Application of ABHD17C in diagnosis, treatment and prognosis of KRAS mutant pancreatic ductal carcinoma

Abstract

The invention provides application of ABHD17C in diagnosis, treatment and prognosis of KRAS mutant pancreatic ductal carcinoma. It is found that the expression level of ABHD17C protein in KRAS mutant pancreatic ductal carcinoma patients is remarkably higher than that of KRAS wild pancreatic ductal carcinoma patients and healthy control persons, and the ABHD17C protein is in remarkable negative correlation with the expression level of ALOX15B. Besides, compared with KRAS mutant pancreatic ductal cancer patients with low expression of ABHD17C protein, the total lifetime and the recurrence-free lifetime of KRAS mutant pancreatic ductal cancer patients with high expression of ABHD17C protein are obviously shorter, and the difference has statistical significance. Moreover, the ferroptosis of the KRAS mutant pancreatic duct cancer cells can be promoted by silencing or inhibiting the expression of the ABHD17C protein, the occurrence and development of the KRAS mutant pancreatic duct cancer cells can be obviously inhibited, the growth of tumors can be inhibited, and the overall lifetime can be effectively prolonged. The ABHD17C protein can be used as a biomarker for diagnosis and prognosis evaluation of the KRAS mutant pancreatic ductal cancer, and can be used as a specific treatment target of the KRAS mutant pancreatic ductal cancer.

Description

Technical Field

[0001] The present invention belongs to the technical fields of disease diagnosis and biomedicine, and particularly relates to the application of ABHD17C in the diagnosis, treatment and prognosis of KRAS mutant pancreatic ductal carcinoma. Background Art

[0002] Pancreatic ductal adenocarcinoma (PDAC) is an invasive malignant tumor, characterized by rapid progression, easy metastasis, poor prognosis and high mortality. At present, surgical resection and adjuvant chemotherapy are the main methods for treating pancreatic ductal carcinoma. Since most patients with pancreatic ductal carcinoma have developed into the clinical advanced cancer stage at the first diagnosis, only 15%-20% of the patients can receive surgical treatment. However, patients who have undergone surgical resection of tumor tissues still face problems such as postoperative metastasis and local recurrence, and the 5-year survival rate of patients is less than 8%. Therefore, exploring the mechanism of the occurrence and development of pancreatic ductal carcinoma helps the early diagnosis of pancreatic ductal carcinoma and the development of targeted treatment strategies for pancreatic ductal carcinoma.

[0003] As a GTPase, KRAS can cycle between an inactive GDP-bound form and an active GTP-bound form, and is the most frequently mutated oncogene in cancer. In pancreatic ductal carcinoma, 86%-90% of patients have mutations in the KRAS gene at codon 12, including G12D (45%), G12V (35%), G12R (17%) and G12C (1%-2%). At present, clinical trials have confirmed the anti-cancer effects of KRAS inhibitors such as MRTX1133, sotorasib and adagasib. It has been reported that KRAS mutations can activate multiple cancer signaling pathways, alter intracellular metabolic pathways, resulting in an increase in reactive oxygen species (ROS) and an acceleration of the iron-dependent lipid peroxidation process. And lipid peroxides play an important role in ferroptosis. Therefore, ferroptosis has become a hot strategy for cancer treatment in recent years, and it is of great significance to develop new targeted ferroptosis therapies for KRAS mutant pancreatic ductal carcinoma (KRASmut-PDAC).

[0004] Since it was first reported in 2012, ferroptosis has attracted much attention as a unique form of non-apoptotic cell death. Ferroptosis is caused by iron-dependent lipid peroxides and is regulated by multiple cellular metabolic pathways, including redox homeostasis, mitochondrial activity and lipid metabolism. Free iron or iron-containing enzymes in cells react with polyunsaturated fatty acids to produce a large amount of membrane lipid peroxides. When these lipid peroxides cannot be metabolized in time by the glutathione (GSH)-glutathione peroxidase (GPX4) system, it will lead to a large accumulation of lipid peroxides on the cell membrane, ultimately resulting in cell membrane rupture and cell death.

