Toxoplasma gondii mic19 gene knockout strain and construction method and application thereof

Abstract

The application discloses a Toxoplasma gondii gene knockout worm strain, which is deficient in a Toxoplasma gondii microtubule protein MIC19 (TGME49_294790 gene) with a nucleotide sequence as shown in SEQ ID No. 1, and discloses a construction method of the worm strain and application thereof, and belongs to the field of biology. Δ mic19 The gene knockout worm strain ME49 constructed by the application has the advantages of virulence attenuation, can induce an immune protection reaction of animals, and can be used for preparing a live attenuated vaccine of Toxoplasma gondii.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biology, and relates to a Toxoplasma gondii strain, in particular a Toxoplasma gondii gene knockout strain, and a construction method and use thereof. BACKGROUND

[0002] Toxoplasma gondii is a obligate intracellular parasite of the Apicomplexa phylum, which can invade almost all warm-blooded animals including humans, causing serious zoonosis. Toxoplasma infection not only leads to reduced meat quality in livestock, but also easily causes abortion in female livestock, greatly limiting the development of livestock breeding industry. The life cycle of Toxoplasma is complex, and drugs can only change it from the rapidly proliferating tachyzoite stage (acute infection) to the slowly proliferating bradyzoite stage (chronic infection), and cannot completely eliminate it from the host body. Once the host's immunity is low, it will seriously threaten the life and health of the host. Vaccines are considered the most effective prevention and control means, however, the immunoprotective efficacy of the current DNA, recombinant protein and other subunit vaccines is extremely low, and the only commercial attenuated live vaccine on the market has the risk of virulence returning to strength, and is not suitable for livestock breeding. Therefore, it is of great significance to develop a safe and effective live attenuated vaccine.

[0003] Toxoplasma MICs are proteins secreted by the microtubule organelle at the tip of the worm, responsible for driving the movement of the worm, mediating adhesion recognition with host cells and other processes. MICs play an important role in the early stage of Toxoplasma invasion of host cells, and several functionally important MICs have been found, including MIC1, MIC2, MIC3, MIC4, MIC6 and MIC10, which often act synergistically in the form of a complex (such as MIC2-M2AP, MIC6-MIC1-MIC4). For example, MIC2 is connected to the actin skeleton of the worm through aldolase to provide power for invasion, and proteins such as MIC3 recognize host cell surface carbohydrates through a lectin-like domain to enhance adhesion. Due to their high immunogenicity, some MICs have become candidate molecules for vaccine development. Studies have shown that after knocking out the MICI gene of Toxoplasma, the invasion rate of the gene knockout strain of Toxoplasma to host cells is reduced by about 50% compared with the wild type Toxoplasma, but the MIC2 and AMA1 genes cannot be knocked out. SUMMARY

[0004] The first object of the present application is to provide a new Toxoplasma gene knockout strain, which is attenuated due to the loss of function of MIC19 gene.

[0005] Specifically, the strain is a MIC19 gene deletion strain of Toxoplasma gondii ME49 strain, and the MIC19 gene encodes a microtubule protein, and its nucleotide sequence is shown as SEQ ID NO: 1.

[0006] A second object of the present application is to provide a method for constructing the T. gondii gene knockout strain, comprising the following steps:

[0007] (1) Using T. gondii gene editing plasmid pSAG1-Cas9-TgU6-sgUPRT as a template, an efficient targeting site of MIC19 gene is screened by using CRISPR design tool, and primers are designed according to the targeting site for site-directed mutagenesis, so that the sgUPRT in the above template plasmid is replaced by gRNA specific to the MIC19 gene target site, and the pSAG1-Cas9-TgU6-sgMIC19 plasmid is constructed;

[0008] (2) Using the genome of the starting strain as a template, primers are designed, and the upper and lower homologous arms of the MIC19 gene are amplified respectively; DHFR is amplified from a plasmid containing a DHFR drug screening tag; the upper and lower homologous arms and DHFR are inserted into the linearized vector pUC19 by seamless cloning to construct a homologous recombination template containing the upper and lower homologous arms of the MIC19 gene and DHFR;

[0009] (3) The pSAG1-Cas9-TgU6-sgMIC19 plasmid constructed in step (1) and the homologous recombination template constructed in step (2) are co-electrotransferred into the T. gondii ME49 strain, and a T. gondii MIC19 gene knockout strain is obtained by drug screening, monoclonal culture and PCR identification.

