effective Binder was screened from 10 candidate proteins. The process of the PopZ co-localization experiment is as follows: AroL or AroK is fused with PopZ to obtain the complex AroL-PopZ or AroK-PopZ, and this complex will automatically aggregate at both ends of the cell according to the characteristics of PopZ. The candidate Binder is fused with eGFP to obtain the complex Binder-eGFP, which is used to test whether the Binder can interact with AroL or AroK. If the Binder binds to AroL or AroK, green fluorescence will also appear at the cell ends; if the Binder does not bind to AroL or AroK, the green fluorescence will be evenly distributed in the cytoplasm. Based on this design, Binders (04356, 10934, 09452) that can target and bind to AroL and Binders (15247, 08542) that can target and bind to AroK were successfully screened. Subsequently, the nucleic acid sequences of the above Binders were codon-optimized (the nucleotide sequences shown in SEQ ID NO.4 to SEQ ID NO.8 were obtained respectively) to be suitable for expression in Escherichia coli. The optimized Binder gene sequences were integrated after the RBS0034 sequence of the pEtrcQ plasmid, and their expression was inhibited by the repressor protein LacI, and IPTG needed to be added to induce their expression. The plasmids carrying the Binder-encoding genes were respectively introduced into the recombinant bacterium E. coli SA10 constructed in Example 2, and the obtained strains were cultured in LB medium. When the growth reached OD 600 was 0.6, 0.1 mM IPTG was added, and the culture was continued at 37 °C for 12 h to induce the expression of different Binders, and at the same time, the enzyme activities of intracellular AroK and AroL were detected.

[0055] The method for detecting enzyme activity is as follows: After induction for 12 h, the bacterial liquid was collected and centrifuged at 12,000 rpm for 10 min, and then washed with pre-cooled PBS. The cell pellet was resuspended in 0.05 M barbital buffer (pH 7.0). The crude cell extract was obtained by sonication and then centrifuged again at 12,000 rpm for 10 min. The protein concentration was determined using a BCA kit. The activities of AroK and AroL were evaluated in a 1 mL reaction system containing (at final concentrations) 4 μM ATP, 1 μM shikimic acid, 10 μM NaF, 5 μM MgCl2, 25 μM barbital buffer (pH 9.0), and 0.1 - 1.0 mg of protein from the crude cell extract. One unit of enzyme activity was defined as the amount of enzyme required to consume 1 μM of shikimic acid per minute. The results of the enzyme activity detection showed that compared with the activities of AroL and AroK in the control group without IPTG addition, Binder 04356 ( Figure 1 ) and Binder 15247 ( Figure 2 ) decreased the activities of AroL and AroK by 89.5 and 81.7%, respectively. Therefore, Binder 04356 and Binder 15247 were used as protein binders for AroL and AroK, and were named antiAroL and antiAroK, respectively.

[0056] Table 2 Inhibition levels of different binders on the enzyme activities of AroK and AroL

[0057] Binder Reduced level of AroL activity Reduced level of AroK activity 04356 89.5％ - 10934 80.4％ - 09452 62.3％ - 08542 - 62.8％ 15247 - 81.7％

[0058] Example 4: Construction of plug-and-play binder-inducing expression plasmids and strains

[0059] The medium-copy plasmid pEtrcQ (nucleotide sequence as shown in SEQ ID NO.3, plasmid map as Figure 3 shown) was selected as the plasmid for inducing the expression of the binder. The screening antibiotic for this plasmid is ampicillin, the replicon is f1, the promoter P trc (nucleotide sequence is TTGACAATTAATCATCCGGCTCGTATAATG), and the RBS is 0034 (nucleotide sequence is AAAGAGGAGAAA). Finally, the plasmid pEtrcQ-Binder was obtained. The pEtrcQ-Binder plasmid was introduced into the recombinant bacterium E. coli SA10 constructed in Example 2 to obtain a new recombinant strain E. coli SA11.

[0060] Table 3 List of plasmids and strains used

[0061]

[0062] Example 5: Optimization of the induction time and concentration of Binder

[0063] To reduce the addition of aromatic amino acids, a two-stage fermentation regulation strategy was adopted: in the early stage of fermentation, the strain grew rapidly and AroK and AroL were normally expressed; in the middle and early stage of fermentation, Binder expression was induced to rapidly inhibit AroK and AroL, so that shikimic acid was no longer degraded, realizing the rapid accumulation of shikimic acid. For this purpose, the induction time and concentration of Binder were optimized.