[0005] The occurrence and development of cancer cells are related to the abnormal inhibition of ferroptosis, but the specific mechanism remains to be studied. Therefore, finding the related molecules that regulate ferroptosis in cancer cells and regulating the sensitivity of cancer cells to ferroptosis are crucial for the early diagnosis of PDAC and the development of targeted treatment strategies for PDAC. Summary of the Invention

[0006] Based on this, the purpose of the present invention is to provide the application of ABHD17C in the diagnosis, treatment, and prognosis of KRAS mutant pancreatic ductal adenocarcinoma.

[0007] To achieve the above purpose, the present invention adopts the following technical solutions.

[0008] In the first aspect of the present invention, there is provided the application of ABHD17C protein as a biomarker in the detection of KRAS mutant pancreatic ductal adenocarcinoma.

[0009] In the second aspect of the present invention, there is provided the application of ABHD17C protein as a biomarker in the prognosis evaluation of KRAS mutant pancreatic ductal adenocarcinoma.

[0010] In the third aspect of the present invention, there is provided the application of a reagent for detecting the content of ABHD17C protein in the preparation of a detection product for KRAS mutant pancreatic ductal adenocarcinoma.

[0011] In the fourth aspect of the present invention, there is provided the application of a reagent for detecting the content of ABHD17C protein in the preparation of a prognosis evaluation product for KRAS mutant pancreatic ductal adenocarcinoma.

[0012] In some embodiments, the reagent includes reagents for western blot detection and immunohistochemical detection.

[0013] In some embodiments, the reagent is a specific antibody against ABHD17C protein, preferably a monoclonal antibody.

[0014] In some embodiments, the product is a kit.

[0015] In the fifth aspect of the present invention, there is provided the application of a reagent for silencing or inhibiting the expression of ABHD17C protein in the preparation of a drug for treating KRAS mutant pancreatic ductal adenocarcinoma.

[0016] In some embodiments, the application includes promoting ferroptosis in KRAS mutant pancreatic ductal adenocarcinoma cells.

[0017] In some embodiments, the reagent for silencing or inhibiting the expression of ABHD17C protein includes shRNA and ABHD17C inhibitor.

[0018] The present invention has found through research that the expression level of ABHD17C protein in patients with KRAS mutant pancreatic ductal carcinoma is significantly higher than that in patients with KRAS wild-type pancreatic ductal carcinoma and healthy controls, and is significantly negatively correlated with the expression level of ALOX15B. In addition, compared with KRAS mutant pancreatic ductal carcinoma patients with low expression of ABHD17C protein, the overall survival period and recurrence-free survival period of KRAS mutant pancreatic ductal carcinoma patients with high expression of ABHD17C protein are significantly shorter, and the difference is statistically significant. This indicates that ABHD17C protein can be used as a biomarker for the diagnosis and prognosis evaluation of KRAS mutant pancreatic ductal carcinoma, and can more specifically and sensitively predict the occurrence of pancreatic ductal carcinoma at an early stage, detect pancreatic ductal carcinoma, predict disease progression, evaluate treatment effects, and guide drug use and prognosis evaluation.

[0019] In addition, silencing or inhibiting the expression of ABHD17C protein can promote ferroptosis of KRAS mutant pancreatic ductal carcinoma cells, significantly inhibit the occurrence and development of KRAS mutant pancreatic ductal carcinoma, inhibit tumor growth, and effectively prolong the overall survival period. Therefore, ABHD17C protein can be used as a therapeutic target for KRAS mutant pancreatic ductal carcinoma. Brief Description of the Drawings

[0020] Figure 1 It is the result of label-free quantitative proteomics analysis.

[0021] Figure 2 It is for ABHD17C highly expressed in KRAS mut -PDAC cells.

[0022] Figure 3 It is the result of immunoprecipitation experiment.

[0023] Figure 4 It is a schematic diagram showing the negative correlation between the expression levels of ABHD17C and ALOX15B.

[0024] Figure 5 It is a schematic diagram showing that ABHD17C promotes the down-regulation of its expression by mediating the depalmitoylation of ALOX15B.

