CBE editing system and application

Abstract

The invention belongs to the technical field of gene editing, and discloses a CBE editing protein and application. The CBE editing protein provided by the invention is fused with a deubiquitinated protein. Compared with ABE and other single-base editors, the CBE single-base editor has the advantages that the protein is unstable, and the CBE single-base editor can be quickly degraded in cells. By fusing the deubiquitinated protein, the improvement of the protein stability of the CBE single-base editor is realized, so that the editing efficiency of the CBE is improved.

Description

Technical Field

[0001] The present invention relates to the field of gene editing technology, and particularly relates to a CBE editing system and its application. Background Art

[0002] Gene editing technology is a genetic engineering technology that modifies specific DNA fragments by performing site-directed editing on target genes.

[0003] In the prior art, gene editing was first achieved by using zinc finger proteins (ZFPs) to specifically recognize specific base sequences. Following ZFNs, the TALEN technology derived from the AvrBs3 protein emerged. However, ZFN and TALENs editing technologies have limitations such as complex design / screening processes, high off-target rates, and difficult packaging and delivery. Subsequently, the CRISPR technology is a gene editing technology that uses RNA-guided endonucleases to cut nucleic acids at specific positions. The full name of the CRISPR-Cas system is Clustered Regularly Interspaced Short Palindromic Repeats and CRISPR-associated proteins (Cas), which consists of a Cas nuclease and two separate RNA components, one is a programmable crRNA (CRISPR RNA) and one is a fixed tracrRNA (trans-activating crRNA). Cas1-Cas2 proteins can cut the invading phage DNA into small fragments and then integrate them as spacers into the CRISPR array. Subsequently, the CRISPR array is transcribed to produce crRNA and complementary tracrRNA, which form a double-stranded RNA structure and recruit Cas proteins for cleavage. Near the crRNA targeting sequence on the invading DNA, the protospacer adjacent motif (PAM) plays a crucial role in the adaptation and interference stages, and these sequences are recognized by the CRISPR-Cas complex during the target DNA binding process. The CRISPR-Cas9 technology has quickly become the preferred technology for genetic operations such as gene knockout, gene knock-in, and large fragment deletion in plants, animals, and microorganisms due to its simplicity and high efficiency.

[0004] The CRISPR-Cas system is mainly divided into two categories: one is the multi-protein effector complex including type I, type III, and type IV, and the other is the single Cas protein complex including type II, type V, and type VI. Compared with the former, the type II systems (type II Cas9, type V Cas12a, type VI Cas13a, and Cas13b systems) have greater potential in genome editing applications. Among them, compared with other systems that require multiple Cas proteins, the type II system has only one Cas protein, Cas9. The Cas9 protein relies on the sgRNA (single guide RNA) formed by the fusion and cleavage of crRNA and tracrRNA and plays a role in RNA-guided DNA recognition, making it useful for genome engineering. Cas9 contains domains homologous to the HNH and RuvC endonucleases, where the HNH domain cleaves the complementary DNA strand, and the RuvC-like domain cleaves the non-complementary DNA strand. In 2012, Jinek et al. first reported that the CRISPR-Cas9 system could be modified into a programmable RNA-guided DNA endonuclease. Subsequently, Cong et al. used the modified CRISPR-Cas9 system to achieve targeted gene editing in mammalian cells for the first time. Since then, the CRISPR-Cas9 technology has rapidly become the preferred technology for genetic operations such as gene knockout, gene knock-in, and large fragment deletion in plants, animals, and microorganisms due to its simplicity and high efficiency. With the in-depth research, researchers have developed a large number of new editing tools by exploring other types of CRISPR systems, making the CRISPR-Cas system the dominant gene editing tool.

