Detection primer, probe and detection method for gene II type grass carp reovirus
By designing specific primers and probes for droplet digital PCR technology, the problem of absolute quantification of genotype II grass carp reovirus was solved, achieving accurate quantitative detection of GCRV-II. This technology is applicable to all stages of grass carp farming and improves the sensitivity and applicability of the detection.
Patent Information
- Application Number
- CN202511650760.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-12
- Publication Date
- 2026-01-16
AI Technical Summary
Existing methods for detecting genotype II grass carp reovirus cannot meet the requirement of absolute quantification of virus titers, especially in the quarantine of parent stock and fry, as well as in the quantitative counting of viruses in water bodies, and are not suitable for the detection of variant strains.
Specific primers and probes were designed, and combined with droplet digital PCR technology, the absolute quantitative detection of GCRV-II was achieved by optimizing reaction conditions. Primers and probes were designed using the S6 segment, and primer applicability was considered to avoid probe dimer formation. RT-ddPCR method was used for detection.
It achieves accurate quantitative detection of GCRV-II, capable of detecting viruses down to a single copy, applicable to all stages of grass carp hemorrhagic disease, improving detection sensitivity and specificity, and meeting the detection needs of variant strains.
Smart Images

Figure CN121344263A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the detection technology of genotype II grass carp reovirus, specifically to the detection primers and probes and detection methods for genotype II grass carp reovirus. Background Technology
[0002] Grass carp reovirus type II (GCRV-II) is the main pathogen of grass carp hemorrhagic disease. This disease breaks out on a large scale every year in major grass carp farming areas, with a high mortality rate (20%–80%), severely restricting intensive grass carp farming. Grass carp hemorrhagic disease is classified as a Class II animal disease, characterized by high infectivity and lethality, causing hundreds of millions of yuan in economic losses to the grass carp farming industry annually.
[0003] Accurate diagnosis is one of the important means of preventing and controlling animal diseases. At present, the main detection methods for GCRV-II include virus isolation and identification, multiplex PCR, nested PCR, real-time PCR, and RPA. Although these methods can detect the virus, they cannot meet the requirement of absolute quantification of virus titer and have certain limitations in the quarantine of parent and seedlings as well as the quantitative counting of viruses in water bodies.
[0004] Droplet digital PCR (ddPCR) is a new technology further developed from PCR and qPCR. It disperses the template-containing reaction system into tens of thousands of nanodroplets using a water-in-oil emulsion method. Each droplet is a reaction unit, and PCR amplification occurs independently within each unit. By detecting the fluorescence signal at the end of the PCR amplification reaction, the copy number of the pathogen is statistically calculated based on the Poisson distribution principle, achieving absolute quantitative detection of the pathogen. Droplet digital PCR can achieve absolute quantification of target nucleic acid fragments without the need for standards or standard curve plotting, and has advantages such as high sensitivity, strong specificity, and resistance to interference. Currently, this technology has been applied in many fields, such as food safety, water quality monitoring, and the detection of animal and plant pathogens such as dengue fever, brucellosis, African swine fever, H5 subtype avian influenza, and potato virus.
[0005] Studies have shown that the GCRV-II genome contains 11 double-stranded RNAs encoding 11 proteins, among which the S6 segment encodes the VP4 protein, which has NTPase and RTPase activities and can interact with the non-structural protein NS79 to participate in the formation of inclusion bodies. It is an important cofactor in the viral genome replication process. Summary of the Invention
[0006] In view of this, the first objective of this invention is to propose a detection primer and probe for genotype II grass carp reovirus. Based on the S6 segment of GCRV-II virus and the corresponding gene sequences of GCRV-I and GCRV-III, a phylogenetic tree was constructed using MAGE 11.0 software, and specific primers were mainly designed using the S6 segment. Furthermore, primers (JX02M-F and JX02M-R) and probe (JX02M-probe) for the S7 segment were used as controls. The optimal primer and probe set was evaluated by comparing the amplification efficiency of each primer and probe set for GCRV-II.
[0007] The second objective of this invention is to provide a detection kit comprising the aforementioned primers and probes. When used to detect genotype II grass carp reovirus, it can determine the absolute number of target molecules down to a single copy without relying on Ct values or internal reference genes, offering low cost and high practicality.
[0008] Therefore, the third objective of this invention is to provide a method for detecting genotype II grass carp reovirus.