[0025] Figure 6 It is for the transmission electron micrograph of mitochondria in KRAS mut -PDAC cells after knocking out ABHD17C.

[0026] Figure 7 It is the immunohistochemical staining map of PDAC xenograft tumors.

[0027] Figure 8 It is the normalized BLI signal of murine PDAC.

[0028] Figure 9Representative BLI images and Kaplan-Meier survival curves of mice.

[0029] Figure 10 Representative images of the expression of ABHD17C in different PDAC tissues.

[0030] Figure 11 For high and low expression of ABHD17C and KRAS mut - Kaplan-Meier survival curves of PDAC survival curves. Detailed implementation manners

[0031] To facilitate the understanding of the present invention, the present invention will be described more comprehensively below with reference to the embodiments. The following are the preferred embodiments of the present invention. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. The purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive. It should be understood that the experimental methods without specific conditions noted in the following embodiments are generally carried out under conventional conditions or according to the conditions recommended by the manufacturers. All kinds of commonly used reagents used in the embodiments are commercially available products.

[0032] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the technical field to which the present invention belongs. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used herein includes any and all combinations of one or more of the related listed items.

[0033] The following is described in conjunction with specific embodiments.

[0034] KRAS mutant pancreatic ductal carcinoma: KRAS mut - PDAC; KRAS wild-type pancreatic ductal carcinoma: KRAS wt - PDAC.

[0035] In the following embodiments, overexpression or gene knockout was commissioned to Shandong Weizhen Biotechnology Co., Ltd. to produce. Among them, the ABHD17C-sh1 sequence for the ABHD17C gene is: CATCAACTGTAACCATATAAA (SEQ ID NO.1); the ABHD17C-sh2 sequence is: GCGTGAGTCCCGAGAACATTA (SEQ ID NO.2).

[0036] Example 1

[0037] Application of ABHD17C in the diagnosis of KRAS mutant pancreatic ductal carcinoma.

[0038] For culturing KRAS mut -PDAC organoids, tumor cells were obtained from the Sun Yat-sen University Cancer Center, and the clinical ethics number was B2022–639–01.

[0039] Fresh tumor tissues resected surgically were immediately digested with 2 mg / ml collagenase at 37 °C for 12 hours. The dissociated cells were embedded in growth factor-reduced Matrigel, and then the Matrigel was allowed to solidify in a 48-well plate and immediately supplied with PDAC organoid medium. The medium was changed every 2 - 3 days. Cell viability was detected using the CellTiter-Glo 3D kit (purchased from Promega).

[0040] Knockout or overexpression of genes in organoids: The organoids were digested with collagenase to obtain single-cell suspensions. The corresponding lentiviruses (constructed by Weizhen Biotechnology Co., Ltd., Shandong) and polybrene were added to the suspensions, and the mixtures were centrifuged at 300 g for 1 hour at room temperature and then incubated at 37 °C for 3 hours. The cells were plated in Matrigel and continued to be cultured with PDAC organoids.

[0041] To explore the role of proteins in the mut development and progression of KRAS G12V -PDAC, we performed label-free quantitative proteomic analysis on 3 KRAS mutant PDAC tissues (one KRAS G12D -PDAC tissue and two KRAS wt )-PDAC tissues) and 3 KRAS wild-type (KRAS Figure 1 )-PDAC tissues to analyze the abundance of proteins in these PDAC tissues. The results are shown in wt a as follows. The results showed that compared with KRAS mut -PDAC, a total of 82 proteins were abnormally expressed in KRAS

[0042] -PDAC, among which 40 proteins were downregulated and 42 proteins were upregulated (P < 0.01, log2 fold change > 5). mut -PDAC and KRAS wt -PDAC. The results are shown in Figure 1 b as follows. Overexpression of ALOX15B had the most obvious inhibitory effect on the growth of 3 types of KRAS mut -PDAC organoids. Therefore, the downregulation of ALOX15B expression may be related to the mut development and progression of KRAS

[0043] Furthermore, KRAS was isolated and extracted from fresh pancreatic cancer clinical specimens collected from the Sun Yat-sen University Cancer Center wt -PDAC and KRAS mut -PDAC cells. The proteins in KRAS wt -PDAC cells and KRAS mut -PDAC cells were subjected to immunoprecipitation experiments followed by mass spectrometry detection and analysis.