[0010] Preferably, the sequence of the targeting site is shown as SEQ ID NO: 2.

[0011] Further preferably, the primer sequence of the targeting site is shown as SEQ ID NO: 3 and SEQ ID NO: 4.

[0012] Preferably, the primer sequence of the upper and lower homologous arms of the MIC19 gene is:

[0013] MIC19-5H-F: as shown in SEQ ID NO: 5;

[0014] MIC19-5H-R: as shown in SEQ ID NO: 6;

[0015] MIC19-3H-F: as shown in SEQ ID NO: 7;

[0016] MIC19-3H-R: as shown in SEQ ID NO: 8.

[0017] The present application is based on the clustered regularly interspaced short palindromic repeats-associated nuclease (CRISPR / Cas9) technology to knockout the MIC19 gene of Toxoplasma gondii. The main steps and principles of the method are as follows: first, DNA break is mediated by the CRISPR / Cas9 system, then gene replacement is achieved by homology-directed repair (HDR), and finally, mutants are enriched by drug screening. Specifically, first, an sgRNA targeting the target gene (such as MIC19) is designed to guide the Cas9 nuclease to cut the DNA double strand at a specific site (such as SEQ ID NO: 2) to form a double-strand break (DSB); then, a homologous recombination template (containing 5' and 3' homologous arms + drug screening tag DHFR) is provided to insert the DHFR tag into the target gene site accurately by using the HDR mechanism of Toxoplasma gondii, thereby achieving gene knockout; finally, ethenylpyrimidine (inhibiting DHFR) is used to screen the strains successfully integrating the DHFR tag, and the unmutated strains die.

[0018] CRISPR-Cas9 is the most mature and efficient method for Toxoplasma gondii gene knockout at present. Of course, in addition to the CRISPR-Cas9 technology, other methods commonly used for gene knockout, such as double exchange replacement based on homologous recombination, conditional gene knockout mediated by DiCre / loxP double mini-chromosome strategy, etc. are also applicable to the present application.

[0019] A third object of the present application is to provide the use of the Toxoplasma gondii gene knockout strain in the preparation of a Toxoplasma gondii vaccine.

[0020] Experiments show that the knockout of the MIC19 gene does not affect the in vitro proliferation of Toxoplasma gondii, but the survival rate of mice inoculated with the ME49Δmic19 knockout strain is greatly improved compared with the wild-type ME49 starting strain, indicating that the virulence of the knockout strain is attenuated. In addition, compared with the unvaccinated control group, the survival rate of ME49Δmic19 immunized mice after challenge with RH or ME49 wild-type strains is greatly improved, indicating that the ME49Δmic19 strain has good immune protection against Toxoplasma gondii infection in mice. The above results show that the gene knockout strain provided by the present application can be used to prepare a live attenuated vaccine of Toxoplasma gondii.

[0021] A fourth object of the present application is to provide a Toxoplasma gondii vaccine comprising the Toxoplasma gondii gene knockout strain and a pharmaceutically acceptable adjuvant or carrier.

[0022] For more detailed technical solutions, please refer to the specific embodiments. BRIEF DESCRIPTION OF DRAWINGS

[0023] Figure 1 is the plasmid map of pUC19-MIC19-5H::DHFR::3H. In the figure, pUC19 is a plasmid vector carrying an ampicillin resistance gene (AmpR), MIC19 is the target gene, 5H and 3H are homologous arms, and DHFR is a drug screening tag.r ) and its promoter, for screening of positive plasmid clones. 5h is the 5' homology arm of MIC19 gene, 3h is the 3' homology arm, and loxp-DHFR-loxp in between is the drug selection tag, which can be used to screen positive monoclonal strains of Toxoplasma after transfection by pyrimethamine (targeting DHFR).