[0005] However, there are some problems that cannot be ignored in the CRISPR-Cas system, such as low efficiency, off-target cleavage, and low safety. Komor et al. reported a single-base editing technology that fuses spCas9 with cytosine deaminase and uses the precise DNA targeting ability of spCas9 to direct cytosine deaminase to the target sequence. Then, under the catalysis of cytosine deaminase, cytosine C within the mutation window is converted to thymine T, which was later also called cytosine base editor (CBE). The CBE system mainly consists of nCas9 or dCas9 and cytidine deaminase 1 (APOBEC1), and the spontaneous deamination of cytosine is the main source of the C-G to T-A conversion. Komor et al. reported BE1 (rAPOBEC1-XTENdCas9), the principle of which is to form a fusion protein by linking the N-terminus of dCas9 with APOBEC1. Subsequently, the gRNA guides the fusion protein to the target site, and APOBEC1 deaminates the C of single-stranded DNA in the R-loop to form U, and the C-to-T conversion is completed through DNA replication. However, further research found that although the average in vitro apparent editing efficiency of the BE1 system was 44%, the editing efficiency in mammalian cells was only 0.8% to 7.7%. To improve the editing efficiency, uracil DNA glycosylase inhibitor (UGI) was fused to the C-terminus of BE1 to construct the second-generation base editor BE2 (APOBEC-XTEN-dCas9-UGI). Compared with BE1, the addition of UGI increased the editing efficiency by about 3 times. Subsequently, dCas9 in the BE2 system was replaced with nCas9 to introduce a nick in the non-edited strand and stimulate the cell to undergo base mismatch repair (MMR), thereby constructing the third-generation base editor BE3 (APOBEC-XTEN-dCas9(A840H)-UGI). Compared with BE2, the editing efficiency of BE3 was increased by 2-6 times. To further improve the editing efficiency, Koblan et al. constructed BE4max by adding a nuclear localization signal (NLS) and optimizing codons, which increased the editing efficiency by 3 times based on BE4.

[0006] Although researchers have optimized and improved various components (including Cas proteins, deaminases, small elements, etc.) of the CBE single-base editing system, the editing efficiency of this system still needs to be further improved and optimized. Therefore, studying new strategies to improve the editing efficiency of CBE is of great significance for the application of CBE. Summary of the Invention

[0007] The object of the present invention is to provide a CBE editing system and its application by overcoming the deficiencies of the prior art.

[0008] To achieve the above object, the technical solution adopted by the present invention is as follows:

[0009] In a first aspect, the present invention provides a CBE editing protein, which is fused with a protein for deubiquitination gene expression.

[0010] The present invention discovers that compared with other single-base editors such as ABE, the protein of the CBE single-base editor is unstable and rapidly degrades in cells. By fusing a deubiquitination protein, the stability of the CBE single-base editor protein is improved, thereby improving the editing efficiency of CBE.

[0011] As a preferred embodiment of the CBE editing protein of the present invention, the CBE editing protein is selected from any one of xCas9(3.7)BE4, CP1028 CBEmax, BE4 GAM, CBE4max SpG, CBE4max SpRY, YE1 BE3, ancBE4max, AID.

[0012] As a preferred embodiment of the CBE editing protein of the present invention, the deubiquitination gene is at least one of UCHL1, TIGAR, SNCB, SCGN, GSTM3, OTUB1, YWHAQ, TBCB, PHYHD1, FBXO2.

[0013] In a second aspect, the present invention provides an expression vector for expressing the CBE editing protein described above.

[0014] As a preferred embodiment of the expression vector of the present invention, it includes a nucleotide sequence encoding any one of the CBE editing proteins of xCas9(3.7)BE4, CP1028CBEmax, BE4 GAM, CBE4max SpG, CBE4max SpRY, YE1 BE3, ancBE4max, AID.

[0015] As a preferred embodiment of the expression vector of the present invention, it includes the nucleotide sequence shown in SEQ ID NO: 1.

[0016] In a third aspect, the present invention provides a nucleic acid encoding the CBE editing protein.

[0017] In a fourth aspect, the present invention provides a CBE editing system, which includes the CBE editing protein described above.