[0044] KRAS wt -PDAC cells and KRAS mut -PDAC cells were lysed thoroughly with lysis buffer, placed on ice for 30 minutes, and then centrifuged at 12,000 rpm for 10 minutes at 4°C. The resulting supernatant was incubated with G protein agarose beads conjugated with the corresponding antibody on a shaker at 4°C overnight. The immunoprecipitates were washed 5 - 6 times and used for mass spectrometry analysis.

[0045] Through mass spectrometry detection and analysis, the results are as Figure 2 shown. Figure 2 In a, after co-incubation with magnetic beads with anti-ALOX15B antibody, compared with KRAS wt -PDAC cells, there was a significant increase in the expression of 7 proteins that bind to ALOX15B in KRAS mut -PDAC cells.

[0046] Figure 2 In b, western blot analysis showed that when the expression of the above 7 genes was knocked down, only when ABHD17C or DCAF10 was knocked down could the expression and half-life of ALOX15B be significantly downregulated.

[0047] Subsequent immunoprecipitation experiments found ( Figure 3 ), there was no direct binding relationship between ABHD17C and DCAF10, while knocking out ABHD17C significantly inhibited the binding between DCAF10 and ALOX15B, but knocking out DCAF10 did not affect the binding between ALOX15B and ABHD17C, indicating that the downregulation of ALOX15B expression mediated by ABHD17C was achieved by regulating the binding between ALOX15B and DCAF10. In addition, knocking out DCAF10 significantly inhibited the binding of ALOX15B - DDB1 and ALOX15B - CUL4A, indicating that the CUL4 / DDB1 / DCAF10 ubiquitin ligase complex binds to ALOX15B and regulates the expression of ALOX15B. That is, ABHD17C can regulate the content of ALOX15B by affecting the ubiquitination and degradation of ALOX15B, thereby affecting ferroptosis and leading to the occurrence and development of PDAC, suggesting that ABHD17C can be applied to the diagnosis of KRAS mut -PDAC.

[0048] Furthermore, 95 cases of KRAS mut -PDAC patient tissues and 12 cases of KRAS wt -PDAC patient tissues were collected. The patient tissues were fixed with formalin, then embedded in paraffin and sectioned, and finally immunohistochemical staining (IHC staining) experiments were performed to detect the expression of ABHD17C and ALOX15B in each tissue. ABHD17C scoring and ALOX15B scoring were performed according to the detection results, and the correlation between the expression levels of the two was analyzed. Two independent pathologists reviewed and scored the immunohistochemical staining degree of formalin-fixed sections and paraffin-embedded sections according to the pathological characteristics of the sectioned tissues and patient data. The score was determined by combining the proportion of positively stained tumor cells with the staining intensity. The scores given by the two independent pathologists were combined into an average score for further comparative evaluation. Tumor cell proportion scoring: 0, no positive tumor cells; 1, positive cells < 10%; 2, 10 - 35% positive tumor cells; 3, 35 - 75% positive tumor cells; 4, 75% positive tumor cells. Staining intensity was graded according to the following criteria: 1, no staining; 2, weak staining (light yellow); 3, moderate staining (tan); 4, strong staining (brown). The staining index (SI) was calculated as the product of the staining intensity score and the proportion of positive tumor cells. Using the evaluation method, we evaluated the protein expression in pancreatic ductal carcinoma tissues by measuring SI, and the scores were 0, 2, 3, 4, 6, 8, 9, 12, and 16. SI ≥ 8 was considered high expression, and SI < 8 was considered low expression.