[0009] This invention references the S6 segment gene sequence of GCRV-II in NCBI, selects conserved regions as target genes, designs multiple primer pairs and probes, and optimizes the reaction to finally determine an RT-ddPCR detection method. This method can accurately quantify GCRV-II, which is beneficial for strengthening the detection of GCRV-II in all stages such as fertilized eggs, seedlings, breeding, and sales. It can provide technical support for research on the prevalence of grass carp hemorrhagic disease and the transmission routes of GCRV-II.
[0010] The key to this invention lies in the design of the primers and probes. To address the issue of primer applicability to different mutant strains, the second base at the 3′ end of GCRV-S6-R3 is designed as a degenerate base "Y". To prevent the probe from forming dimers, the "C" at the 5′ end of the probe is changed to "G". Experiments have confirmed that the modified primers and probes do not affect the amplification efficiency and specificity of ddPCR, and that these primers have higher applicability for detecting mutant strains. Attached Figure Description
[0011] Figure 1 This invention constructs a phylogenetic tree based on the S6 segment DNA sequence of GCRV-II; Figure 2 The sequence alignment analysis results of the primers GCRV-S6-F3 and GCRV-S6-R3 and the probe GCRV-S6-P3 of this invention; Figure 2 In the middle, A represents GCRV-S6-F3; Figure 2 B in the middle indicates GCRV-S6-P3; Figure 2In the text, C represents GCRV-S6-R3; Figure 3 The amplification efficiency of ddPCR at different annealing temperatures; Figure 4 The amplification efficiency of ddPCR with different probe concentrations; Figure 5 The amplification efficiency of ddPCR with different primer concentrations; Figure 6 To improve the sensitivity of ddPCR detection of GCRV-II; Figure 7 To ensure the specificity of the ddPCR detection method; Figure 8 To detect the copy number of GCRV-II in different grass carp tissue samples using ddPCR. Detailed Implementation
[0012] To enable those skilled in the art to understand the present invention more clearly and intuitively, the present invention will be further described below with reference to the accompanying drawings.
[0013] 1. Materials and Methods 1.1 Materials 1.1.1 Sample Source Both GCRV-I and GCRV-II viruses and their nucleic acids (cDNA) are preserved in this laboratory. Positive nucleic acids for carp edema virus (CEV), koi herpesvirus (KHV), crucian carp hematopoietic organ necrosis virus 2 (CyHV-2), infectious spleen and kidney necrosis virus (ISKNV), and red sea bream iridovirus (RSIV), as well as nucleic acids for pathogens such as Aeromonas hydrophila, Aeromonas vesiculosus, Flavobacterium columnare, and Flavobacterium psychrophilum, are also preserved in this laboratory.
[0014] 1.1.2 Main Reagents RNA extraction kit, one-step genomic cDNA first-strand synthesis premix reagent, and 2×PerfectStart ⅡProbe qPCR SuperMix UDG were all purchased from Beijing TransGen Biotech Co., Ltd.; ddPCR Supermix for Probes (No dUTP) and droplet generation oil were products of Bio-Rad; primers and probes were synthesized by Guangzhou Aiji Biotechnology Co., Ltd.
[0015] 1.1.3 Main Instruments The QX200 digital PCR system, PX1 96-well plate sealer, and PCR instrument were all manufactured by Bio-Rad; the ABI 7500 real-time PCR instrument was manufactured by Applied Biosystems (ABI).
[0016] 1.1.4 Primer and probe design Based on the S6 segment of GCRV-II virus and the corresponding gene sequences of GCRV-I and GCRV-III types, a phylogenetic tree was constructed using MAGE 11.0 software (e.g., Figure 1 (As shown). Specific primers for the S6 segment were primarily selected, while primers (JX02M-F and JX02M-R) and probe (JX02M-probe) for the S7 segment were used as controls (Patent Publication No. CN109971890A: Droplet Digital PCR Detection Kit for Type II Grass Carp Reovirus and its Dedicated Primers and Probes). The optimal primer and probe sets were evaluated by comparing the amplification efficiency of each primer and probe set for GCRV-II.
[0017] 1.2 Methods 1.2.1 Preparation of Clinical Samples The clinical samples used in this study were collected from grass carp hemorrhagic disease samples (artificial and natural infection) in Guangdong Province. Tissue samples from grass carp liver, spleen, kidney, muscle, intestine, skin, gills, and brain were collected, RNA was extracted, and cDNA was prepared by reverse transcription.