[0018] In a fifth aspect, the present invention applies the CBE editing protein, the expression vector, the nucleic acid, and the CBE editing system in gene editing.

[0019] As a preferred embodiment of the application of the present invention, the editing is gene editing from C to T at a specific locus.

[0020] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0021] By integrating the deubiquitinating protein UCHL1, the present invention improves the protein stability of the CBE single-base editor, thereby enhancing the editing efficiency of CBE. The present invention provides a new method for improving the efficiency of the CBE single-base editor, achieving an improvement in the efficiency of CBE single-base editing. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 It is a graph of experimental results showing the instability of the CBE protein; in the figure, A: Schematic diagram of the CDS region elements of each expression plasmid and the schematic diagram of protein stability detection; B: After transfection of each plasmid for 48 h, CHX was treated for 2, 4, 6, and 8 hours, and the 0-hour treatment was used as a control, and western blot was performed to detect the expression level of the target protein. Each expression plasmid carried a V5 tag and was detected by a V5 antibody; C: Quantification graph of each protein level with GAPDH as an internal reference for normalization.

[0023] Figure 2 Inhibiting the ubiquitination degradation pathway can inhibit the degradation of the CBE protein; in the figure, A: Western Blot was used to detect the expression levels of each protein; after transfection of the corresponding plasmid for 48 h, CHX was treated alone for 8 hours, or CHX + MG132 was treated together for 8 hours, and the samples were collected for detection; B: Quantitative scatter plot of the ratio of the protein level in the CHX + MG132 treatment group to the protein level in the CHX-alone treatment group.

[0024] Figure 3 Fusing UCHL1 can significantly improve the stability of CBE, increase its protein expression level, and thus improve its editing efficiency; in the figure, A: Schematic diagram of two strategies for screening stable protein expression ORFs; B: Scatter plot of ORFs with significantly improved protein stability in both strategies (FC >= 2, P <= 0.01), where FBXO2, UCHL1, and OTUB1 belong to ubiquitination-related proteins; C: Select ubiquitination-related proteins and randomly select other proteins to fuse with the CBE4max-SpRY protein; D: Western blot was used to detect the expression levels of these fusion proteins. GAPDH was used as an internal reference; E: Co-transfect the CBE editor and sgRNA, and the CBE editor fused with the UCHL1 protein has a higher editing efficiency. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0025] To better illustrate the objectives, technical solutions, and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. Those skilled in the art should understand that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0026] Unless otherwise specified, the test methods used in the examples are conventional methods; the materials, reagents, etc. used can be obtained from commercial sources unless otherwise specified.

[0027] Example 1: Construction of expression vectors for CBE and control proteins

[0028] (1) The pCDHblast MCSNard OST-LMNA (Addgene #22661) vector was double-digested with NEB restriction enzyme kits (R3136S and R3101S) at 37 °C for 1 h. After separation and purification by agarose gel electrophoresis, the digested vector was recovered by cutting the gel using the Omega Gel Extraction Kit (D2500). The digestion system is shown in Table 1.

[0029] Table 1 Digestion system

[0030]

[0031] (2) High-fidelity PCR reactions were performed using the following corresponding primers from the respective plasmids. The PCR products were cloned into the backbone using Novoprotein's ClonExpress II One Step Cloning Kit (C112-01) to obtain the corresponding CBE expression vectors or control protein expression vectors with V5 tags.