[0049] The results are as Figure 4 shown, Figure 4 in a are IHC staining images of 2 representative cases of KRAS mut -PDAC, scale bar, 50 μm. Figure 4 in b is a data analysis graph of the IHC results of KRAS mut -PDAC (n = 95) and KRAS wt -PDAC (n = 12). The results showed that ABHD17C was highly expressed in KRAS mut -PDAC and was negatively correlated with the expression level of ALOX15B, further confirming that ABHD17C can be applied to the diagnosis of KRAS mut -PDAC.

[0050] Example 2

[0051] For ALOX15B-high-expressing KRAS wt cells or ALOX15B-low-expressing KRAS wtCells were subjected to overexpression of ABHD17C or knockout of ABHD17C, and then the overall expression level and palmitoylation level of ALOX15B were analyzed by ABE / IB experiment. The immunoprecipitates obtained in the immunoprecipitation experiment were separated by SDS-PAGE, and then the proteins were transferred to a nitrocellulose membrane or a PVDF membrane, incubated with the corresponding specific antibody to bind to the target protein, and then incubated with a secondary antibody labeled with horseradish peroxidase or alkaline phosphatase, and finally a color reaction was carried out to obtain the target protein band.

[0052] Figure 5 In a, the overall expression level and palmitoylation level of ALOX15B after overexpression of ABHD17C or knockout of ABHD17C in specific cells were shown. The results showed that in KRAS wt -PDAC with high expression of ALOX15B, overexpression of the depalmitoylating enzyme ABHD17C led to a significant decrease in the overall expression level and palmitoylation level of ALOX15B; while in KRAS mut -PDAC with low expression of ALOX15B, silencing of ABHD17C or inhibition of ABHD17C activity with ABD975 would lead to an increase in the overall expression level and palmitoylation level of ALOX15B.

[0053] For KRAS cells with high expression of ALOX15B wt or KRAS cells with low expression of ALOX15B wt After overexpression of ABHD17C or knockout of ABHD17C, IF staining of ALOX15B was performed. As Figure 5 shown in b, it was visible that in KRAS wt -PDAC with high expression of ALOX15B, overexpression of ABHD17C led to a significant reduction in the membrane localization of ALOX15B; while in KRAS mut -PDAC with low expression of ALOX15B, silencing of ABHD17C or inhibition of ABHD17C activity with ABD975 led to an increase in the membrane localization of ALOX15B, suggesting that ABHD17C regulates the down-regulation of its expression by mediating the depalmitoylation of ALOX15B.

[0054] Furthermore, after knocking out the ABHD17C gene in KRAS mut -PDAC using shRNA, PDAC was then treated with 5 μM Erastin or 10 μM RSL3, and transmission electron micrographs of intracellular mitochondrial cristae were obtained. The results ( Figure 6)PDAC with ABHD17C gene knockout treated with RSL3 or erastin for display showed typical ferroptosis morphological features, especially the disappearance of mitochondrial cristae was obvious, confirming that ABHD17C could inhibit ferroptosis of PDAC. Previous studies have reported that ALOX15B can convert arachidonic acid into 15-HpETE to induce ferroptosis, suggesting that ABHD17C plays an important role in ferroptosis of pancreatic ductal carcinoma cells by regulating the expression level of ALOX15B.

[0055] Example 3

[0056] A mouse model of PDAC xenograft tumor was constructed as follows: NOD-SCID IL-2rγ- / -(NOG) mice at 4-6 weeks of age were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. The mice were divided into 6 groups with 6 mice in each group and were treated as follows: Each group of mice was respectively injected orthotopically into the pancreas with 5×10 5 sh-V KRAS mut -PDAC cells capable of expressing luciferase, ABHD17C-sh#1KRAS mut -PDAC cells and ABHD17C-sh#2KRAS mut -PDAC cells. Doxycycline (DOX, which can regulate gene expression. In the Tet-on system, gene knockout does not occur without tetracycline, and only when tetracycline is given can specific genes be knocked out at specific sites) was dissolved in the drinking water of mice at a concentration of 0.5-8 mg / ml and administered continuously for 12 weeks, and then MLS000545091 (50 mg / kg) was administered by intraperitoneal injection. D-luciferin (75 mg / kg) was injected into the mice weekly, and the tumor growth status was observed and evaluated by bioluminescence imaging technology (IVIS Spectrum In Vivo Imager).

