Guide agRNA for regulating RNA splicing

Abstract

The invention belongs to the field of biological medicine, and relates to a guide agRNA for regulating RNA splicing. The invention provides an application of a guide agRNA (Ribonucleic Acid) in preparation of a medicine for changing expression of a target protein by cells of a subject. The guide agRNA recruits ADAR protein to the 3 'splice site or pseudo 3' splice site to edit the A base of the 3 'splice site or pseudo 3' splice site, thereby splicing the whole exon located at the 3 'splice site or flanking the pseudo 3' splice site of the intron from the precursor mRNA, thereby changing the level of mRNA encoding the target protein, and altering the expression of the target protein in the cell. The target gene pre-mRNA selective splicing is regulated and controlled to influence the function or expression of the functional RNA and the target protein of the target gene, so that the purpose of treating diseases is achieved.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biological medicine, and relates to an ADAR guide RNA (agRNA) for regulating RNA splicing. BACKGROUND

[0002] Pre-messenger RNA (pre-mRNA) splicing is a key step in the post-transcriptional regulation of gene expression, which can significantly expand the functional proteome of eukaryotes with limited gene numbers. The protein-coding exon sequences in eukaryotic genes are interrupted by intervening sequences or introns, and the removal of introns is achieved by a large and highly dynamic ribonucleoprotein complex called the spliceosome, which is composed of five small ribonucleoprotein (snRNP) complexes (U1, U2, U4, U5, and U6) and more than 150 other proteins. These snRNPs and additional non-snRNP-associated proteins (e.g., SF1, U2AF, and Prp19 complex) sequentially form pre-spliceosomal E, A, B, and C complexes on the pre-mRNA in an orderly manner. During this orderly process, complex binding and unbinding processes occur between these snRNPs and non-snRNP-associated proteins and the reaction sites, which provide multiple checking opportunities for the nucleosome to ensure the accuracy of their binding and thus improve the accuracy of site selection. Before nucleosome assembly, U1 snRNP occupies the 5' splice site (5'-splice site, 5'SS), and SF1 binds to the branch point, both of which are ATP-dependent and ultimately form the pre-spliceosomal E complex. With the participation of ATP, snRNPs sequentially transition from the pre-spliceosomal E complex to the spliceosomal A, B, and C complexes. Subsequently, the U2 snRNP replaces the SF1 binding to the branch point to form the A complex. Then, the pre-assembled U4-U6-U5 triplex complex and the NTC complex are recruited to the splice site to form the B complex. Subsequently, the U1 and U4 snRNPs are released from the complex, while the U6 snRNP binds to the U2 snRNP at the 5' splice site. This replacement reaction facilitates the completion of the first transesterification reaction, i.e., the cleavage of the phosphodiester bond between the upstream exon and the intron, and at the same time, the formation of a 2'-5' phosphodiester bond between the guanosine at the 5'SS and the internal adenosine at the branch point (BP), generating a lariat intermediate, thereby leading to the formation of the C complex. In the C complex, the second transesterification reaction is catalyzed, i.e., the cleavage of the phosphodiester bond between the 3' splice site (3'-splice site, 3'SS) of the intron and the downstream exon, forming an intron lariat structure and finally connecting the 3' and 5' ends of the exon to form a mature mRNA.

[0003] Alternative splicing (also known as "variable splicing") refers to the process in which different splicing methods during the process of pre-mRNA to mature mRNA make the same gene produce multiple different mature mRNAs, and ultimately produce different proteins, which is widely present in eukaryotic organisms. Studies have shown that among the genes containing multiple exons in the human genome, 95% of the genes have alternative splicing. Alternative splicing leads to polymorphism of transcripts and protein structure and function, and the structural differences of various protein isoforms often affect the stability of the protein, intracellular localization, enzyme activity, and interaction with other proteins or nucleic acids. Alternative splicing mainly includes cassette splicing, mutually exclusive exon splicing, variable start exon splicing, variable terminal exon splicing, 5' alternative splicing, 3' alternative splicing, intron retention splicing, and reverse splicing. Accurate splicing requires auxiliary sequences or structures that activate or suppress splicing site recognition, which are called intron or exon splicing enhancers or silencers. These elements enable the real splicing site to be recognized among a large number of excess cryptic sites or pseudo sites in the genome of higher eukaryotes, which have the same sequence but are one order of magnitude more than the real sites. Alternative splicing is diverse in different tissues or different stages of development, and specific splicing isoforms are produced in specific tissues or conditions, thereby associating alternative splicing with normal life activities and diseases. A large number of studies have found that changes in alternative splicing are associated with cancer, central nervous system degenerative diseases, and many other diseases. Abnormal alternative splicing, such as intron retention splicing caused by gene mutation, can introduce premature stop codons, which can trigger nonsense-mediated decay (NMD) and other RNA degradation mechanisms, leading to low expression of normal proteins and causing diseases.

[0004] Studies have shown that up to half of human genetic diseases can be caused by mutations affecting splicing. From the small nucleic acid drugs that have been approved for listing or are undergoing clinical trials, it is clear that targeting and regulating the alternative splicing of pre-mRNA has high clinical treatment value. SUMMARY

[0005] In some embodiments, the present application provides a method for regulating RNA splicing by RNA editing of the A base of the 3' splice site or pseudo 3' splice site in the pre-mRNA, thereby causing exon skipping to change the expression of target proteins, and achieving the purpose of treating diseases.

[0006] In some embodiments, the present application provides use of a guide agRNA (ADAR guide RNA, agRNA) in the manufacture of a medicament for altering expression of a target protein in a cell of a subject, the cell having a pre-mRNA encoding the target protein, wherein the pre-mRNA comprises an intron, an exon flanked by a 5' splice site of the intron, and an exon flanked by a 3' splice site or a pseudo 3' splice site of the intron; the guide agRNA is capable of binding to the pre-mRNA to form a structure capable of recruiting ADAR in the cell, thereby forming a complex containing ADAR protein.

[0007] The agRNA designed in the present application can target and bind to the 3' splice site or the pseudo 3' splice site in the pre-mRNA of the target gene, edit the adenine in the NAG / N sequence of the 3' splice site into hypoxanthine by recruiting ADAR protein, thereby destroying the 3' splice site or the pseudo 3' splice site, so that the exon flanked by the edited 3' splice site is skipped in the splicing process, thereby regulating the splicing of the pre-mRNA of the target gene and affecting the expression and function of the mRNA and protein of the target gene.

[0008] In some embodiments, the guide agRNA is capable of recruiting ADAR to the 3' splice site or the pseudo 3' splice site to edit the A base of the 3' splice site or the pseudo 3' splice site, thereby causing the exon flanked by the 3' splice site or the pseudo 3' splice site of the intron to be spliced from the pre-mRNA, resulting in skipping of the exon, thereby changing the expression level or sequence composition of the mature mRNA encoding the target protein, and changing the expression level or function of the target protein in the cell.

[0009] In some embodiments, the target protein comprises LRRK2, APP, CFTR, UNC13A, MDM4, or Nav1.1 protein.

[0010] In some embodiments, the guide agRNA is unmodified or has a modification.

[0011] In some embodiments, the modification comprises a backbone modification, a sugar modification, or a base modification.

[0012] In some embodiments, the modification is selected from LNA, UNA, 2'-MOE, 2'-F, 2'-OMe, phosphorothioate modification, 5mC, polyethylene glycol modification, or DNA base substitution modification.

[0013] In some embodiments, the polyethylene glycol modification is selected from a dimeric polyethylene glycol.

[0014] In some embodiments, the polyethylene glycol modified guide agRNA comprises two domains linked by a polyethylene glycol.

[0015] In some embodiments, the 5' splice site has a consensus NNN / GUNNNN or NNN / GCNNNN motif.

[0016] In some embodiments, the 3' splice site has a consensus NAG / N motif.

[0017] In some embodiments, the "N" is one of A, U, G, C bases, and " / " is an exon-intron boundary.

[0018] In some embodiments, the adenine in the 3' splice site NAG / N sequence is edited by ADAR.

[0019] In some embodiments, the ADAR editing is ADAR-mediated A-to-I editing.

[0020] In some embodiments, the ADAR is selected from ADAR1 or ADAR2.

[0021] In some embodiments, the guide agRNA, after binding to the pre-mRNA, forms a complex that is capable of recruiting ADAR, which is capable of mutating the A in the NAG / N of the 3' splice site of the pre-mRNA to a G.

[0022] In some embodiments, the guide agRNA is fully complementary paired or incompletely complementary paired to the pre-mRNA.

[0023] In some embodiments, the incomplete base complementary pairing is a complementary pairing with one or more mismatches, wobbles, deletions, and / or bulges to the targeted region.

[0024] In some embodiments, the guide agRNA has at least one mismatch to the pre-mRNA.

[0025] In some embodiments, the base in the guide agRNA that binds to the A base of the 3' splice site or pseudo 3' splice site is one of C, A, G, or I, or a base derivative thereof.

[0026] In some embodiments, the base in the guide agRNA that binds to the A base of the 3' splice site or pseudo 3' splice site is C or a base derivative thereof.

[0027] In some embodiments, the guide agRNA forms a double-stranded RNA with the pre-mRNA that is incompletely base complementary paired.

[0028] In some embodiments, the complementary strand is base-pairing complementary at non-mismatched or non-deleted or non-bulged or non-looped or non-wobble base-pairing sites.

[0029] In some embodiments, the ratio of complementary base-pairing in the double-stranded RNA formed by the guide agRNA and the pre-mRNA is greater than 60%.

[0030] In some embodiments, the ratio of complementary base-pairing in the double-stranded RNA formed by the guide agRNA and the pre-mRNA is greater than 75%.

[0031] In some embodiments, the guide agRNA is capable of binding to the pre-mRNA to form a complex with an ADAR protein, and the editing efficiency of the pre-mRNA is greater than 1% after the binding.

[0032] In some embodiments, the position of the guide agRNA targeting the pre-mRNA is within the region of 1000 bp upstream to 1000 bp downstream relative to the 3' splice site.

[0033] In some embodiments, the position of the guide agRNA targeting the pre-mRNA is within the region of 500 bp upstream to 500 bp downstream relative to the 3' splice site.

[0034] In some embodiments, the position of the guide agRNA targeting the pre-mRNA is within the region of 100 bp upstream to 100 bp downstream relative to the 3' splice site.

[0035] In some embodiments, the sequence length of the guide agRNA is 10-300 bp.

[0036] In some embodiments, the sequence length of the guide agRNA is 20-150 bp.

[0037] In some embodiments, the sequence length of the guide agRNA is 25-100 bp.

[0038] In some embodiments, the sequence length of the guide agRNA is 30-70 bp.

[0039] In some embodiments, the sequence of the guide agRNA is selected from at least any one of the sequences shown in SEQ ID NO: 2-3, SEQ ID NO: 10-14, SEQ ID NO: 22, SEQ ID NO: 30, SEQ ID NO: 43-44, SEQ ID NO: 52-53, SEQ ID NO: 54-56, SEQ ID NO: 58-60, or SEQ ID NO: 70-71.

[0040] In some embodiments, the sequence of the guide agRNA is selected from the combination of SEQ ID NO: 56 and SEQ ID NO: 70, or from the combination of SEQ ID NO: 60 and SEQ ID NO: 71.

[0041] In some embodiments, the drug is a drug for treating amyotrophic lateral sclerosis, cystic fibrosis, Alzheimer’s disease, Parkinson’s disease, amyloid angiopathy, familial hemiplegic migraine-2, familial basal ganglia migraine, alternating hemiplegia of childhood, ataxia 2, familial hemiplegic migraine, spinocerebellar ataxia 6, mental retardation-23, 3p25 microdeletion syndrome, Fechtner- McDowell syndrome, schizophrenia-15, neurofibromatosis, type 2, meningioma, NF2- associated, schwannomatosis 1, hereditary sensory neuropathy type IE, autosomal dominant cerebellar ataxia, deafness, and narcolepsy, Pitt Hopkins syndrome, Smith- Magenis syndrome, peroxisome biogenesis disorder la, Heimler syndrome-1, metachromatic leukodystrophy, vanishing white matter leukodystrophy, Aicardi-Goutieres syndrome 6, early infantile epileptic encephalopathy 4, progressive myoclonic epilepsy 5, familial infantile convulsions with paroxysmal kinesigenic choreoathetosis, paroxysmal kinesigenic dyskinesia 1, benign familial infantile convulsions 2, or generalized epilepsy with febrile seizures plus type 9.