[0032] Table 2 Primer and plasmid information

[0033] Forward primer Reverse primer Amplification length Template plasmid (Addgene#) Obtained plasmid GAM-F GAM-R 6.1 kb 100806 pCDH-V5-BE4-Gam CABE-F CABE-R 5.7 kb 119802 pCDH-V5-CP1028-CBEmax YE1-F GAM-R 5.2 kb 85174 pCDH-V5-YE1-BE3 CABE-F CABE-R 5.6 kb 139998 pCDH-V5-CBE4max-SpG CABE-F CABE-R 5.6 kb 139999 pCDH-V5-CBE4max-SpRY CABE-F CABE-R 5.6 kb 112094 pCDH-V5-AncBE4max YE1-F GAM-R 5.5 kb 108381 pCDH-V5-xCas9(3.7)-BE4 AID-F AID-R 4.9 kb 83260 pCDH-V5-AID ABE8.8-F ABE8.8-R 4.9 kb 136294 pCDH-V5-ABE8.8m CABE-F CABE-R 5.7 kb 140252 pCDH-V5-CGBE D10A-F D10A-R 4.2 kb 85174 pCDH-V5-nCas9(D10A) SpRy-F SpRy-R 4.2 kb 139999 pCDH-V5-nCas9(SpRY)

[0034] The primer sequences are as follows:

[0035] GAM-F:

[0036] agagctagcgaattgggatccatgggcaagcccatccccaaccccctgctgggcctggacagcaccATGGCTAAACCAGCAAAACGTAT;

[0037] GAM-R: agcggccgcctcgaggaattcTTAGACTTTCCTCTTCTTCTTGGGA;

[0038] CABE-F:

[0039] agagctagcgaattgggatccatgggcaagcccatccccaaccccctgctgggcctggacagcaccAAACGGACAGCCGACGGA;

[0040] CABE-R: agcggccgcctcgaggaattcCTAGACTTTCCTCTTCTTCTTGGGC;

[0041] YE1-F:

[0042] agagctagcgaattgggatccatgggcaagcccatccccaaccccctgctgggcctggacagcaccATGAG CTCAGAGACTGGCCCA;

[0043] AID-F:

[0044] agagctagcgaattgggatccatgggcaagcccatccccaaccccctgctgggcctggacagcaccGCCCC AAAGAAGAAGCGG;

[0045] AID-R: agcggccgcctcgaggaattcttaGGGCAAAAGGATGCGCCG;

[0046] ABE8.8-F:

[0047] agagctagcgaattgggatccatgggcaagcccatccccaaccccctgctgggcctggacagcaccATGTC CGAAGTCGAGTTTTCCC;

[0048] ABE8.8-R: agcggccgcctcgaggaattcTTAGACTTTCCTCTTCTTCTTGGGG;

[0049] D10A-F:

[0050] agagctagcgaattgggatccatgggcaagcccatccccaaccccctgctgggcctggacagcaccGATAA AAAGTATTCTATTGGTTTAGCCAT;

[0051] D10A-R: gcggccgcctcgaggaattcttaGTCACCCCCAAGCTGTGACA;

[0052] SpRy-F:

[0053] agagctagcgaattgggatccatgggcaagcccatccccaaccccctgctgggcctggacagcaccGACAA GAAGTACAGCATCGGCC;

[0054] SpRy-R: gcggccgcctcgaggaattcttaGTCACCTCCCAGCTGAGACAGG。

[0055] The PCR reaction system is shown in Table 3:

[0056] Table 3 PCR reaction system

[0057]

[0058]

[0059] The PCR reaction procedure is shown in Table 4:

[0060] Table 4 PCR reaction procedure

[0061]

[0062] (3) Perform agarose gel electrophoresis on the amplified PCR products, cut the gel and recover. Connect the PCR products to the vector backbone through Gibson Assembly. The reaction conditions are 37 °C for 40 min. The reaction system is shown in Table 5.

[0063] Table 5 Reaction system

[0064]

[0065] (4) Add all the ligation products to 50 μL of stbl3 competent cells, mix well and place on ice for 20 min, heat activate at 42 °C for 1 min and then place on ice for 2 min. Add 300 μL of SOC medium and culture in a shaker at 37 °C for 1 h.

[0066] (5) Take 100 μL of the bacterial liquid cultured for 1 h and evenly inoculate it on an LB plate containing ampicillin. Place the plate in an incubator at 37 °C and culture overnight.