[0018] 1.2.2 Establishment of ddPCR method The reaction system was prepared according to the instructions of the 2×ddPCR Supermix for Probes (No dUTP), with a negative control (RNA from fish tissue or cells clearly free of GCRV-II infection) and a blank control (sterile ddH2O). After the 20 μL ddPCR reaction mixture generated droplets, it was transferred to a 96-well plate and placed in a PCR instrument for amplification. After the reaction was complete, the plate was placed in a droplet analyzer, and the results were read and analyzed. The ddPCR reaction system (Table 1) and reaction procedure are shown in Table 2.
[0019] Table 1. Probe method premixed liquid reaction system
[0020] Table 2 ddPCR reaction program (including annealing temperature optimization)
[0021] 1.2.3 Optimization of reaction conditions Using GCRV-II reverse transcribed cDNA as a template, the reaction conditions for ddPCR were optimized, mainly including probe concentration, primer concentration, and annealing temperature.
[0022] Annealing temperatures were set at 63℃, 62.5℃, 61.5℃, 59.7℃, 57.6℃, 55.8℃, and 54.6℃, respectively. The most recent annealing temperature was analyzed by ddPCR.
[0023] The probe concentrations were set to 150, 200, 250, and 300 nmol / L, respectively, and the optimal probe concentration was determined by ddPCR.
[0024] After optimizing the probe concentration, the primer concentrations were set to 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, and 1200 nmol / L, respectively, and the optimal primer concentrations were determined by ddPCR.
[0025] 1.2.4 Sensitivity Detection Analysis The reverse transcribed cDNA of GCRV-II was serially diluted 2-fold, for a total of 10 gradients. Negative and blank controls were also included, and the sensitivity of the optimized ddPCR detection of GCRV-II was analyzed.
[0026] 1.2.5 Specificity Detection Using optimized ddPCR conditions, we detected Carp Edema Virus (CEV), Koi Herpesvirus (KHV), Cyprinid Herpesvirus 2 (CyHV-2), Infectious Spleen and Kidney Necrosis Virus (ISKNV), Largemouth Bass Virus (LMBV), Channel Catfish Virus (CCV), Aeromonas hydrophila, Aeromonas vesiculosus, Flavobacterium columnare, Flavobacterium psychrophilum, negative control, GCRV-II, and GCRV-I, and analyzed the specificity of the ddPCR established in this study.
[0027] 1.3 Applications in the detection of clinical samples The established ddPCR method was used to perform ddPCR and qPCR detection on 12 grass carp tissue samples that were naturally infected and artificially infected with GCRV-II, respectively, to analyze the reliability of the ddPCR method in clinical samples.
[0028] 2.1 Results 2.1 Primer Design Based on the sequence conservation of GCRV-II, the S6 segment (VP4) and S7 segment (VP56) were selected as target genes to design primers for constructing ddPCR specific primers (Table 3).
[0029] The specificity and sensitivity of each primer and probe cassette in amplifying GCRV-II were analyzed by ddPCR, and the optimal primer and probe combination was finally screened out, namely primers GCRV-S6-F3 / GCRV-S6-R3 and probe GCRV-S6-P3. The sequence alignment analysis results of primers GCRV-S6-F3 / GCRV-S6-R3 and probe GCRV-S6-P3 are as follows: Figure 2 As shown. Furthermore, in the design of the primers and probes described above, to address the issue of primer adaptation to different mutant strains, the second base at the 3′ end of GCRV-S6-R3 was designed as a degenerate base "Y"; to avoid the probe itself forming a dimer, the "C" at the 5′ end of the probe was modified to "G" (…). Figure 2 Experiments have confirmed that the modified primers and probes do not affect the amplification efficiency and specificity of ddPCR, and that these primers have greater applicability for detecting variant strains.
[0030] Table 3. Design of ddPCR primers and probes based on GCRV-II S6 and S7 segments.
[0031] 2.2 Optimal Annealing Temperature Analysis of ddPCR annealing temperature showed that the highest positive copy number was achieved at an annealing temperature of 59.7℃. Therefore, the optimal annealing temperature for ddPCR is 59.7℃. Figure 3 ).
[0032] 2.3 Optimal probe concentration ddPCR probe concentration analysis showed that when the probe concentration was 150, 200, 250, and 300 nmol / L, the positive copy numbers were 529, 550, 568, and 559 copies / μL, respectively, indicating that the optimal probe concentration was 250 nmol / L. Figure 4 ).