[0042] In some embodiments, the present application provides use of a guide agRNA in the manufacture of a medicament for treating a disease in a subject in need thereof by altering the expression of a target protein or functional RNA in a cell of the subject, the cell having a pre-mRNA encoding the target protein, wherein the pre-mRNA comprises an intron, an exon flanked by a 5’ splice site of the intron, and an exon flanked by a 3’ splice site or a pseudo 3’ splice site of the intron; the guide agRNA is capable of binding to the pre-mRNA to form a structure capable of recruiting an ADAR in the cell, thereby forming a complex containing the ADAR protein.

[0043] In some embodiments, the guide agRNA is capable of recruiting the ADAR to the 3’ splice site or the pseudo 3’ splice site to edit the A base of the 3’ splice site or the pseudo 3’ splice site, thereby splicing out the entire exon flanked by the 3’ splice site or the pseudo 3’ splice site of the intron from the pre-mRNA to cause the exon skipping, to alter the level or sequence of a mature mRNA encoding the target protein, and to alter the expression level or function of the target protein in the cell.

[0044] In some embodiments, the target protein comprises LRRK2, APP, CFTR, UNC13A, MDM4, or Nav1.1 protein.

[0045] In some embodiments, the guide agRNA is unmodified or has a modification.

[0046] In some embodiments, the guide agRNA comprises a backbone modification, comprises a sugar modification, or comprises a base modification.

[0047] In some embodiments, the chemical modification is selected from LNA, UNA, 2’-MOE, 2’-F, 2’-OMe, 5mC, polyethylene glycol modification, or DNA base replacement modification.

[0048] In some embodiments, the polyethylene glycol modification is selected from a di-polyethylene glycol.

[0049] In some embodiments, the polyethylene glycol modified guide agRNA comprises two domains linked by a polyethylene glycol.

[0050] In some embodiments, the 5’ splice site has the consensus NNN / GUNNNN or NNN / GCNNNN motif.

[0051] In some embodiments, the 3’ splice site has the consensus N / AGN motif.

[0052] In some embodiments, the “N” is any base and “ / ” is the exon-intron boundary.

[0053] In some embodiments, the adenine in the 3’ splice site N / AGN sequence is edited by ADAR.

[0054] In some embodiments, the ADAR editing is ADAR-mediated A-to-I editing.

[0055] In some embodiments, the guide agRNA has at least one mismatch with the pre-mRNA.

[0056] In some embodiments, the base in the guide agRNA that binds to the A base of the 3’ splice site or pseudo 3’ splice site is one of C, A, G, or I, or a base derivative thereof.

[0057] In some embodiments, the guide agRNA forms a double stranded RNA with the pre-mRNA that is not perfectly base-paired.

[0058] In some embodiments, the imperfect base-pairing is a complementation with one or more mismatches, wobbles, deletions, and / or bulges in the targeted region.

[0059] In some embodiments, the complementary strands are base-paired at non-mismatched or non-deleted or non-bulged or non-looped or non-wobble base-pairing sites.

[0060] In some embodiments, the ratio of complementary base-pairing in the double-stranded RNA formed by the guide agRNA and the pre-mRNA is greater than 60%.

[0061] In some embodiments, the ratio of complementary base-pairing in the double-stranded RNA formed by the guide agRNA and the pre-mRNA is greater than 75%.

[0062] In some embodiments, the guide agRNA is capable of binding to the pre-mRNA to form a complex with an ADAR protein, and the editing efficiency of the pre-mRNA is greater than 1% after the binding.

[0063] In some embodiments, the position of the guide agRNA targeting the pre-mRNA is within a region of 1000 bp upstream to 1000 bp downstream relative to the 3' splice site.

[0064] In some embodiments, the position of the guide agRNA targeting the pre-mRNA is within a region of 500 bp upstream to 500 bp downstream relative to the 3' splice site.

[0065] In some embodiments, the position of the guide agRNA targeting the pre-mRNA is within a region of 100 bp upstream to 100 bp downstream relative to the 3' splice site.

[0066] In some embodiments, the sequence length of the guide agRNA is 10-300 bp.

[0067] In some embodiments, the sequence length of the guide agRNA is 20-150 bp.

[0068] In some embodiments, the sequence length of the guide agRNA is 25-100 bp.

[0069] In some embodiments, the sequence length of the guide agRNA is 30-70 bp.

[0070] In some embodiments, the sequence of the guide agRNA is selected from at least any one of the sequences set forth in SEQ ID NO: 2-3, SEQ ID NO: 10-14, SEQ ID NO: 22, SEQ ID NO: 30, SEQ ID NO: 43-44, SEQ ID NO: 52-53, SEQ ID NO: 54-56, SEQ ID NO: 58-60, or SEQ ID NO: 70-71.

[0071] In some embodiments, the sequence of the guide agRNA is selected from a combination of SEQ ID NO: 56 and SEQ ID NO: 70, or a combination of SEQ ID NO: 60 and SEQ ID NO: 71.

[0072] In some embodiments of the guide agRNA, the drug is a drug for treating amyotrophic lateral sclerosis, cystic fibrosis, Alzheimer's disease, Parkinson's disease, amyloid angiopathy, familial hemiplegic migraine-2, familial basal ganglia migraine, alternating hemiplegia of childhood, ataxia 2, familial hemiplegic migraine, spinocerebellar ataxia 6, mental retardation-23, 3p25 microdeletion syndrome, Fechtner- MacDermot syndrome, schizophrenia-15, neurofibromatosis, type 2, meningioma, NF2- associated, schwannomatosis 1, hereditary sensory neuropathy type IE, autosomal dominant cerebellar ataxia, deafness, and narcolepsy, Pitt Hopkins syndrome, Smith- Magenis syndrome, peroxisome biogenesis disorder la, Heimler syndrome-1, metachromatic leukodystrophy, vanishing white matter leukodystrophy, Aicardi-Goutieres syndrome 6, early infantile epileptic encephalopathy 4, progressive myoclonic epilepsy 5, familial infantile convulsions with paroxysmal kinesigenic choreoathetosis, paroxysmal kinesigenic dyskinesia 1, benign familial infantile convulsions 2, or generalized epilepsy with febrile seizures plus type 9.

[0073] In some embodiments, the present application provides a method of editing a target RNA in a host cell, comprising: introducing a construct comprising a nucleic acid encoding a guide agRNA into the host cell, wherein: (1) the host cell has a precursor mRNA encoding a target protein, wherein the precursor mRNA comprises an intron, an exon flanked by a 5' splice site of the intron, and an exon flanked by a 3' splice site or a pseudo 3' splice site of the intron; (2) the host cell is contacted with the guide agRNA; (3) the host cell contains ADAR, and the guide agRNA is capable of binding to the precursor mRNA to form a structure capable of recruiting ADAR in the cell, thereby forming a complex with ADAR protein.

[0074] In some embodiments, the guide agRNA is capable of recruiting ADAR to the 3' splice site or pseudo 3' splice site to edit the A base of the 3' splice site or pseudo 3' splice site, thereby splicing out the entire exon flanked by the 3' splice site or pseudo 3' splice site of the intron from the pre-mRNA, causing the exon to skip, thereby altering the level or sequence of the mature mRNA encoding the target protein, and altering the expression level or function of the target protein in the cell.

[0075] In some embodiments, the target protein comprises LRRK2, APP, CFTR, UNC13A, MDM4, or Navl.1 protein.

[0076] In some embodiments, the guide agRNA is unmodified or has a modification.

[0077] In some embodiments, the modification is selected from LNA, UNA, 2'-MOE, 2'-F, 2'- OMe, phosphorothioate modification, 5mC, polyethylene glycol modification, or DNA base substitution modification.

[0078] In some embodiments, the polyethylene glycol modification is selected from di-polyethylene glycol.

[0079] In some embodiments, the polyethylene glycol modified guide agRNA comprises two domains linked by a polyethylene glycol.

[0080] In some embodiments, the 5' splice site has a consensus NNN / GUNNNN or NNN / GCNNNN sequence.

[0081] In some embodiments, the 3' splice site has a consensus N / AGN sequence.

[0082] In some embodiments, the "N" is any base, and " / " is the exon-intron boundary.

[0083] In some embodiments, the adenine in the 3' splice site N / AGN sequence is edited by ADAR.

[0084] In some embodiments, the ADAR editing is ADAR-mediated A-to-I editing.

[0085] In some embodiments, the ADAR is selected from ADAR1 or ADAR2.

[0086] In some embodiments, the base in the guide agRNA that binds to the A base of the 3' splice site or pseudo 3' splice site is one of C, A, G, or I, or a base derivative thereof.

[0087] In some embodiments, the base of the guide agRNA that binds to the A base of the 3' splice site or pseudo 3' splice site is C or a base derivative thereof.

[0088] In some embodiments, the double stranded RNA formed by the guide agRNA and the pre-mRNA is a perfect complementary pairing or an imperfect complementary pairing.

[0089] In some embodiments, the imperfect base complementary pairing is a complementary pairing with one or more mismatches, wobbles, deletions, and / or bulges in the targeted region.

[0090] In some embodiments, the guide agRNA has at least one mismatch with the pre-mRNA.

[0091] In some embodiments, the complementary strands are base complementary paired at non-mismatched or non-deleted or non-bulged or non-internal loop or non-wobbled base pairing sites.

[0092] In some embodiments, the proportion of complementary paired bases in the double stranded RNA formed by the guide agRNA and the pre-mRNA is greater than 60%.

[0093] In some embodiments, the proportion of complementary paired bases in the double stranded RNA formed by the guide agRNA and the pre-mRNA is greater than 75%.

[0094] In some embodiments, the guide agRNA is capable of binding to the pre-mRNA to form a complex with an ADAR protein and editing the pre-mRNA with an editing efficiency greater than 1%.

[0095] In some embodiments, the guide agRNA targets a position of the pre-mRNA within a region of 1000 bp upstream to 1000 bp downstream relative to the 3' splice site.

[0096] In some embodiments, the guide agRNA targets a position of the pre-mRNA within a region of 500 bp upstream to 500 bp downstream relative to the 3' splice site.

[0097] In some embodiments, the guide agRNA targets a position of the pre-mRNA within a region of 100 bp upstream to 100 bp downstream relative to the 3' splice site.

[0098] In some embodiments, the sequence of the guide agRNA is 10-300 bp in length. In some embodiments, the sequence of the guide agRNA is 20-150 bp in length. In some embodiments, the sequence of the guide agRNA is 20-100 bp in length. In some embodiments, the sequence of the guide agRNA is 30-70 bp in length.

[0099] In some embodiments, the sequence of the guide agRNA is selected from at least any one of the sequences set forth in SEQ ID NO: 2-3, SEQ ID NO: 10-14, SEQ ID NO: 22, SEQ ID NO: 30, SEQ ID NO: 43-44, SEQ ID NO: 52-53, SEQ ID NO: 54-56, SEQ ID NO: 58-60, or SEQ ID NO: 70-71.

[0100] In some embodiments, the sequence of the guide agRNA is selected from a combination of SEQ ID NO: 56 and SEQ ID NO: 70, or a combination of SEQ ID NO: 60 and SEQ ID NO: 71.

[0101] In some embodiments, the present application provides a method of screening or designing a guide agRNA, comprising designing a guide agRNA capable of binding to a pre-mRNA of a target gene to form a structure capable of recruiting an ADAR in a cell, the pre-mRNA comprising an intron, an exon flanked by a 5’ splice site of the intron, and an exon flanked by a 3’ splice site or a pseudo 3’ splice site of the intron; the guide agRNA is capable of recruiting the ADAR to the 3’ splice site or the pseudo 3’ splice site to edit an A base of the 3’ splice site or the pseudo 3’ splice site; determining the results of the expression level of the gene, the percentage of exon or pseudo exon skipping, or the editing level of the exon or pseudo exon of the pre-mRNA of the target gene after editing; and screening the guide agRNA according to the results.