[0067] (6) Pick single colonies on the plate, perform colony PCR, after 1% agarose gel electrophoresis, pick the bacterial liquid corresponding to a single bright band for sequencing confirmation. Extract the plasmid from the bacterial liquid with the correct sequencing sequence using a plasmid extraction kit, measure its concentration and store it at -40 °C for later use.

[0068] Example 2: Construction of a stable protein fusion vector

[0069] Using primers CBE-SPRY-F / R, with pCDH-V5-CBE4max-SpRY as the template, perform PCR amplification to obtain PCR fragment 1 (length 5628 bp).

[0070] The sequences of primers CBE-SPRY-F / R are as follows:

[0071] CBE-SPRY-F: AGAGCTAGCGAATTGGGATCCATGGGCAAGCCCATCCCC;

[0072] CBE-SPRY-R: TCCACCGACTTTCCTCTTCTTCTTGGGCT.

[0073] Using primers 13xLinker-F / R, with the plasmid MCS-13X Linker-BioID2-HA (Addgene #80899) as the template, perform PCR amplification to obtain PCR fragment 2 (233 bp).

[0074] The sequences of primers 13xLinker-F / R are as follows:

[0075] 13XLINKER-F: AGAAGAGGAAAGTCGGTGGAGGCGGGTCTGGA;

[0076] 13XLINKER-R: AGCGGCCGCCTCGAGGAATTCCGATCCACCGCCTCCGCT.

[0077] Perform Gibson Assembly ligation on the three fragments in total, namely PCR fragment 1, PCR fragment 2, and the backbone of pCDHblast MCSNard OST-LMNA digested with BamH I / EcoR I, to obtain the plasmid pCDH-V5-CBE4max-SPRY-13xlinker.

[0078] The nucleotide sequence of V5-CBE4max-SPRY-13xlinker is shown in SEQ ID NO: 1.

[0079] Synthesize the gene coding sequences of UCHL1 (Ubiquitin C-Terminal Hydrolase L1), TIGAR (TP53 Induced Glycolysis Regulatory Phosphatase), SNCB (Synuclein Beta), SCGN (Secretagogin, EF-Hand Calcium Binding Protein), GSTM3 (Glutathione S-Transferase Mu 3), OTUB1 (OTU Deubiquitinase, Ubiquitin Aldehyde Binding 1), YWHAQ (Tyrosine 3-Monooxygenase / Tryptophan 5-Monooxygenase Activation Protein Theta), TBCB (Tubulin Folding Cofactor B), PHYHD1 (Phytanoyl-CoA Dioxygenase Domain Containing 1) and FBXO2 (F-Box Protein 2), perform PCR amplification with corresponding primers, and ligate them to the Xho I single-digested backbone of the pCDH-V5-CBE4max-SPRY-13xlinker plasmid through Gibon Assembly to obtain the corresponding fusion protein expression vectors. The steps of amplification, ligation, transformation, etc. are as described in Example 1.

[0080] As shown in SEQ ID NO: 2, the nucleotide sequence of the expressed fusion protein V5-CBE4max-SpRY-13xLinker-UCHL1 is as follows.

[0081] The corresponding primer sequences are as follows:

[0082] UCHL1-F: GGTGGATCGGAATTCCTCGAGATGCAGCTCAAGCCGATGG;

[0083] UCHL1-R: CTATTTAGCGGCCGCCTCGAGTTAGGCTGCCTTGCAGAGAGC;

[0084] TIGAR-F: GGTGGATCGGAATTCCTCGAGATGGCTCGCTTCGCTCTGA;

[0085] TIGAR-R: CTATTTAGCGGCCGCCTCGAGTTAGCGAGTTTCAGTCAGTCCATT;

[0086] SNCB-F: GGTGGATCGGAATTCCTCGAGATGGACGTGTTCATGAAGGGC;

[0087] SNCB-R: CTATTTAGCGGCCGCCTCGAGCTACGCCTCTGGCTCATACTCC;

[0088] SCGN-F: GGTGGATCGGAATTCCTCGAGATGGACAGCTCCCGGGAA;