[0057] After 12 weeks, the pancreatic tissues of mice in each group were taken, and IHC staining was used to detect the expression levels of 3 ALOX15B metabolites, 2 lipid peroxide products and caspase-3.

[0058] Figure 7 In a, it is a representative IHC staining map obtained after corresponding treatment of PDAC xenograft tumors, scale bar, 50 μm. b is the expression levels of 3 metabolites of ALOX15B, 15-HETE, 13-HODE and 15-HPEP. The results showed that compared with the tumors of the control group, the KRAS with silenced ABHD17C was inoculated mut-In the tumors formed by PDAC cells, the levels of three ALOX15B metabolites (such as 15-HETE, 13-HODE, and 15-HPEP) and two lipid peroxide products (4-HNE and MDA) were significantly increased, and the level of caspase-3 remained unchanged, confirming that ABHD17C mediated KRAS by regulating the level of ALOX15B mut -sensitivity of PDAC cells to ferroptosis, thus playing an important role in the development of KRAS mut -PDAC.

[0059] Example 4

[0060] A mouse model of orthotopic inoculation of PDAC tumors was constructed, and the methods, grouping, and treatments of each group were the same as in Example 3.

[0061] After 12 weeks, the relative changes in BLI of mice in each group were detected.

[0062] Figure 8 For the standardized BLI signal of mice orthotopically inoculated with specified PDAC cells treated with DOX and ALOX15B inhibitor MLS000545091 (50 mg / kg), n = 6 / group. When the BLI signal reached 3.0×1‎0 6 p / s / cm 2 / sr, mice were intraperitoneally injected with DOX, which could significantly inhibit the expression of ABHD17C and induce the expression of ALOX15B. The results showed that injection of DOX could significantly inhibit the growth of orthotopic KRAS mut -PDAC, suggesting that ABHD17C could promote the development of KRAS mut -PDAC.

[0063] Figure 9 In a, the representative BLI image of mice orthotopically inoculated with specified PDAC cells, scale bar, 50 μm. Figure 9 In b, the Kaplan-Meier survival curves of mice in each group above. These results demonstrated that ABHD17C promoted the development of KRAS mut -PDAC, while silencing ABHD17C in KRAS mut -PDAC cells could significantly inhibit the occurrence and development of PDAC and effectively prolong the overall survival period of mice, indicating that ABHD17C is an important target for inhibiting KRAS mutant pancreatic ductal carcinoma.

[0064] Example 5

[0065] In this example, the expression levels of ABHD17C in different tissue samples were verified. Eight normal pancreatic tissues, 12 KRAS wt -PDAC tissues, and 95 KRASmut -For PDAC tissues, the patient tissues were fixed with formalin, then embedded in paraffin for sectioning, and finally subjected to immunohistochemical staining experiments to detect the expression levels of ABHD17C in each group of tissues.

[0066] Figure 10 For ABHD17C in normal pancreatic tissues (n = 8), KRAS wt -PDAC tissues (n = 12) and KRAS mut -Representative immunohistochemical staining images (left) and quantification (right) of PDAC tissues (n = 95), scale bar, 50 μm. The results showed that compared with normal pancreatic tissues and KRAS wt -PDAC tissues, the expression level of ABHD17C in KRAS mut -PDAC tissues was significantly increased, further confirming that ABHD17C could be used as a diagnostic marker for KRAS mut -PDAC.

[0067] Example 6

[0068] Collect 95 cases of KRAS mut -PDAC tissues, and use immunohistochemical staining to detect the expression levels of ABHD17C in each tissue. According to the detection results, KRAS mut -PDAC was divided into KRAS patients with high expression of ABHD17C mut -PDAC and KRAS patients with low expression of ABHD17C mut -PDAC patients, and the criteria for high and low expression were the same as in Example 1.