[0102] In some embodiments, the guide agRNA is capable of recruiting the ADAR to the 3’ splice site or the pseudo 3’ splice site to edit an A base of the 3’ splice site or the pseudo 3’ splice site, thereby splicing the entire exon flanked by the 3’ splice site or the pseudo 3’ splice site of the intron from the pre-mRNA to cause the exon to skip, thereby changing the level or sequence of the mature mRNA encoding the target protein, and changing the expression level or function of the target protein in the cell.

[0103] In some embodiments, the screening or designing method comprises the following steps: (1) transfecting a reporter plasmid of a target gene into a cell overexpressing ADAR gene; (2) transfecting a guide agRNA to be screened into the cell of step (1); (3) determining the expression of the target gene RNA, the percentage of exon or pseudo-exon skipping, or the editing level.

[0104] In some embodiments, in the determination of step (3), total RNA is extracted from the cell obtained after transfection of step (2), and cDNA is reverse transcribed from the total RNA, and the determination is performed again using the cDNA as a template.

[0105] In some embodiments, in order to measure the editing level of the editing site using the raw sequencing file obtained by Sanger sequencing, a software is used to analyze the peak values of A, T, G, and C of each base in the upstream and downstream regions of the editing site.

[0106] In some embodiments, the calculation method of the RNA editing level of the target gene is 100*(1-A peak value / A+T+C+G peak value sum).

[0107] In some embodiments, the software is EditR software.

[0108] In some embodiments, the determination of the percentage of exon or pseudo-exon skipping comprises: using the cDNA as a template, amplifying the target gene using a primer pair, and detecting the PCR product using agarose gel electrophoresis to analyze the gray scale of the result map.

[0109] In some embodiments, the calculation method of the percentage of exon or pseudo-exon skipping is: percentage of exon or pseudo-exon skipping = gray scale value of exon or pseudo-exon skipping gene / (gray scale value of exon or pseudo-exon skipping gene + gray scale value of exon or pseudo-exon containing gene).

[0110] In some embodiments, the determination step of the expression of the target gene RNA comprises: using the cDNA as a template, performing real-time quantitative PCR using a primer pair, and detecting the expression amount of the target gene exon or pseudo-exon containing gene, wherein the lower the expression amount, the higher the degree of exon or pseudo-exon skipping.

[0111] In some embodiments, the application provides a guide agRNA or a complementary sequence thereof used in the method.

[0112] In some embodiments, the sequence of the guide agRNA is selected from at least any one of the sequences set forth in SEQ ID NO: 2-3, SEQ ID NO: 10-14, SEQ ID NO: 22, SEQ ID NO: 30, SEQ ID NO: 43-44, SEQ ID NO: 52-53, SEQ ID NO: 54-56, SEQ ID NO: 58-60, or SEQ ID NO: 70-71.

[0113] In some embodiments, the sequence of the guide agRNA is selected from a combination of SEQ ID NO: 56 and SEQ ID NO: 70, or a combination of SEQ ID NO: 60 and SEQ ID NO: 71.

[0114] In some embodiments, the present application provides a pharmaceutical composition comprising the guide agRNA or its complementary sequence and a pharmaceutically acceptable excipient, diluent or carrier. BRIEF DESCRIPTION OF DRAWINGS

[0115] Figure 1 LRRK2 gene reporter plasmid map.

[0116] Figure 2 APP gene reporter plasmid map.

[0117] Figure 3 CFTR gene reporter plasmid map.

[0118] Figure 4 UNC13A gene reporter plasmid map.

[0119] Figure 5 LRRK2 gene reporter plasmid expression verification results.

[0120] Figure 6 APP gene reporter plasmid expression verification results.

[0121] Figure 7 CFTR gene reporter plasmid expression verification results.

[0122] Figure 8 UNC13A gene reporter plasmid expression verification results.

[0123] Figure 9 Endogenous MDM4 gene expression verification results.

[0124] Figure 10(A) APP gene RNA expression agarose gel electrophoresis detection results. (B) APP gene exon 17 skipping percentage results. (C) APP gene exon 17 containing gene expression results. (D) Editing efficiency of A base in AG sequence of 3' splice site of exon 17 of APP gene pre-mRNA results.

[0125] Figure 11 APP gene Sanger sequencing original map.

[0126] Figure 12 (A) APP gene RNA expression agarose gel electrophoresis detection results. (B) APP gene exon or pseudo-exon skipping percentage results.

[0127] Figure 13 (A) APP gene RNA expression agarose gel electrophoresis detection results. (B) APP gene exon 17 skipping percentage results. (C) APP gene exon 17 containing gene expression results. (D) Editing efficiency of A base in AG sequence of 3' splice site of exon 17 of APP gene pre-mRNA results.

[0128] Figure 14 APP gene Sanger sequencing original map.

[0129] Figure 15 (A) APP gene RNA expression agarose gel electrophoresis detection results. (B) APP gene exon 17 skipping percentage results. (C) APP gene exon 17 containing gene expression results. (D) Editing efficiency of A base in AG sequence of 3' splice site of exon 17 of APP gene pre-mRNA results.

[0130] Figure 16 APP gene Sanger sequencing original map.

[0131] Figure 17To detect the agRNA-mediated exon skipping effect targeting the 3' splice site of exon 41 of LRRK2. (A) The results of agarose gel electrophoresis detection of LRRK2 gene RNA expression. (B) The results of LRRK2 gene exon 41 skipping percentage. (C) The results of LRRK2 gene exon 41 containing gene expression. (D) The results of LRRK2 gene exon 41 skipping gene change fold. (E) The results of editing efficiency of A base in AG sequence of 3' splice site of exon 41 of LRRK2 gene pre-mRNA.

[0132] Figure 18 LRRK2 gene Sanger sequencing original map.

[0133] Figure 19 To detect the agRNA-mediated exon skipping effect targeting the 3' splice site of exon 23 of CFTR gene. (A) The results of agarose gel electrophoresis detection of CFTR gene RNA expression. (B) The results of CFTR gene exon 23 skipping percentage. (C) The results of CFTR gene exon 23 containing gene expression. (D) The results of editing efficiency of A base in AG sequence of 3' splice site of exon 23 of CFTR gene pre-mRNA.

[0134] Figure 20 CFTR gene Sanger sequencing original map.

[0135] Figure 21 To detect the agRNA-mediated exon skipping effect targeting the 3' splice site of exon 23 of CFTR gene. (A) The results of agarose gel electrophoresis detection of CFTR gene RNA expression. (B) The results of CFTR gene exon 23 skipping percentage. (C) The results of CFTR gene exon 23 containing gene expression. (D) The results of editing efficiency of A base in AG sequence of 3' splice site of exon 23 of CFTR gene pre-mRNA.

[0136] Figure 22 UNC13A gene Sanger sequencing original map.

[0137] Figure 23To detect the agRNA-mediated exon skipping effect of targeting the 3' splice site of exon 6 of the MDM4 gene. (A) Agarose gel electrophoresis detection results of MDM4 gene RNA expression. (B) MDM4 gene exon 6 skipping percentage results. (C) Results of the expression amount of the exon 6 containing gene of the MDM4 gene. (D) Editing efficiency results of the A base in the AG sequence of the 3' splice site of exon 6 of the pre-mRNA of the MDM4 gene.

[0138] Figure 24 MDM4 gene Sanger sequencing original map.

[0139] Figure 25 To detect the exon skipping effect of different structure agRNA targeting the 3' splice site of exon 41 of LRRK2. (A) Agarose gel electrophoresis detection results of LRRK2 gene RNA expression. (B) LRRK2 gene exon 41 skipping percentage results. (C) Results of the change fold of the LRRK2 gene exon 41 skipping gene. (D) Results of the expression amount of the exon 41 containing gene of the LRRK2 gene. (E) Editing efficiency results of the A base in the AG sequence of the 3' splice site of exon 41 of the pre-mRNA of the LRRK2 gene.

[0140] Figure 26 SCN1A expression vector map is shown. (A) pCAG-mSCNA-WPRE plasmid map. (B) pCMV(CAT)T7-SB100 plasmid map.

[0141] Figure 27 mSCN1A-Hela stable cell strain SCN1A gene transcription expression verification results are shown.

[0142] Figure 28 The function verification of agRNA targeting the 3' splice site of the pseudo-exon of the SCN1A gene is shown. (A) is the SCN1A gene transcription expression result. (B) is the percentage of SCN1A gene productive transcription product. (C) is the expression of SCN1A gene productive transcription product detected by fluorescence quantitative PCR. (D) is the expression of SCN1A gene non-productive transcription product detected by fluorescence quantitative PCR. (E) is the editing efficiency result. DETAILED DESCRIPTION

[0143] The technical solutions of the present application are further illustrated below by specific examples, which do not represent a limitation on the scope of protection of the present application. Some non-essential modifications and adjustments made by others according to the concept of the present application still fall within the scope of protection of the present application.

[0144] Certain definitions

[0145] In the present application, the term “RNA editing” generally refers to the regulation of RNA by editing the target RNA. In the present application, the purpose of RNA editing can be to change the base of the target RNA, or to regulate the expression of the target RNA. The editing of adenosine to inosine in the target RNA can be achieved by expressing specially designed RNA to recruit endogenous deaminase ADAR in cells.

[0146] In the present application, the term “guide agRNA”, also known as “ADAR guide RNA”, abbreviated as “agRNA”, generally refers to an artificially synthesized single-stranded or double-stranded oligonucleotide. The structure and binding site of the agRNA can be changed by modifying the agRNA. In the present application, the agRNA can be in a single-stranded form, and its function can be to complementarily pair with a specific sequence of the target RNA and edit it.

[0147] In the present application, the term “target RNA”, also known as “target RNA” or “Target RNA”, which can be used interchangeably in the present application, generally refers to RNA containing a target site. In the present application, the target RNA can be pre-mRNA, mRNA, rRNA, tRNA, lnc-RNA, snRNA, snoRNA, and microRNA, etc. Mutation of certain nucleotide sites can cause different types of functional differences in target RNA, such as abnormal splicing, alternative splicing of RNA, truncation, extension, and incorrect folding of protein, etc.

[0148] In the present application, the term “target site”, also known as “editing site”, which can be used interchangeably in the present application, generally refers to the site edited by agRNA in RNA editing. In the present application, the target site can be adenosine.

[0149] In the present application, the terms “complementary pairing”, “complementary”, and “pairing” can be used interchangeably, and generally refer to Watson-Crick or Hoogsteen base pairing between nucleotide units of nucleic acid molecules. In the present application, base pairing can refer to A-T, C-G, T*A / T, C*G / C. In the present application, complementary pairing can be complete complementary pairing, or there can be one or more bulges, wobbles, deletions, and / or mismatches between nucleic acid molecules. In the present application, agRNA can form a double-stranded complex with the target RNA by complementary pairing.

[0150] In the present application, the term "bulge" generally refers to a region where the bases upstream and downstream of the bulge are complementary to the target RNA strand and the corresponding two bases of the target RNA strand are contiguous. In the present application, the term "wobble" generally refers to a G-U pairing. In the present application, the term "deletion" generally refers to a region where the bases upstream and downstream of the deletion are contiguous and there are corresponding number of bases of the target RNA strand in the region of the deletion. In the present application, the term "mismatch" generally refers to a pair of nucleotides in a duplex RNA complex that are not a perfect base pair according to Watson-Crick base pairing rules. The type of mismatch can be one of A-A, A-G, A-C, U-U, U-C, G-G, G-A, C-A, C-C, C-U.

[0151] In the present application, the term "perfect complementarity" generally refers to the presence of only strict Watson-Crick or Hoogsteen base pairing between the nucleotide units of the nucleic acid molecules. Perfect complementarity is free of bulges, wobbles, deletions, and / or mismatches.