[0064] (1) Optimization of IPTG induction time

[0065] The IPTG induction time of the recombinant strain E. coli SA11 was carried out in a 5 L fermenter, and the specific fermentation conditions were as follows:

[0066] Fermentation medium: glucose 18 - 22 g / L, yeast powder 10 g / L, peptone 3 g / L, ferric ammonium citrate 1 g / L, dipotassium hydrogen phosphate 4 - 6 g / L, magnesium sulfate heptahydrate 1 g / L, aromatic amino acid mixture 0.04 g / L, metal ion solution 1 mL / L.

[0067] Metal ion solution: (NH4)6Mo7O 24 ·4H2O 0.0037 g / L, ZnSO4·7H2O 0.0029 g / L, H3BO3 0.0247 g / L, CuSO4·5H2O 0.0025 g / L, MnCl2·4H2O 0.0158 g / L.

[0068] Fermentation conditions: inoculation amount of seed liquid 10%, fermentation pH 6.6 - 6.8, dissolved oxygen controlled at 30%, residual sugar controlled at 10 g / L.

[0069] The recombinant strain E. coli SA11 constructed in Example 3 was inoculated into the fermentation medium, cultured at 37 °C for 2 h, and IPTG with a final concentration of 0.1 mM was added. Different induction times were set for different batches: 8 h, 10 h, 12 h, 14 h, 16 h. The results showed that the shikimic acid yields induced at the above different times were 43.5 g / L, 46.5 g / L, 53.8 g / L, 73.5 g / L, 97.2 g / L respectively. This result indicates that the earlier the induction time, the lower the yield.

[0070] (2) Optimization of IPTG induction concentration

[0071] The induction concentration of the recombinant strain E. coli SA11 was optimized in a 5 L fermenter, and the specific fermentation conditions were as follows:

[0072] The fermentation medium and fermentation conditions were the same as those in part (1) of this example. The difference was that different IPTG induction concentrations were set for different batches: 0.1 mM, 0.5 mM, and 1 mM, and induction was carried out for 12 h respectively, while other fermentation conditions remained unchanged. The results showed that the shikimic acid yields reached 93.5 g / L, 105.4 g / L, and 120.6 g / L respectively. As the IPTG concentration increased, the yield gradually increased. When the IPTG induction concentration was increased to 1 mM, the shikimic acid yield reached the highest level. The fermentation parameters are shown in Table 4, and the changes in the fermentation process parameters are as Figure 4 shown.

[0073] Table 4 Fermentation data of E. coli SA10

[0074] Production index Production data Yield 120.6 g / L Recovery rate > 0.38 g / L glucose Production intensity 2.5 g / L / h 3-Dehydroshikimic acid <15 g / L

[0075] Although the present invention has been disclosed above with preferred embodiments, it is not intended to limit the present invention. Any person familiar with this technology can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the claims.

Claims

1. An active protein Binder that targets and inhibits the activity of Escherichia coli shikimate kinase, characterized in that, It is (a) or (b); (a) Binder antiAroL that targets and inhibits Escherichia coli shikimate kinase AroL, and its amino acid sequence is shown in SEQ ID NO.1; (b) Binder antiAroK that targets and inhibits Escherichia coli shikimate kinase AroK, and its amino acid sequence is shown in SEQ ID NO.

2.

2. A gene encoding the active protein Binder described in claim 1.

3. An expression vector containing the gene described in claim 2.

4. The expression vector according to claim 3, characterized in that, Using plasmid pEtrcQ as the vector; the nucleotide sequence of the plasmid pEtrcQ is shown in SEQ ID NO.

3.

5. A recombinant bacterium co-expressing the protein Binder described in claim 1 and shikimate kinase.

6. Recombinant Escherichia coli, characterized in that, Co-express the protein Binder described in claim 1 and shikimate kinase.

7. A method for fermentatively producing shikimic acid, characterized in that, Use the recombinant Escherichia coli described in claim 6 for fermentation, and induce the expression of the active protein Binder by IPTG during the fermentation process.

8. The method according to claim 7, wherein Using glucose as the substrate, the fermentation temperature is 32 - 34 °C, and the residual sugar is controlled at 5 - 10 g / L.

9. The method according to claim 7 or 8, characterized in that During the fermentation process, induce with IPTG at a concentration of 0.5 - 1 mM, and the induction time is 15 - 17 h.

10. Use of the recombinant Escherichia coli described in claim 6 or any one of the methods described in claims 7 - 9 in the preparation of a product containing shikimic acid.

Images