[0069] According to the above grouping criteria, there were 64 cases in the KRAS mut -PDAC patient group with high expression of ABHD17C (high expression 17C), and 31 cases in the KRAS mut -PDAC patient group with low expression of ABHD17C (low expression 17C). Kaplan-Meier analysis of the survival curve and recurrence-free survival curve was performed on the two groups of patients.

[0070] Figure 11 For KRAS patients with low expression of ABHD17C mut -PDAC and KRAS patients with high expression of ABHD17C mut -Kaplan-Meier analysis chart of the survival curve and recurrence-free survival curve of PDAC patients (n = 95; P < 0.001, log-rank test). The results showed that compared with KRAS patients with low expression of ABHD17C mut -PDAC patients, KRAS patients with high expression of ABHD17C mut- The overall survival and recurrence-free survival of PDAC patients were significantly shorter, and the differences were statistically significant. The results showed that ABHD17C could serve as a biomarker for prognostic evaluation of KRAS mut - PDAC patients, and the expression level of ABHD17C could be used to evaluate the prognosis of KRAS mut - PDAC patients.

[0071] Furthermore, we detected and analyzed 54 cases of KRAS mut - PDAC tissues to verify that the expression level of ABHD17C could be used to evaluate the prognosis of KRAS mut - PDAC patients.

[0072] The expression level of ABHD17C in each tissue was detected by immunohistochemical staining. According to the detection results, KRAS mut - PDAC was divided into KRAS mut - PDAC patients with high expression of ABHD17C and KRAS mut - PDAC patients with low expression of ABHD17C. The determination criteria for high expression and low expression were the same as above.

[0073] The results were as [[ID=Z4]] Figure 11 shown, which were consistent with the above results. Compared with KRAS mut - PDAC patients with low expression of ABHD17C, the overall survival and recurrence-free survival of KRAS mut - PDAC patients with high expression of ABHD17C were significantly shorter, and the differences were statistically significant. It was verified again that ABHD17C could serve as a biomarker for prognostic evaluation of KRAS mut - PDAC patients.

[0074] Based on the above relevant experimental data, the ABHD17C protein can serve as a diagnostic and prognostic biomarker for KRAS-mutant pancreatic ductal carcinoma and as a target for KRAS-mutant pancreatic ductal carcinoma,

[0075] achieving the effect of precise treatment of PDAC.

[0076] The technical features of the above-described embodiments can be combined arbitrarily. For the sake of brevity of description, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, it should be considered as the scope recorded in this specification.

[0077] The above-described embodiments merely represent several implementation manners of the present invention. The description thereof is relatively specific and detailed, but it should not be construed as a limitation on the scope of the patent for the present invention. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all fall within the protection scope of the present invention. Therefore, the protection scope of the patent for the present invention shall be subject to the appended claims.

Claims

1. Use of ABHD17C protein as a biomarker in the detection of KRAS mutant pancreatic ductal carcinoma.

2. Use of ABHD17C protein as a biomarker in the prognosis assessment of KRAS mutant pancreatic ductal carcinoma.

3. Use of a reagent for detecting the content of ABHD17C protein in the preparation of a product for detecting KRAS mutant pancreatic ductal carcinoma.

4. Use of a reagent for detecting the content of ABHD17C protein in the preparation of a product for prognosis assessment of KRAS mutant pancreatic ductal carcinoma.

5. The application according to claim 3 or 4, characterized in that, The reagent includes reagents for western blot detection and immunohistochemical detection.

6. The application according to claim 5, wherein The reagent is a specific antibody against ABHD17C protein, preferably a monoclonal antibody.

7. The application according to any one of claims 3 to 6, characterized in that, The product is a kit.

8. Use of a reagent for silencing or inhibiting the expression of ABHD17C protein in the preparation of a drug for treating KRAS mutant pancreatic ductal carcinoma.

9. The application according to claim 8, characterized in that, The application includes promoting ferroptosis in KRAS mutant pancreatic ductal cancer cells.

10. The application according to claim 8 or 9, characterized in that The reagent for silencing or inhibiting the expression of ABHD17C protein includes shRNA and ABHD17C inhibitor.

Images