[0152] In the present application, the term "pseudo 3' splice site" generally has the same splice recognition sequence as a true splice site, but is not used in the splicing reaction. A pseudo 3' splice site has the same NAG / N motif as a 3' splice site, where N is any nucleotide, and / is the exon-intron boundary. The number of pseudo 3' splice sites is an order of magnitude greater than the number of true splice sites in the human genome, and are generally repressed by molecular mechanisms that are not yet fully understood. Activation of a pseudo 3' splice site is positively influenced by surrounding nucleotides that make the pseudo 3' splice site more similar to the optimal consensus sequence of a true splice site, YAG / G, where Y is C or U.

[0153] As used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a method" includes multiple methods, and reference to "the fragment" includes reference to one or more fragments and equivalents thereof known to those skilled in the art, and so forth.

[0154] The term "and / or," as used in a phrase such as "A and / or B" herein is intended to mean either A alone, B alone, or A and B together. For example, if a composition, combination, method, etc. is described as comprising (or including) components A, B, and / or C, the composition can comprise A alone; B alone; C alone; A and B together; A and C together; B and C together; or A, B, and C together.

[0155] It is further understood that where the term "comprising" is used in the description of individual embodiments, it is to be understood that the embodiments can alternatively be described using the language "consisting essentially of or "consisting of, as would be understood by one of ordinary skill in the art.

[0156] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as those commonly understood by one of ordinary skill in the art to which this disclosure pertains. Although many methods and reagents are similar or identical to those described herein, exemplary methods and materials are disclosed.

[0157] It is to be understood that this disclosure is not limited to the particular methodology, protocols, and reagents described herein and as such can vary. The terminology used herein is for the purpose of describing particular embodiments or aspects only and is not intended to limit the scope of this disclosure.

[0158] When the sequence listing is inconsistent with the sequence in the specification, the specification of this application prevails.

[0159] Herein, the blank control group refers to a group that is not transfected with agRNA.

[0160] Herein, pre-mRNA (precursor mRNA) refers to the primary transcription product produced during the process of gene transcription, which contains a mixed sequence composed of exon and intron sequences.

[0161] Herein, mature mRNA (mature mRNA) is a pre-mRNA molecule that has been processed during splicing. The intron sequence in the pre-mRNA is removed, while the exon sequence is connected together, generating a mature mRNA molecule that only contains the information required to encode proteins. This mature mRNA molecule can be translated into proteins, participating in the biological activities of cells.

[0162] Herein, "base derivative" refers to a modification on the base, for example, C base can be replaced by 5mC (5-methylcytosine) and the like.

[0163] Herein, LN represents a locked nucleic acid (LNA) modification, fN represents a 2'-F modification, mN represents a 2'-OMe modification, eN represents a 2'-MOE modification of the base, "*" represents a phosphorothioate bond, and L5mN represents a 5-methyl base modified by LNA.

[0164] In the following examples herein, the capital letter base N represents the base of DNA, and the lowercase letter base n represents the RNA base.

[0165] Herein, PEG2 refers to a PEG2 (dimeric ethylene glycol) modification, specifically refers to using PEG2 as a linker to connect the two bases upstream and downstream in the two bases of the agRNA.

[0166] Herein, unless otherwise specified, the sequence is from left to right 5'→3'. Patent application CN202410712187.1 is incorporated herein by reference in its entirety.

[0167] Example 1: Construction method of reporter plasmid of LRRK2, APP, CFTR and UNC13A genes

[0168] 1, Human LRRK2 gene report plasmid:

[0169] Using human genomic DNA as a template, three fragments of the LRRK2 gene were amplified by PCR, and homologous arms were added. The first fragment is located at the genomic site Human GRCh37 / hg19: chr12+:40728619-40729109; the second fragment is located at the genomic site Human GRCh37 / hg19: chr12+:40733946-40734406; and the third fragment is located at the genomic site Human GRCh37 / hg19: chr12+:40740405-40740875. The pcDNA3.1 vector was linearized by Nhe I and Hind III double digestion, and the three insertion fragments were connected together into the pcDNA3.1 vector by homologous recombination. The LRRK2 gene reporter plasmid map is shown in Figure 1 .

[0170] 2, Human APP gene report plasmid :

[0171] PCR to amplify three fragments of APP gene with homologous arms, the first fragment is located at the genomic site Human GRCh37 / hg19: chr21-: 27269736-27270135; the second fragment is located at the genomic site Human GRCh37 / hg19: chr21-: 27263884-27264330; the third fragment is located at the genomic site Human GRCh37 / hg19: chr21-: 27252861-27254232. Linearize pcDNA3.1 vector by double digestion with Nhe I and Hind III and use the method of homologous recombination to connect the above three insertion fragments together into pcDNA3.1 vector. The APP gene reporter plasmid map is shown in Figure 2 .

[0172] 3, Human CFTR gene report plasmid

[0173] PCR to amplify three fragments of CFTR gene with homologous arms, the first fragment is located at the genomic site Human GRCh37 / hg19: chr7+: 117267426-117267974; the second fragment is located at the genomic site Human GRCh37 / hg19: chr7+: 117282342-117282797; the third fragment is located at the genomic site Human GRCh37 / hg19: chr7+: 117292746-117293135. Linearize pcDNA3.1 vector by double digestion with Nhe I and Hind III and use the method of homologous recombination to connect the above three insertion fragments together into pcDNA3.1 vector. The CFTR gene reporter plasmid map is shown in Figure 3 .

[0174] 4, Human UNC13A gene report plasmid

[0175] PCR to amplify one fragment of UNC13A gene with homologous arms, the fragment is located at the genomic site Human GRCh37 / hg19: chr19-: 17752002-17753969. Linearize pcDNA3.1 vector by double digestion with Nhe I and Hind III and use the method of homologous recombination to connect the above insertion fragment into pcDNA3.1 vector. The UNC13A gene reporter plasmid map is shown in Figure 4 .

[0176] Example 2: Gene expression and RNA abnormal splicing verification of reporter plasmid

[0177] ​​HEK293T cells were inoculated in 24-well cell culture plates, and after 12 hours, the reporter plasmid of Example 1 was transfected into the cells with Lipofectamine 3000 reagent, 500 ng of plasmid was transfected per well. After 24 hours of plasmid transfection, the total RNA of the cells was extracted with FastPure Cell / Tissue Total RNA Isolation Kit (manufacturer: Novoprotein, catalog number: RC101-01) according to the instructions.

[0178] The RNA was then reverse transcribed to obtain cDNA using HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) (manufacturer: Novoprotein, catalog number: R312-02) according to the instructions. Then, using 2x Taq PCR StarMix (manufacturer: GenStar, catalog number: A012) kit according to the instructions, the LRRK2, APP, CFTR, UNC13A and MDM4 gene fragments were amplified respectively with cDNA as the template. The expression and splicing of the reporter gene RNA are shown in Figure 5 to Figure 9 The experimental results show that the gene reporter plasmid constructed in Example 1 can correctly express the corresponding gene fragments in cells, and can be effectively used in subsequent examples to verify the function of the agRNA designed in the application.

[0179] Example 3 agRNA-mediated RNA editing promotes the splicing jump of exon 17 in APP gene pre-mRNA

[0180] HEK293T-ADAR-OE cells were inoculated in 24-well cell culture plates, and after 12 hours, the reporter plasmid was transfected into the cells with Lipofectamine 3000 reagent, 500 ng of plasmid was transfected per well. After 8 hours of plasmid transfection, 20 pmol of agRNA (SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3) was transfected into the cells with Lipofectamine TM RNAiMAX. After 48 hours of agRNA transfection, the total RNA of the cells was extracted with FastPure Cell / Tissue Total RNA Isolation Kit (manufacturer: Novoprotein, catalog number: RC101-01) according to the instructions. Then, the RNA was reverse transcribed to obtain cDNA using HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) (manufacturer: Novoprotein, catalog number: R312-02) according to the instructions.

[0181] Objective gene RNA expression and splicing detection: using 2xTaq PCR StarMix (manufacturer: GenStar, product number: A012) kit according to the instructions, using cDNA as template, using Primer1-F and Primer1-R primers to amplify APP gene, and performing 2% agarose gel electrophoresis on the PCR product and exposing the gel for detection, then gray scale analysis of the result graph, calculate the percentage of exon or pseudo-exon skipping (exon or pseudo-exon skipping percentage = exon or pseudo-exon skipping gene gray value / (exon or pseudo-exon skipping gene gray value + exon or pseudo-exon inclusion gene gray value)) results as shown in Figure 10 A and 10B.

[0182] Real-time fluorescent quantitative PCR detection: using ChamQ SYBR qPCR Master Mix (manufacturer: Novozyme, product number: Q311-02) kit according to the instructions, using cDNA as template, using Primer2-F and Primer2-R primers for real-time fluorescent quantitative PCR detection of APP gene exon 17 inclusion gene expression (normalized to blank control group, calculate gene expression change fold), results as shown in Figure 10 C, the lower the exon 17 inclusion gene expression, the better the agRNA-induced exon 17 splicing skipping effect.

[0183] First-generation sequencing Sanger sample preparation: using 2xTaq PCR StarMix (manufacturer: GenStar, product number: A012) kit according to the instructions, using cDNA as template, using Primer3-F and Primer3-R primers to amplify APP gene, and performing Sanger sequencing on the PCR product, results as shown in Figure 10 D and Figure 11 .

[0184] Sanger data RNA editing level measurement: the raw sequencing file obtained by Sanger sequencing needs to measure the editing level of the editing site, the present application adopts EditR software (https: / / moriaritylab.shinyapps.io / editr_v10 / ) for calculation and analysis, which analyzes the peak value of each base A, T, G, C in the upstream and downstream region of the editing site, the calculation method of editing level is 100*(1-A peak value / A+T+C+G peak value sum), Sanger sequencing raw map as shown in Figure 11 .

[0185] Experimental results: as shown in Figure 10As shown, both agRNAs SEQ ID NO: 2 and SEQ ID NO: 3 targeting the 3’ splice site of exon 17 of the APP gene can induce the splicing jump of the 17th exon of the reporter gene in cells, and the effect is better than the ASO (SEQ ID NO: 1) disclosed in the prior art (reference: Jennifer L Chang, et al. Targeting Amyloid-β Precursor Protein, APP, Splicing with Antisense Oligonucleotides Reduces Toxic Amyloid-b Production. Mol Ther. 2018.). On the other hand, SEQ ID NO: 2 is a 2’-OME modification on the base opposite to the editing site based on SEQ ID NO: 3, so that SEQ ID NO: 2 cannot induce RNA editing. The experimental results show that the A base in the AG sequence of the 3’ splice site of the 17th exon of the APP gene pre-mRNA has an average editing efficiency of 10% after adding SEQ ID NO: 3, and the splicing jump of the 17th exon mediated by SEQ ID NO: 3 is significantly better than SEQ ID NO: 2 which cannot induce RNA editing, indicating that by ADAR-mediated RNA editing on the 3’ splice site of the exon, editing the A in the AG sequence to I base destroys the 3’ splice site, which can effectively improve the splicing jump of the exon in the pre-mRNA of the target gene, that is, the higher the efficiency of agRNA-mediated RNA editing, the better the effect of induced exon splicing jump.