[0089] SCGN-R: TATTTAGCGGCCGCCTCGAGTTATGGGTTGATTTTCAGCCCA;

[0090] GSTM3-F: GGTGGATCGGAATTCCTCGAGATGTCGTGCGAGTCGTCTATGG;

[0091] GSTM3-R: CTATTTAGCGGCCGCCTCGAGTCAGCATACAGGCTTGTTGCC;

[0092] OTUB1-F: GGTGGATCGGAATTCCTCGAGATGGCGGCGGAGGAACCT;

[0093] OTUB1-R: CTATTTAGCGGCCGCCTCGAGCTATTTGTAGAGGATATCGTAGTGTCCA; YWHAQ-F: GGTGGATCGGAATTCCTCGAGATGGAGAAGACTGAGCTGATCCA;

[0094] YWHAQ-R: CTATTTAGCGGCCGCCTCGAGTTAGTTTTCAGCCCCTTCTGCC;

[0095] TBCB-F: GGTGGATCGGAATTCCTCGAGATGGAGGTGACGGGGGTG;

[0096] TBCB-R: CTATTTAGCGGCCGCCTCGAGTCATATCTCGTCCAACCCGTAGT;

[0097] PHYHD1-F: GGTGGATCGGAATTCCTCGAGATGGCCTGCCTGAGCCCC;

[0098] PHYHD1-R: CTATTTAGCGGCCGCCTCGAGTTAGGTGTACAGTTGGGGAAAGG;

[0099] FBXO2-F: GGTGGATCGGAATTCCTCGAGATGGACGGAGACGGTGACCC;

[0100] FBXO2-R: CTATTTAGCGGCCGCCTCGAGTCAGGGTTCTACCCACACGC.

[0101] Example 3: sgRNA Cloning

[0102] After the Lentiguide plasmid was digested with BsmB I, the primers gRNA-F and gRNA-R were annealed and then ligated to the Lentiguide vector through Solution I (DNA Ligation Kit Ver.2.1 from Takara, catalog number 6022). The reaction conditions were 16°C for 30 min. The ligation system is shown in the following table. The transformation and other steps were as described in Example 1.

[0103] Table 5 Ligation System

[0104]

[0105]

[0106] The primer sequences are as follows:

[0107] gRNA-F: CACCGGTGCTCTCCACTGACACAG;

[0108] gRNA-R: AAACCTGTGTCAGTGGAGAGCACC.

[0109] Example 4: 293T Cell Transfection

[0110] HEK-293T cells were seeded in a 6-cm cell culture dish. When the cell density reached 90% the next day, the complete medium for cell growth (DMEM containing 10% FBS) was discarded, and 1 mL of 1640 medium containing 5% FBS at 37°C was added. The dish was then placed statically in a 37°C incubator for 30 min. Plasmids were added to a 1.5-mL EP tube, and then filled up to a total volume of 100 μL with Opti-MEM. After thorough mixing, it was left standing at room temperature for 5 min.

[0111] Take the PEI solution in a 1.5 mL EP tube according to the amount of plasmid (add 4 μL of PEI for every 1 μg of plasmid), and make up to a total volume of 100 μL with Opti-MEM. After mixing well, let it stand at room temperature for 5 min. After the well-standing plasmid solution and the PEI dilution are fully mixed, let it stand at room temperature for 15 min. The mixed solution is evenly dropped into HEK-293T cells. After culturing at 37 °C for 5 h, discard the liquid in the culture dish and add 4 mL of pre-warmed complete medium at 37 °C.

[0112] The results are as follows:

[0113] (1) Common CBE editor proteins are unstable.