[0033] 2.4 Optimal Primer Concentration The optimal annealing temperature and probe concentration were selected, and primer concentrations were set to 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, and 1200 nmol / L, respectively. The optimal primer concentration was determined by ddPCR. The results showed that the highest positive copy number (561 copies / μL) was achieved at a primer concentration of 1100 nmol / L, indicating that the optimal primer concentration was 1100 nmol / L. Figure 5 ).
[0034] 2.5 Sensitivity Analysis The sensitivity results of ddPCR detection of GCRV-II showed that the detection limit of this technique was 1.7 copies / μL. Figure 6 ).
[0035] 2.6 Specificity Analysis The specific detection results of ddPCR showed that the method was negative for CEV, KHV, CyHV-2, ISKNV, LMBV, CCV, Aeromonas hydrophila, Aeromonas vesiculosus, Flavobacterium columnare, Flavobacterium psychrophilum, and GCRV-Ⅰ, and the negative control was also negative. Only the positive control GCRV-Ⅱ was positive. Figure 7 This indicates that the detection method has high specificity.
[0036] 2.7 Clinical Application of ddPCR Detection Method In clinical samples of grass carp, ddPCR testing revealed a 100% GCRV-II positivity rate. Figure 8 (as shown in Table 4), however, the positive rate of qPCR was 75%, mainly due to the failure of qPCR to obtain Ct values in samples with low GCRV-II copy numbers. However, ddPCR was still able to detect positive copy numbers even in extremely low GCRV-II copy numbers, demonstrating that ddPCR has extremely high sensitivity and reliability in absolute quantification.
[0037] Table 4 Comparative analysis of ddPCR and qPCR detection of clinical samples
[0038] The above description of the embodiments is provided to enable those skilled in the art to understand and apply the present invention. It will be apparent to those skilled in the art that various modifications can be made to these embodiments, and the general principles described herein can be applied to other embodiments without inventive effort. Therefore, the present invention is not limited to the embodiments described herein, and any improvements and modifications made to the present invention by those skilled in the art based on the disclosure thereof should be within the scope of protection of the present invention.
Claims
1. A detection primer and probe for grass carp reovirus type II, characterized in that, It comprises: GCRV-S6-F3: 5'-GGCTAAGGTTACTCCTGCATTGC-3'; GCRV-S6-R3: 5'- CAGTGGTGACCAAAGTGTTGAG Y T-3' GCRV-S6-P3: 5'-fluorescent group-GGTAAACCACTTAGTGCGGAGA-quenching group-3'.
2. The detection primer and probe of the grass carp reovirus type II according to claim 1, characterized in that, The fluorescent group is FAM or VIC, and the quenching group is BHQ-1.
3. A detection kit for grass carp reovirus type II, characterized in that, The detection primer and probe of the grass carp reovirus type II gene in claim 1 or 2 are included.
4. The detection kit of grass carp reovirus type II according to claim 3, characterized in that, It also includes positive and negative controls.
5. The kit for detecting grass carp reovirus type II according to claim 3, characterized in that, The primer concentration is 1100 nmol / L.
6. The detection kit of grass carp reovirus type II according to claim 3, characterized in that, The probe concentration is 250 nmol / L.
7. The detection primer and probe of the grass carp reovirus type II gene in claim 1 or 2 are used for detecting the grass carp reovirus type II gene.
8. Use according to claim 7, characterized in that, The detection object is any one or more of the liver, spleen, kidney, muscle, intestine, skin, gill, and brain of grass carp.
9. The method for detecting grass carp reovirus type II by using the detection kit for grass carp reovirus type II according to any one of claims 3-6, characterized in that, It comprises the following steps: (1) Obtain the detection primer and probe of the grass carp reovirus type II gene; (2) Extract the RNA of the sample to be tested, positive control, and negative control and reverse transcribe; (3) Perform microdroplet digital PCR amplification on the RNA obtained in step (2) to obtain a reaction solution; (4) Perform microdroplet fluorescence signal analysis scanning on the reaction solution obtained in step (3).
10. The method of claim 9, wherein, The annealing temperature in the microdroplet digital PCR amplification is 59.7℃.
Citation Information
Patent Citations
Droplet type digital PCR detection kit for type II grass carp reovirus, special primer and probe of kit
CN109971890A