[0186] Table 1

[0187]

[0188] Table 2 APP gene detection primer sequences

[0189] Primer name Primer sequence Primer 1-F (SEQ ID NO: 4) CGGAGGAGATCTCTGAAGTG Primer 1-R (SEQ ID NO: 5) CGATGGGTAGTGAAGCAATG Primer 2-F (SEQ ID NO: 6) TCATTGGACTCATGGTGGGC Primer 2-R (SEQ ID NO: 7) CTAGTTCTGCATCTGCTCAAAGAAC Primer 3-F (SEQ ID NO: 8) CTCATCCAAATGTCCCCTGC Primer 3-R (SEQ ID NO: 9) CAAGCATCATGGAAGCACAC

[0190] Example 4 Binding of ADAR protease promotes splicing jump of exon or pseudo-exon

[0191] HEK293T-ADAR-OE (ADAR1 gene overexpression) and HEK293T-ADAR-KO (ADAR1 gene knockout) cells were seeded in a 24-well cell culture plate, and after 12 hours, APP reporter plasmid was transfected into the cells using Lipofectamine 3000 reagent, 500 ng of plasmid was transfected per well. After 8 hours of plasmid transfection, 20 pmol of agRNA (SEQ ID NO: 10) was added to the culture medium using Lipofectamine 3000 reagent, and the cells were cultured for 48 hours. The cells were collected and the total RNA was extracted, and the splicing jump of the 17th exon of the reporter gene was detected by RT-PCR. TMThe agRNA was transfected into the cells. After 48 hours of transfection, the total RNA of the cells was extracted by FastPure Cell / Tissue Total RNA Isolation Kit (manufacturer: Norgen, product number: RC101-01) according to the instructions. Then the RNA was reversely transcribed to cDNA by HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) (manufacturer: Norgen, product number: R312-02) according to the instructions.

[0192] The APP gene was amplified by the Primer 1-F and Primer 1-R primers according to the detection method in Example 3, and the PCR product was subjected to 2% agarose gel electrophoresis and gel exposure detection. Then the gray scale analysis of the result map was performed, and the results are shown in Figure 12 A and 12B.

[0193] The experimental results: after the agRNA (SEQ ID NO: 10) was transfected into the cells, it could target and bind to the 3' splice site of exon 17 of the APP gene to form double-stranded RNA, and recruit ADAR proteinase to bind to the 3' splice site of exon 17 of the APP gene. However, because the base at the editing site and the editing site adjacent to the editing site targeted by SEQ ID NO: 10 has 2'-OME modification, the agRNA SEQ ID NO: 10 cannot induce RNA editing. As shown in Figure 12 The results show that the splicing jump effect of SEQ ID NO: 10 on exon 17 of the APP reporter gene in HEK293T-ADAR-OE cells is higher than that in HEK293T-ADAR-KO cells, indicating that the binding of ADAR proteinase to the 3' splice site can increase the splicing jump of the exon.

[0194] Table 3

[0195]

[0196] Example 5 agRNA targeting different regions mediating splicing jump of exon 17 in APP gene pre-mRNA

[0197] HEK293T-ADAR-OE cells were seeded in a 24-well cell culture plate, and after 12 hours, the reporter plasmid was transfected into the cells by Lipofectamine 3000 reagent, 500 ng of plasmid was transfected per well. After 8 hours of plasmid transfection, 20 pmol of agRNA was transfected into the cells by Lipofectamine 3000 reagent, and the transfection was performed according to the instructions. TMRNAiMAX was transfected into cells. 48 hours after transfection of agRNA, total RNA of cells was extracted by FastPure Cell / Tissue Total RNA Isolation Kit according to the instructions. Then RNA was reversely transcribed to cDNA by HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) according to the instructions.

[0198] The APP gene was amplified by Primer1-F and Primer1-R primer pair according to the detection method in Example 3, and the PCR product was subjected to 2% agarose gel electrophoresis and gel exposure detection. Then the gray scale analysis of the result map was carried out, and the results are shown in Figure 13 A and 13B. The expression amount of APP gene exon 17 containing gene was detected by real-time fluorescent quantitative PCR with Primer2-F and Primer2-R primer pair, and the results are shown in Figure 13 C. The APP gene was amplified by Primer3-F and Primer3-R primer pair, and the PCR product was subjected to Sanger sequencing, and the results are shown in Figure 13 D and Figure 14 .

[0199] The experimental results are shown in Figure 13 , agRNA targeting different regions of the 3' splice site of exon 17 of the APP gene (such as SEQ ID NO: 11-13) can induce RNA editing of the 3' splice site of exon 17 in pre-mRNA of the APP gene in cells, and can induce splicing skipping of exon 17 of the reporter gene, and the effect is better than that of the prior art ASO (SEQ ID NO: 1).

[0200] Table 4

[0201]

[0202]

[0203] Example 6 agRNA of different lengths mediating splicing skipping of exon 17 in pre-mRNA of APP gene

[0204] HEK293T-ADAR-OE cells were seeded in a 24-well cell culture plate, and 12 hours later, the reporter plasmid was transfected into the cells using Lipofectamine 3000 reagent, 500 ng of plasmid was transfected per well. 8 hours after plasmid transfection, 20 pmol of agRNA was transfected into the cells using Lipofectamine 3000 reagent, and the transfection was carried out according to the manufacturer's instructions. 48 hours after transfection, the total RNA of cells was extracted by FastPure Cell / Tissue Total RNA Isolation Kit according to the instructions. TMRNAiMAX was transfected into cells. 48 hours after transfection of agRNA, total RNA of cells was extracted by FastPure Cell / Tissue Total RNA Isolation Kit according to the instructions. Then RNA was reversely transcribed to cDNA by HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) according to the instructions.

[0205] The APP gene was amplified by Primer1-F and Primer1-R primer pairs according to the detection method in Example 3, and the PCR product was subjected to 2% agarose gel electrophoresis and gel exposure detection, and then the gray scale analysis of the result map was performed, and the results are shown in Figure 15 A and 15B. The expression amount of APP gene exon 17 containing gene was detected by real-time fluorescent quantitative PCR with Primer2-F and Primer2-R primer pairs, and the results are shown in Figure 15 C. The APP gene was amplified by Primer3-F and Primer3-R primer pairs, and the PCR product was subjected to Sanger sequencing, and the results are shown in Figure 15 D and Figure 16 .

[0206] The experimental results are shown in Figure 15 It can be seen that different lengths of agRNA targeting the 3' splice site of exon 17 of the APP gene (SEQ ID NO: 3, SEQ ID NO: 13 and SEQ ID NO: 14) can induce RNA editing of the 3' splice site of exon 17 in pre-mRNA of the APP gene in cells, and can induce splicing skipping of exon 17 of the reporter gene, and the effect is better than that of the prior art ASO (SEQ ID NO: 1).

[0207] Table 5

[0208]

[0209] Example 7 agRNA-mediated RNA editing promotes splicing skipping of exon 41 in pre-mRNA of LRRK2 gene

[0210] HEK293T-ADAR-OE cells were seeded in a 24-well cell culture plate, and 12 hours later, the reporter plasmid was transfected into the cells using Lipofectamine 3000 reagent, 500 ng of plasmid was transfected per well. 8 hours after plasmid transfection, 20 pmol of agRNA was transfected into cells using Lipofectamine 3000 reagent, and the transfection was performed according to the manufacturer's instructions. 48 hours after transfection, total RNA of cells was extracted by FastPure Cell / Tissue Total RNA Isolation Kit according to the instructions. Then RNA was reversely transcribed to cDNA by HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) according to the instructions. TMRNAiMAX was transfected into cells. After 48 hours of transfection of agRNA, total RNA of cells was extracted by FastPure Cell / Tissue Total RNA Isolation Kit according to the instructions. Then the RNA was reverse transcribed to obtain cDNA by HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) according to the instructions.

[0211] According to the detection method in Example 3, the LRRK2 gene was amplified by Primer4-F and Primer4-R primer pairs, and the PCR products were subjected to 2% agarose gel electrophoresis and gel exposure detection, and then the gray scale analysis of the result map was performed, and the results are shown in Figure 17 A and 17B. The expression amount of LRRK2 gene exon 41 inclusion gene was detected by real-time fluorescent quantitative PCR with Primer5-F and Primer5-R primer pairs, and the expression amount of LRRK2 gene exon 41 skipping gene was detected by real-time fluorescent quantitative PCR with Primer6-F and Primer5-R primer pairs, and the results are shown in Figure 17 C and 17D. The LRRK2 gene was amplified by Primer7-F and Primer7-R primer pairs, and the PCR products were subjected to Sanger sequencing, and the results are shown in Figure 17 E and Figure 18 .

[0212] Table 6 LRRK2 gene detection primer sequences

[0213]

[0214]

[0215] Experimental results: as shown in Figure 17 , the agRNA (SEQ ID NO: 22) targeting the 3' splice site of exon 41 of the LRRK2 gene can induce RNA editing of the 3' splice site of exon 41 in the pre-mRNA of the LRRK2 gene in cells, and can induce splicing skipping of exon 41 of the reporter gene, and the effect is better than the ASO (SEQ ID NO: 23) of the prior art (Reference: Joanna A Korecka, et al. Splice-Switching Antisense Oligonucleotides Reduce LRRK2 Kinase Activity in Human LRRK2 Transgenic Mice. Molecular therapy. 2020.).

[0216] Table 7

[0217]

[0218] Example 8 agRNA-mediated RNA editing promotes splicing of exon 23 in CFTR gene pre-mRNA

[0219] HEK293T-ADAR-OE cells were seeded in 24-well cell culture plates, and 12 hours later, reporter plasmid was transfected into cells with Lipofectamine 3000 reagent, 500 ng plasmid was transfected per well. 8 hours after plasmid transfection, 20 pmol of agRNA was transfected into cells with Lipofectamine RNAiMAX. 48 hours after agRNA transfection, total RNA of cells was extracted with FastPure Cell / Tissue Total RNA Isolation Kit according to the instructions. Then RNA was reversely transcribed to cDNA with HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) according to the instructions. TM RNAiMAX transfection into cells. 48 hours after agRNA transfection, total RNA of cells was extracted with FastPure Cell / Tissue Total RNA Isolation Kit according to the instructions. Then RNA was reversely transcribed to cDNA with HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) according to the instructions.

[0220] According to the detection method in Example 3, the CFTR gene was amplified with Primer 8-F and Primer 8-R primer pairs, and the PCR products were subjected to 2% agarose gel electrophoresis and gel exposure detection, and then the gray scale analysis of the result map was carried out, and the results are shown in Figures 8A and 8B. Figure 19 The expression amount of CFTR gene exon 23 containing gene was detected by real-time fluorescent quantitative PCR with Primer 9-F and Primer 9-R primer pairs, and the results are shown in Figures 9A and 9B. Figure 19 The CFTR gene was amplified with Primer 10-F and Primer 10-R primer pairs, and the PCR products were subjected to Sanger sequencing, and the results are shown in Figures 10A and 10B. Figure 19 D and Figure 20 D and

[0221] Table 8 CFTR gene detection primer sequences

[0222] Primer name Primer sequence Primer 8-F (SEQ ID NO: 24) GCGATCTGTGAGCCGAGTC Primer 8-R (SEQ ID NO: 25) CTTGATCACTCCACTGTTCATAGGGATC Primer 9-F (SEQ ID NO: 26) GGCCAAATGACTGTCAAAGATC Primer 9-R (SEQ ID NO: 27) CAAGACACACCATCGATCTG Primer 10-F (SEQ ID NO: 28) ATGGAGTCATGCAACAAGGTTTGAATGAATAAGT Primer 10-R (SEQ ID NO: 29) AGCCTATGAGAAAACTGCACTGGA

[0223] Experimental results: as Figure 19As shown, the agRNA targeting the 3' splice site of exon 23 of the CFTR gene (SEQ ID NO: 30) can induce RNA editing of the 3' splice site of exon 23 in the pre-mRNA of the CFTR gene in cells, can induce splicing skipping of exon 23 of the reporter gene, and the effect is better than the ASO (SEQ ID NO: 31) of the prior art (reference: Young Jin Kim, et al. Exon skipping antisense oligonucleotides for cystic fibrosis therapy. Proc Natl Acad Sci U S A. 2022.).