[0114] By expressing common CBE editors (xCas9(3.7)BE4, CP1028CBEmax, BE4 GAM, CBE4max SpG, CBE4max SpRY, YE1 BE3, ancBE4max, and AID) with the pCDH vector, expressing nCas9 (nCas9(D10A) and nCas9(SpRY)), CGBE, and ABE8.8m with the same vector as controls. After 48 hours of transfection of 293T cells, cycloheximide (CHX) treatment for different times was performed to inhibit translation, and the protein expression levels were detected by Western blot (as shown in Figure 1 A). By comparing the protein expression levels at different time points after inhibiting translation, the proteins of nCas9 (nCas9(D10A) and nCas9(SpRY)), CGBE, and ABE8.8m have high stability, while the proteins of CBE editors are all unstable and are rapidly degraded in cells (as shown in Figure 1 B and C).

[0115] (2) The ubiquitination degradation pathway is one of the main pathways for protein degradation in cells.

[0116] By inhibiting protein translation in cells simultaneously (CHX treatment for 8 hours), if the ubiquitination degradation pathway is inhibited simultaneously (adding MG132, a proteasome inhibitor), the degradation of CBE proteins can be significantly inhibited (as shown in Figure 2 ). However, MG132 treatment has no obvious effect on nCas9, CGBE, and ABE. It can be seen that treating cells with MG132 is a method to increase the protein stability of CBE base editors.

[0117] (3) Since treating cells with MG132 may bring toxicity, it can limit the application of CBE base editors.

[0118] Enhancing the stability of CBE proteins by fusing deubiquitinating genes. First, intersection analysis was performed on the genes with protein-stabilizing effects screened by two strategies (requiring P <= 0.001 and FC >= 2 in both strategies), and 3 ubiquitination-related proteins (FBXO2, UCHL1, and OTUB1) were found ( Figure 3 A and B in). In addition, 7 other types of genes with protein-stabilizing effects were randomly selected. By fusing these genes to the C-terminus of CBE4max SpRY ( Figure 3 C in). It was found that except for FBXO2, the fusion of these genes all played a role in stabilizing the CBE4max SpRY protein to a certain extent. Among them, the increase was the largest after the fusion of UCHL1 ( Figure 3 D in).

[0119] To explore whether increasing the stability of CBE can increase the editing efficiency. In 293T cells, genome-specific site C-to-T gene editing was performed by plasmid transfection. Compared with the CBE SpRY editor without the fusion of UCHL1, the editing efficiency of the single-base editor fused with UCHL1 was significantly improved at the relevant sites ( Figure 3 E in).

[0120] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the protection scope of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A CBE editing protein, characterized in that, The CBE editing protein is fused with a protein that deubiquitinates gene expression.

2. The CBE editing protein according to claim 1, wherein The CBE editing protein is selected from any one of xCas9(3.7)BE4, CP1028 CBEmax, BE4 GAM, CBE4max SpG, CBE4max SpRY, YE1 BE3, ancBE4max, and AID.

3. The CBE editing protein according to claim 1, characterized in that, The deubiquitination gene is at least one of UCHL1, TIGAR, SNCB, SCGN, GSTM3, OTUB1, YWHAQ, TBCB, PHYHD1, and FBXO2.

4. An expression vector, characterized in that, Express the CBE editing protein of claim 1.

5. The expression vector according to claim 4, wherein, It includes a nucleotide sequence encoding any one of the CBE editing proteins of xCas9(3.7)BE4, CP1028CBEmax, BE4 GAM, CBE4max SpG, CBE4max SpRY, YE1 BE3, ancBE4max, and AID.

6. The expression vector according to claim 4, characterized in that, It includes the nucleotide sequence shown in SEQ ID NO:

1.

7. A nucleic acid encoding the CBE editing protein according to any one of claims 1-3.

8. A CBE editing system, characterized in that, It includes the CBE editing protein according to any one of claims 1-3.

9. Use of the CBE editing protein according to any one of claims 1-3, the expression vector according to any one of claims 4-6, the nucleic acid according to claim 7, and the CBE editing system according to claim 8 in gene editing.

10. The application according to claim 9, wherein The editing is C-to-T gene editing at a specific locus.

Images