[0224] Table 9

[0225]

[0226] Example 9 agRNA-mediated RNA editing promotes splicing skipping of exon Exon20N in the pre-mRNA of UNC13A gene

[0227] HEK293T-ADAR-OE cells were seeded in 24-well cell culture plates, and 12 hours later, 20 pmol of control siRNA or siTDP-43 was transfected into the cells with Lipofectamine TM RNAiMAX; 36 hours after transfection of siRNA, the reporter plasmid was transfected into the cells with Lipofectamine 3000 reagent, 500 ng of plasmid was transfected per well. 8 hours after plasmid transfection, 20 pmol of agRNA was transfected into the cells with Lipofectamine TM RNAiMAX. 36 hours after transfection of agRNA, total RNA of the cells was extracted with FastPure Cell / Tissue Total RNA Isolation Kit according to the instructions. Then the RNA was reverse transcribed to obtain cDNA with HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) according to the instructions.

[0228] According to the detection method in Example 3, the UNC13A gene was amplified with Primer 11-F and Primer 11-R primers, and the PCR product was subjected to 2% agarose gel electrophoresis and the gel was exposed for detection, and the results were as follows Figure 21 A.

[0229] The expression amount of total mRNA of the TDP-43 gene was detected by real-time fluorescent quantitative PCR with the Primer15-F and Primer15-R primer pairs, and the results are shown in Figure 21 The expression amount of total mRNA of the UNC13A gene was detected by real-time fluorescent quantitative PCR with the Primer12-F and Primer12-R primer pairs, and the results are shown in Figure 21 C.

[0230] The expression amount of the pseudo-exon containing gene of the UNC13A gene was detected by real-time fluorescent quantitative PCR with the Primer13-F and Primer13-R primer pairs, and the results are shown in Figure 21 D. The UNC13A gene was amplified with the Primer14-F and Primer14-R primer pairs, and the PCR product was subjected to Sanger sequencing, and the results are shown in Figure 21 E and Figure 22 .

[0231] Table 10 UNC13A gene detection primer sequences

[0232] Primer name Primer sequence Primer 11-F (SEQ ID NO: 32) CTGACAAATCTGCCGTGTC Primer 11-R (SEQ ID NO: 33) GGGCTGTCTCATCGTAGTAAAC Primer 12-F (SEQ ID NO: 34) CTGACAAATCTGCCGTGTC Primer 12-R (SEQ ID NO: 35) GTGTACTGGACATGGTACGGG Primer 13-F (SEQ ID NO: 36) TGGATGGAGAGATGGAACCT Primer 13-R (SEQ ID NO: 37) GGGCTGTCTCATCGTAGTAAAC Primer 14-F (SEQ ID NO: 38) CATGCCACTTCCACTCACCA Primer 14-R (SEQ ID NO: 39) CTAGTTCCTGGGGATAAGAGTTC Primer 15-F (SEQ ID NO: 40) TCATCCCCAAGCCATTCAGG Primer 15-R (SEQ ID NO: 41) TGCTTAGGTTCGGCATTGGA

[0233] Experimental results: The UNC13A reporter plasmid is normally expressed and spliced in the HEK293T-ADAR-OE cell, but when the TDP-43 gene in the cell is knocked down by siRNA, the splicing of the UNC13A reporter gene in the pre-mRNA will be abnormal due to the absence of TDP-43 protein, and three forms of transcripts containing the pseudo-exon Exon20N in the mature mRNA will be expressed, as shown in Figure 21 A. The results show that the agRNA targeting the 3' splice site of the pseudo-exon of the UNC13A gene can induce RNA editing of the 3' splice site of the pseudo-exon in the pre-mRNA of the UNC13A gene in the cell, and can induce splicing skipping of the pseudo-exon of the reporter gene, and the agRNA SEQ ID NO: 43 and SEQ ID NO: 44 of the present application are better than the ASO (SEQ ID NO: 42) of the prior art (Reference: X Rosa Ma, et al. TDP-43 represses cryptic exon inclusion in the FTD-ALS gene UNC13A. Nature. 2022).

[0234] Table 11

[0235]

[0236] Example 10: agRNA-mediated RNA editing promotes splicing skipping of exon 6 in MDM4 gene pre-mRNA

[0237] Hela cells were seeded in 24-well cell culture plates, 20 pmol of agRNA was transfected into cells with Lipofectamine TM RNAiMAX 48 hours after transfection of agRNA. Total RNA of cells was extracted with FastPure Cell / Tissue Total RNA Isolation Kit according to the instructions. Then RNA was reversely transcribed to cDNA with HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) according to the instructions.

[0238] The expression of MDM4 gene was detected by real-time fluorescent quantitative PCR with Primer 17-F and Primer 17-R primer pair, and the results were shown in FIGS. 23A and 23B. The expression of exon 6 containing gene of MDM4 gene was detected by real-time fluorescent quantitative PCR with Primer 17-F and Primer 17-R primer pair, and the results were shown in FIGS. 23A and 23B. Figure 23 Figure 23 The MDM4 gene fragment was amplified with Primer 18-F and Primer 18-R primer pair, and the PCR product was subjected to Sanger sequencing, and the results were shown in FIGS. 24A and 24B. Figure 23 Figure 24

[0239] Table 12 MDM4 gene detection primer sequences

[0240] Primer Name Primer Sequence Primer 16-F (SEQ ID NO: 45) TCTGAGGTAGGCAGTGTGGG Primer 16-R (SEQ ID NO: 46) AGGTGCGCAAGGTGAAATGT Primer 17-F (SEQ ID NO: 47) GATGCTGCTCAGACTCTCGC Primer 17-R (SEQ ID NO: 48) TGCACTTTGCTTCAGTTGGTC Primer 18-F (SEQ ID NO: 49) GCTTTGTCCAGCCAACATGG Primer 18-R (SEQ ID NO: 50) GGGGCCACTCTGTACAACAA

[0241] Experimental results: as shown in FIGS. 22A and 22B, the expression of MDM4 gene was detected by real-time fluorescent quantitative PCR with Primer 16-F and Primer 16-R primer pair, and the results were shown in FIGS. 22A and 22B. Figure 23 ​​​As shown, agRNAs (SEQ ID NO: 52 and SEQ ID NO: 53) targeting the 3' splice site of exon 6 of the MDM4 gene can both induce RNA editing of the 3' splice site of exon 6 in the pre-mRNA of the endogenous MDM4 gene in cells, can both induce splicing skipping of exon 6 in the pre-mRNA of the endogenous MDM4 gene, and the effect is better than that of the prior art (reference: Michael Dewaele, et al. Antisense oligonucleotide-mediated MDM4 exon 6 skipping impairs tumor growth. J Clin Invest. 2016.) ASO (SEQ ID NO: 51).

[0242] Table 13

[0243]

[0244] Example 11 agRNAs of different structures mediate RNA editing to promote splicing skipping of exon 41 in the pre-mRNA of the LRRK2 gene

[0245] In order to verify the effect of agRNAs of different structures mediating RNA editing to regulate RNA splicing, several agRNAs of different structures were designed. SEQ ID NO: 54 and SEQ ID NO: 55 are a chemically modified oligonucleotide, comprising a first domain and a second domain, the first domain and the second domain are connected by a linker (Linker), for example, the common chemical structure PEG2. The first domain and the second domain can both target and bind to the pre-mRNA of the target gene, mediate ADAR proteinase-based RNA editing. SEQ ID NO: 56 and SEQ ID NO: 70 are a chemically modified oligonucleotide, SEQ ID NO: 56 is the first domain and SEQ ID NO: 70 is the second domain, the first domain and the second domain can form double-stranded RNA through an in vitro annealing program and target and bind to the pre-mRNA of the target gene, mediate ADAR proteinase-based RNA editing.

[0246] Hela cells were seeded in a 24-well cell culture plate, and after 12 hours, the reporter plasmid was transfected into the cells with Lipofectamine 3000 reagent, 500 ng of plasmid was transfected per well. After 8 hours of plasmid transfection, 100 pmol of agRNA was transfected into the cells with Lipofectamine 3000 reagent, and the transfection was performed according to the manufacturer's instructions. TMRNAiMAX was transfected into cells. After 48 hours of transfection of agRNA, total RNA of cells was extracted by FastPure Cell / Tissue Total RNA Isolation Kit according to the instructions. Then the RNA was reversely transcribed to cDNA by HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) according to the instructions.

[0247] The LRRK2 gene was amplified by Primer4-F and Primer4-R primer pairs according to the detection method in Example 3, and the PCR product was subjected to 2% agarose gel electrophoresis and gel exposure detection, and then the gray scale analysis of the result map was performed, and the results are shown in Figure 25 A and 25B. The expression amount of LRRK2 gene exon 41 inclusion gene was detected by real-time fluorescent quantitative PCR with Primer5-F and Primer5-R primer pairs, and the expression amount of LRRK2 gene exon 41 skipping gene was detected by real-time fluorescent quantitative PCR with Primer6-F and Primer5-R primer pairs, and the results are shown in Figure 25 C and 25D. The LRRK2 gene was amplified by Primer7-F and Primer7-R primer pairs, and the PCR product was subjected to Sanger sequencing, and the results are shown in Figure 25 E.

[0248] Experimental results: as shown in Figure 25 , the agRNA targeting the 3' splice site of exon 41 of LRRK2 gene can induce RNA editing of the 3' splice site of exon 41 in pre-mRNA of LRRK2 gene in cells, and can induce splicing skipping of exon 41 of the reporter gene.

[0249] Table 14

[0250]

[0251] Example 12 Functional verification of agRNA with different structures

[0252] To verify the function of agRNA with different structures, several agRNAs with different structures were designed. SEQ ID NO: 58 and SEQ ID NO: 59 are a chemically modified oligonucleotide comprising a first domain and a second domain, the first domain and the second domain being connected by a linker, for example, a common chemical structure PEG2. The first domain and the second domain can both target and bind to the pre-mRNA of the target gene and mediate ADAR protease-based RNA editing. SEQ ID NO: 60 and SEQ ID NO: 71 are a chemically modified oligonucleotide, wherein SEQ ID NO: 60 is the first domain and SEQ ID NO: 71 is the second domain. The first domain and the second domain can form double-stranded RNA through an in vitro annealing program and target and bind to the pre-mRNA of the target gene, mediating ADAR protease-based RNA editing.

[0253] comprising the steps of:

[0254] 1. Construction of mSCN1A-Hela stable cell strain and detection of gene expression

[0255] Construction of pCAG-mSCN1A-WPRE plasmid: The sequence of SCN1A gene in the SCN1A gene reporter plasmid of mouse origin was amplified by PCR and homologous arms were added to obtain an insertion fragment. The pCAG-WPRE was linearized by double digestion with NheI and SpeI, and the insertion fragment was connected to the vector by homologous recombination to obtain the pCAG-mSCNA-WPRE plasmid.

[0256] According to the conventional cell passage and transfection steps, the SCN1A expression vector pCAG-mSCNA-WPRE Figure 26 A) and pCMV(CAT)T7-SB100 Figure 26 B) plasmid were co-transfected into Hela cells. After 48 hours of transfection, G418 was added, and the medium was changed every two days. When there were no living cells in the untransfected group, the selection of Hela cell strain stably transfected with mouse SCN1A gene was completed, and the mSCN1A-Hela stable cell strain was obtained.

[0257] The obtained mSCN1A-Hela stable cell strain was inoculated in a 24-well cell culture plate, and after 12 hours, Lipofectamine TMRNAiMAX was used to transfect 20 pmol of positive drug ASO into cells. After transfecting ASO for 48 hours, total RNA of cells was extracted by FastPure Cell / Tissue Total RNA Isolation Kit (manufacturer: Norgen, catalog number: RC101-01) according to the instructions. Then the RNA was reverse transcribed to obtain cDNA by HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) (manufacturer: Norgen, catalog number: R312-02) according to the instructions. Then 2 x Taq PCR StarMix (manufacturer: GenStar, catalog number: A012) kit was used to perform PCR amplification with cDNA as template using primer pair Mouse-F: CCCTAAGAGCCTTATCACGATTT (SEQ ID NO: 61) and Mouse-R: TAACAGGGCATTCACAACCA (SEQ ID NO: 62) according to the instructions. The PCR product was subjected to 2% agarose gel electrophoresis and the gel was exposed for detection.

[0258] The results are shown in Figure 27 As shown, the mSCN1A-Hela stable cell strain can stably express the mouse SCN1A gene fragment, and there are two kinds of transcription products, respectively, a non-productive transcription product containing a pseudo-exon and a productive transcription product not containing a pseudo-exon. After treatment with a positive drug (SEQ ID NO: 63: LC*LA*LA*g*u*u*g*g*a*g*c*a*a*g*a*u*u*a*u*c*c*c*a*u*a*c*a*a*a*a*LT*LA*LG), the non-productive transcription product decreases and the productive transcription product significantly increases, indicating that the mSCN1A-Hela stable cell strain constructed by the present disclosure can be effectively used to verify the function of agRNA targeting the pseudo-exon of the mouse SCN1A gene.

[0259] 2. Verification of the function of agRNA targeting the 3' splice site of the pseudo-exon of the mouse SCN1A gene in Hela cells

[0260] The mSCN1A-Hela stable cell strain stably expressing the SCN1A gene was inoculated in a 24-well cell culture plate, and 100 pmol of agRNA was transfected into the cells using Lipofectamine TMRNAiMAX was transfected into cells. Forty-eight hours after transfection with agRNA, total RNA was extracted from the cells using the FastPure Cell / Tissue Total RNA Isolation Kit according to the manufacturer's instructions. Subsequently, the RNA was reverse transcribed into cDNA using the HiScript III 1st Strand cDNA Synthesis Kit (+gDNAwiper) according to the manufacturer's instructions. The expression of the SCN1A gene in cells and the editing of the SCN1A gene pre-mRNA target site were detected according to the method in Example 3.

[0261] Using the ChamQ SYBR qPCR Master Mix kit, following the manufacturer's instructions, real-time quantitative PCR was performed with cDNA as a template and MPRimmer1-F and MPRimmer1-R primer pairs to detect changes in the expression of SCN1A gene productive transcripts in cells transfected with mouse SCN1A gene reporter plasmids. Real-time quantitative PCR was performed with MPRimmer2-F and MPRimmer2-R primer pairs to detect changes in the expression of SCN1A gene non-productive transcripts. Using the 2×Taq PCR StarMix kit, following the manufacturer's instructions, pre-mRNA of the SCN1A gene in cells transfected with mouse SCN1A gene reporter plasmids was amplified with cDNA as a template and MPRimmer3-F and MPRimmer3-R primer pairs, and the editing efficiency of the target sites was detected.

[0262] Table 15 Primer sequences for detecting mouse SCN1A gene

[0263] Primer Name Primer Sequence MPrimer 1-F GGATGAGGGTGGTTGTGAAT (SEQ ID NO: 64) MPrimer 1-R TCATGATGGATGGAATTGCT (SEQ ID NO: 65) MPrimer 2-F CGATTTGAAGGGATGAGGGATAA (SEQ ID NO: 66) MPrimer 2-R GCATTCACAACCACCCATAATAAA (SEQ ID NO: 67) MPrimer 3-F ACGGAATGAACCGATGTCGT (SEQ ID NO: 68) MPrimer 3-R CAGCATCCTACACCAGGGTC (SEQ ID NO: 69)

[0264] Experimental results are as follows Figure 28 As shown, the results indicate that different agRNAs targeting the pseudoexon 3' splicing site of the SCN1A gene can induce RNA editing at the pseudoexon 3' splicing site in the pre-mRNA of the SCN1A gene in cells. Figure 28 E), all of which can induce the splicing skipping of SCN1A gene pseudoexons in cells ( Figure 28 A and Figure 28 B), increases the expression of the productive SCN1A gene ( Figure 28 C), reducing the expression of nonproductive SCN1A genes ( Figure 28 D). Some agRNAs are superior to existing ASO technologies (SEQ ID NO: 57).

[0265] (Reference: Zhou Han, et al. Antisense oligonucleotides increase Scn1a expression and reduce seizures and SUDEP incidence in a mouse model of Dravet syndrome. Sci Transl Med. 2020.).

[0266]

[0267] The embodiments of the present application are only illustrative examples, and are not intended to limit the embodiments of the present application. Any other changes, modifications, replacements, combinations and simplifications made without departing from the spirit and principles of the present application shall be equivalent replacement manners, and shall belong to the protection scope of the present application.

Claims

1. The use of guide agRNA in the preparation of a drug for altering the expression of a target protein in the cells of a subject, characterized in that, The cell has a precursor mRNA encoding the target protein, wherein the precursor mRNA comprises an intron, an exon located flanking the 5' splice site of the intron, and an exon located flanking the 3' splice site or pseudo-3' splice site of the intron. The guide agRNA can bind to the precursor mRNA to form a structure that can recruit ADAR within the cell, thereby forming a complex containing ADAR protein.

2. The application as described in claim 1, characterized in that, The guide agRNA can recruit ADAR to the 3' splice site or pseudo-3' splice site to edit the A base of the 3' splice site or pseudo-3' splice site, thereby splicing the entire exon located flanking the 3' splice site or pseudo-3' splice site of the intron from the precursor mRNA, causing the exon to skip, thereby changing the expression level or sequence composition of the mature mRNA encoding the target protein, and changing the expression level or function of the target protein in the cell; Preferably, the target protein includes LRRK2, APP, CFTR, UNC13A, MDM4, or Nav1.1 protein; Preferably, the guide agRNA is unmodified or modified; Preferably, the modification includes skeletal modification, sugar modification, or base modification; Preferably, the modification is selected from LNA, UNA, 2'-MOE, 2'-F, 2'-OMe, phosphate thioester modification, 5mC, polyethylene glycol modification, or DNA base substitution modification; Preferably, the polyethylene glycol modification is selected from polyethylene glycol; Preferably, the polyethylene glycol-modified guide RNA comprises two domains connected by polyethylene glycol. Preferably, the 5' splice site has a common NNN / GUNNNN or NNN / GCNNNN motif; Preferably, the 3' splice site has a common NAG / N motif; Preferably, the "N" is one of the bases A, U, G, and C, and " / " is an exon-intron boundary; Preferably, the adenine in the NAG / N sequence at the 3' splice site is edited by ADAR; Preferably, the ADAR editing is ADAR-mediated A-to-I editing; Preferably, the ADAR is selected from ADAR1 or ADAR2; Preferably, after the guide agRNA binds to the precursor mRNA to form a complex capable of recruiting ADAR, the A in the NAG / N at the 3' splice site of the precursor mRNA can be mutated to G. Preferably, the guide agRNA is either completely complementary or partially complementary to the precursor mRNA; Preferably, the incomplete base pairing is a complementary pairing with one or more mismatches, wobbles, deletions, and / or protrusions in the target region; Preferably, the guide agRNA has at least one mismatch with the precursor mRNA; Preferably, the base in the guide agRNA that binds to the A base of the 3' splice site or pseudo-3' splice site is one of C, A, G, or I or a derivative thereof; Preferably, the base of the guide agRNA that binds to the A base of the 3' splice site or pseudo-3' splice site is C or a base derivative thereof; Preferably, the guide agRNA and the precursor mRNA form an incompletely complementary double-stranded RNA.

3. The application as described in claim 1, characterized in that, The complementary strands are base-complementary pairs at non-mismatched, non-deleted, non-protruding, non-inner loop, or non-wobbly base-pairing sites. Preferably, the ratio of complementary base pairs in the double-stranded RNA formed by the guide agRNA and the precursor mRNA is greater than 60%. Preferably, the ratio of complementary base pairs in the double-stranded RNA formed by the guide agRNA and the precursor mRNA is greater than 75%. Preferably, the guide agRNA can bind to the precursor mRNA to form a complex linked to the ADAR protein, thereby editing the precursor mRNA with an editing efficiency greater than 1%.

4. The application as described in claim 1, characterized in that, The guide agRNA targets the precursor mRNA in a region 1000 bp upstream to 1000 bp downstream of the 3' splice site. Preferably, the guide agRNA targets the precursor mRNA in a region 500 bp upstream to 500 bp downstream of the 3' splice site; Preferably, the guide agRNA targets the precursor mRNA within a region 100 bp upstream to 100 bp downstream of the 3' splice site; Preferably, the guide agRNA has a sequence length of 10–300 bp; Preferably, the guide agRNA has a sequence length of 20–150 bp; Preferably, the guide agRNA has a sequence length of 25–100 bp; Preferably, the guide agRNA has a sequence length of 30–70 bp; Preferably, the sequence of the guide agRNA is selected from at least one of the sequences shown in SEQ ID NO: 2-3, SEQ ID NO: 10-14, SEQ ID NO: 22, SEQ ID NO: 30, SEQ ID NO: 43-44, SEQ ID NO: 52-53, SEQ ID NO: 54-56, SEQ ID NO: 58-60 or SEQ ID NO: 70-71; Preferably, the sequence of the guide agRNA is selected from the combination of SEQ ID NO: 56 and SEQ ID NO: 70, or from the combination of SEQ ID NO: 60 and SEQ ID NO: 71; Preferably, the drug is for the treatment of amyotrophic lateral sclerosis (ALS), cystic fibrosis, Alzheimer's disease, Parkinson's disease, amyloid angiopathy, familial hemiplegic migraine-2, familial basal migraine, childhood alternating hemiplegia, episodic ataxia type 2, familial hemiplegic migraine, spinocerebellar ataxia type 6, intellectual disability-23, 3p25 microdeletion syndrome, Philanthro-McDermid syndrome, schizophrenia-15, neurofibromatosis type 2, meningioma, NF2-related, schwannoma-1, hereditary sensory neuropathy type IE, and autosomal dominant syndrome. Somatocerebellar ataxia, deafness and narcolepsy, Peter Hopkins syndrome, Smith-Mageni syndrome, peroxisome biosynthesis disorder 1a, Heimler syndrome-1, metachromatic leukodystrophy, white matter loss leukoencephalopathy, Aicardi-Goutieres syndrome 6, early infantile epileptic encephalopathy 4, progressive myoclonic epilepsy 5, familial infantile seizures with paroxysmal choreoathetosis, paroxysmal kinetic dyskinesia 1, benign familial infantile epilepsy 2 or generalized epilepsy with febrile seizures plus type 9 drugs.

5. The use of guide agRNA in the preparation of a medicament for treating a disease in a subject by altering the expression of a target protein or functional RNA in the subject's cells, characterized in that, The cell has a precursor mRNA encoding the target protein, wherein the precursor mRNA comprises an intron, an exon located flanking the 5' splice site of the intron, and an exon located flanking the 3' splice site or pseudo-3' splice site of the intron. The guide agRNA can bind to the precursor mRNA to form a structure that can recruit ADAR in the cell, thereby forming a complex containing ADAR protein; Preferably, the guide agRNA is capable of recruiting ADAR to the 3' splice site or pseudo-3' splice site to edit the A base of the 3' splice site or pseudo-3' splice site, thereby splicing the entire exon located flanking the 3' splice site or pseudo-3' splice site of the intron from the precursor mRNA, causing the exon to skip, thereby changing the level or sequence of the mature mRNA encoding the target protein, and changing the expression level or function of the target protein in the cell; Preferably, the target protein includes LRRK2, APP, CFTR, UNC13A, MDM4, or Nav1.1 protein; Preferably, the guide agRNA is unmodified or modified; Preferably, the guide agRNA includes backbone modification, or contains backbone modification, sugar modification, or base modification; Preferably, the chemical modification is selected from LNA, UNA, 2'-MOE, 2'-F, 2'-OMe, thiophosphate modification, 5mC, polyethylene glycol modification, or DNA base substitution modification; Preferably, the polyethylene glycol modification is selected from polyethylene glycol; Preferably, the polyethylene glycol-modified guide RNA comprises two domains connected by polyethylene glycol. Preferably, the 5' splice site has a common NNN / GUNNNN or NNN / GCNNNN motif; Preferably, the 3' splice site has a common N / AGN motif; Preferably, the "N" is any base, and the " / " is an exon-intron boundary; Preferably, the adenine in the 3' splice site N / AGN sequence is edited by ADAR; Preferably, the ADAR editing is ADAR-mediated A-to-I editing; Preferably, the ADAR is selected from ADAR1 or ADAR2; Preferably, after the guide agRNA binds to the precursor mRNA to form a complex capable of recruiting ADAR, the A in the NAG / N at the 3' splice site of the precursor mRNA can be mutated to G. Preferably, the guide agRNA is either completely complementary or partially complementary to the precursor mRNA; Preferably, the incomplete base pairing is a complementary pairing with one or more mismatches, wobbles, deletions, and / or protrusions in the target region; Preferably, the guide agRNA has at least one mismatch with the precursor mRNA; Preferably, the base in the guide agRNA that binds to the A base of the 3' splice site or pseudo-3' splice site is one of C, A, G, or I or a derivative thereof; Preferably, the base of the guide agRNA that binds to the A base of the 3' splice site or pseudo-3' splice site is C or a base derivative thereof; Preferably, the guide agRNA and the precursor mRNA form an incompletely complementary double-stranded RNA; Preferably, the incomplete base pairing is a complementary pairing with one or more mismatches, wobbles, deletions, and / or protrusions in the target region; Preferably, the complementary chains are base-complementary pairs at non-mismatched, non-deleted, non-protruding, non-inner-loop, or non-wobbling base-pairing sites. Preferably, the ratio of complementary base pairs in the double-stranded RNA formed by the guide agRNA and the precursor mRNA is greater than 60%. Preferably, the ratio of complementary base pairs in the double-stranded RNA formed by the guide agRNA and the precursor mRNA is greater than 75%. Preferably, the guide agRNA can bind to the precursor mRNA to form a complex linked to the ADAR protein, and then edit the precursor mRNA with an editing efficiency greater than 1%. Preferably, the guide agRNA targets the precursor mRNA in a region 1000 bp upstream to 1000 bp downstream of the 3' splice site; Preferably, the guide agRNA targets the precursor mRNA in a region 500 bp upstream to 500 bp downstream of the 3' splice site; Preferably, the guide agRNA targets the precursor mRNA within a region 100 bp upstream to 100 bp downstream of the 3' splice site; Preferably, the guide agRNA has a sequence length of 10–300 bp; Preferably, the guide agRNA has a sequence length of 20–150 bp; Preferably, the guide agRNA has a sequence length of 25–100 bp; Preferably, the guide agRNA has a sequence length of 30–70 bp; Preferably, the sequence of the guide agRNA is selected from at least one of the sequences shown in SEQ ID NO: 2-3, SEQ ID NO: 10-14, SEQ ID NO: 22, SEQ ID NO: 30, SEQ ID NO: 43-44, SEQ ID NO: 52-53, SEQ ID NO: 54-56, SEQ ID NO: 58-60 or SEQ ID NO: 70-71; Preferably, the sequence of the guide agRNA is selected from the combination of SEQ ID NO: 56 and SEQ ID NO: 70, or from the combination of SEQ ID NO: 60 and SEQ ID NO: 71; Preferably, the drug is for the treatment of amyotrophic lateral sclerosis (ALS), cystic fibrosis, Alzheimer's disease, Parkinson's disease, amyloid angiopathy, familial hemiplegic migraine-2, familial basal migraine, childhood alternating hemiplegia, episodic ataxia type 2, familial hemiplegic migraine, spinocerebellar ataxia type 6, intellectual disability-23, 3p25 microdeletion syndrome, Philanthro-McDermid syndrome, schizophrenia-15, neurofibromatosis type 2, meningioma, NF2-related, schwannoma-1, hereditary sensory neuropathy type IE, and autosomal dominant syndrome. Somatocerebellar ataxia, deafness and narcolepsy, Peter Hopkins syndrome, Smith-Mageni syndrome, peroxisome biosynthesis disorder 1a, Heimler syndrome-1, metachromatic leukodystrophy, white matter loss leukoencephalopathy, Aicardi-Goutieres syndrome 6, early infantile epileptic encephalopathy 4, progressive myoclonic epilepsy 5, familial infantile seizures with paroxysmal choreoathetosis, paroxysmal kinetic dyskinesia 1, benign familial infantile epilepsy 2 or generalized epilepsy with febrile seizures plus type 9 drugs.

6. A method for editing target RNA in host cells, characterized in that, include: A construct containing a nucleic acid encoding agRNA is introduced into the host cell, wherein: (1) The host cell has a precursor mRNA encoding the target protein, wherein the precursor mRNA comprises an intron, an exon located flanking the 5' splice site of the intron, and an exon located flanking the 3' splice site or pseudo-3' splice site of the intron. (2) Contact the host cell with the guide agRNA; (3) The host cell contains ADAR, and the guide agRNA can bind to the precursor mRNA to form a structure that can recruit ADAR in the cell, thereby forming a complex with ADAR protein attached. Preferably, the guide agRNA is capable of recruiting ADAR to the 3' splice site or pseudo-3' splice site to edit the A base of the 3' splice site or pseudo-3' splice site, thereby splicing the entire exon located flanking the 3' splice site or pseudo-3' splice site of the intron from the precursor mRNA, causing the exon to skip, thereby changing the level or sequence of the mature mRNA encoding the target protein, and changing the expression level or function of the target protein in the cell; Preferably, the target protein includes LRRK2, APP, CFTR, UNC13A, MDM4, or Nav1.1 protein; Preferably, the guide agRNA is unmodified or modified; Preferably, the modification is selected from LNA, UNA, 2'-MOE, 2'-F, 2'-OMe, phosphate thioester modification, 5mC, polyethylene glycol modification, or DNA base substitution modification; Preferably, the polyethylene glycol modification is selected from polyethylene glycol; Preferably, the polyethylene glycol-modified guide RNA comprises two domains connected by polyethylene glycol. Preferably, the 5' splice site has a common NNN / GUNNNN or NNN / GCNNNN sequence; Preferably, the 3' splice site has a common N / AGN sequence; Preferably, the "N" is any base, and the " / " is an exon-intron boundary; Preferably, the adenine in the 3' splice site N / AGN sequence is edited by ADAR; Preferably, the ADAR editing is ADAR-mediated A-to-I editing; Preferably, the ADAR is selected from ADAR1 or ADAR2; Preferably, the base in the guide agRNA that binds to the A base of the 3' splice site or pseudo-3' splice site is one of C, A, G, or I or a derivative thereof; Preferably, the base of the guide agRNA that binds to the A base of the 3' splice site or pseudo-3' splice site is C or a base derivative thereof; Preferably, the guide agRNA and the precursor mRNA form a double-stranded RNA with either incomplete or complete complementary pairing; Preferably, the incomplete base pairing is a complementary pairing with one or more mismatches, wobbles, deletions, and / or protrusions in the target region; Preferably, the guide agRNA has at least one mismatch with the precursor mRNA; Preferably, the complementary chains are base-complementary pairs at non-mismatched, non-deleted, non-protruding, non-inner-loop, or non-wobbling base-pairing sites. Preferably, the ratio of complementary base pairs in the double-stranded RNA formed by the guide agRNA and the precursor mRNA is greater than 60%. Preferably, the ratio of complementary base pairs in the double-stranded RNA formed by the guide agRNA and the precursor mRNA is greater than 75%. Preferably, the guide agRNA can bind to the precursor mRNA to form a complex linked to the ADAR protein, and then edit the precursor mRNA with an editing efficiency greater than 1%. Preferably, the guide agRNA targets the precursor mRNA in a region 1000 bp upstream to 1000 bp downstream of the 3' splice site; Preferably, the guide agRNA targets the precursor mRNA in a region 500 bp upstream to 500 bp downstream of the 3' splice site; Preferably, the guide agRNA targets the precursor mRNA within a region 100 bp upstream to 100 bp downstream of the 3' splice site; Preferably, the guide agRNA has a sequence length of 10–300 bp; Preferably, the guide agRNA has a sequence length of 20–150 bp; Preferably, the guide agRNA has a sequence length of 20–100 bp; Preferably, the guide agRNA has a sequence length of 30–70 bp; Preferably, the sequence of the guide agRNA is selected from at least one of the sequences shown in SEQ ID NO: 2-3, SEQ ID NO: 10-14, SEQ ID NO: 22, SEQ ID NO: 30, SEQ ID NO: 43-44, SEQ ID NO: 52-53, SEQ ID NO: 54-56, SEQ ID NO: 58-60 or SEQ ID NO: 70-71; Preferably, the sequence of the guide agRNA is selected from the combination of SEQ ID NO: 56 and SEQ ID NO: 70, or from the combination of SEQ ID NO: 60 and SEQ ID NO:

71.

7. A method for screening or designing guide RNA, characterized in that, This includes designing guide agRNAs capable of binding to precursor mRNAs of a target gene to form structures that recruit ADARs within cells. The precursor mRNA comprises introns, exons flanking the 5' splice site of the introns, and exons flanking the 3' splice site or pseudo-3' splice site of the introns. The guide agRNA is capable of recruiting ADARs to the 3' splice site or pseudo-3' splice site and editing the A bases at the 3' splice site or pseudo-3' splice site. The results include determining the expression level of the gene contained in the exons or pseudo-exons of the edited precursor mRNA, the percentage of exon or pseudo-exon skipping, or the level of editing. The guide agRNAs are then screened based on these results. Preferably, the guide agRNA is capable of recruiting ADAR to the 3' splice site or pseudo-3' splice site to edit the A base of the 3' splice site or pseudo-3' splice site, thereby splicing the entire exon located flanking the 3' splice site or pseudo-3' splice site of the intron from the precursor mRNA, causing the exon to skip, thereby changing the level or sequence of the mature mRNA encoding the target protein, and changing the expression level or function of the target protein in the cell; Preferably, the screening or design method includes the following steps: (1) Transfect the target gene reporter plasmid into cells overexpressing the ADAR gene; (2) Transfect the guide agRNA to be screened into the cells of step (1) for transfection; (3) Determine the expression, exon or pseudoexon skipping percentage, or editing level of the target gene RNA; Preferably, in step (3), the total RNA of the cells obtained after transfection in step (2) is extracted, the total RNA is reverse transcribed to obtain cDNA, and the cDNA is used as a template for further determination. Preferably, the editing level of the target gene RNA is measured using the raw sequencing file obtained by Sanger sequencing, and software is used to analyze the peak values ​​of A, T, G, and C for each base in the upstream and downstream regions of the editing site. Preferably, the method for calculating the RNA editing level of the target gene is 100*(1-A peak value / sum of A+T+C+G peak values); Preferably, the software is EditR software; Preferably, the determination of the exon or pseudo-exon skipping percentage includes: Using the cDNA as a template, the target gene was amplified using primer pairs. The PCR products were detected by agarose gel electrophoresis, and the grayscale of the results was analyzed. Preferably, the calculation method for the exon or pseudo-exon jumping percentage is as follows: exon or pseudo-exon jumping percentage = gray value of jumping gene in exon or pseudo-exon / (gray value of jumping gene in exon or pseudo-exon + gray value of gene contained in exon or pseudo-exon; Preferably, the step of determining the expression of the target gene RNA includes: Using the cDNA as a template, real-time quantitative PCR was performed using primer pairs to detect the expression level of genes contained in the exons or pseudoexons of the target gene. The lower the expression level, the higher the degree of exon or pseudoexon skipping.

8. A guide agRNA or its complementary sequence used in any of the applications of claims 1-5 or in the method of claim 7.

9. A guide RNA, characterized in that, It includes at least one of the sequences shown in SEQ ID NO: 2-3, SEQ ID NO: 10-14, SEQ ID NO: 22, SEQ ID NO: 30, SEQ ID NO: 43-44, or SEQ ID NO: 52-53, SEQ ID NO: 54-56, SEQ ID NO: 58-60 or SEQ ID NO: 70-71; Preferably, the sequence of the guide agRNA is selected from the combination of SEQ ID NO: 56 and SEQ ID NO: 70, or from the combination of SEQ ID NO: 60 and SEQ ID NO:

71.

10. A pharmaceutical composition, characterized in that, It comprises the guide agRNA as described in claim 9 or its complementary sequence and a pharmaceutically acceptable excipient, diluent or carrier.

Images