[0024] Figure 2 PCR identification of the monoclonal strain of ME49 Δmic19 Toxoplasma gondii. Δmic19 The MIC19 gene deletion strain of Toxoplasma gondii ME49 strain, in which, Δmic19 PCR1 and PCR2 have bands around 1300bp, while the starting strain ME49 has no corresponding bands, indicating that the 5' homology arm and 3' homology arm of MIC19 gene and the drug selection tag DHFR are successfully integrated into the Toxoplasma genome. The primer of PCR3 is used to detect whether MIC19 DNA exists in the strain, in which, the starting strain ME49 has a band of about 280bp, while the transfection experimental group has no band, indicating that MIC19 is successfully knocked out.

[0025] Figure 3 Cell plaque map of ME49 Δmic19 strain in vitro. In the figure, ME49 Δmic19 strain and the wild type starting strain ME49 infected cell wells have a large number of plaques, and there is no significant difference in the size of the plaques formed by the two.

[0026] Figure 4 Toxicity test results of ME49 Δmic19 strain in mice. In the figure, ME49 Δ mic19 No mice died within 30 days in the group inoculated with the knockout strain, with a survival rate of 100%, while only 40% of the mice inoculated with the wild type ME49 survived within 30 days.

[0027] Figure 5 Short-term immune protection test results of ME49 Δmic19 strain on mice. In the figure, ME49 Δmic19 30d, intraperitoneal injection of RH tachyzoites, all mice in the non-immunization group (No immunization) died within 10 days, all mice in the ME49 Δmic19 immunization group (Immunized with ME49 Δmic19 ) survived within 30 days (A); intraperitoneal injection of ME49 tachyzoites, all mice in the non-immunization group (No immunization) died within 15 days, all mice in the ME49 Δmic19Immunized group (Immunized with ME49 Δmic19 ) All mice survived within 30 days (B).

[0028] Δmic19 It's ME49 Figure 6 The line graph shows the results of the long-term immune protection test of the insect strain on mice. Δmic19 After 75 days, RH tachyzoites were injected intraperitoneally. All mice in the no immunization group died within 10 days. Δmic19 Immunized group (Immunized with ME49 Δmic19 All mice in the non-immunized group (no immunization) survived within 30 days (A). All mice in the ME49 group (no immunization) died within 15 days after intraperitoneal injection of ME49 tachyzoites. Δmic19 Immunized group (Immunized with ME49 Δmic19 ) All mice survived within 30 days (B). DETAILED DESCRIPTION

[0029] The present invention is described in detail below with reference to specific examples. It should be understood that the following examples are only used to illustrate the present invention and are not used to limit the scope of protection of the present invention. Various modifications or equivalent substitutions made by those skilled in the art on the basis of the following examples should also be deemed to fall within the scope of protection of the present invention. The experimental methods for which specific conditions are not specified in the following examples are generally implemented according to conventional conditions or reference books such as "Molecular Cloning Laboratory Guide" (New York: Cold Spring Harbor Laboratory, 2017), or implemented according to the methods recommended in the operating manual provided by the manufacturer. The materials whose sources are not specified in the examples are all commonly used materials well known in the art, which can be constructed by themselves according to literature reports or obtained through commercial channels.

[0030] Example 1: Toxoplasma gondii ME49 Δmic19 Construction of insect strains

[0031] (1) Mother strain ME49

[0032] ME49 is a type II strain of the genus Toxoplasma of the family Toxoplasma in the order Coccidia, which has the MIC19 gene. The nucleotide sequence of the MIC19 gene is shown in SEQ ID NO: 1, encoding the Toxoplasma micronematic protein MIC19. The accession number of the gene on ToxoDB is: TGME49_294790.

[0033] (2) pSAG1-Cas9-TgU6-sg Δmic19 Plasmid construction

[0034] ① Use the gRNA online design website (http: / / www.e-crisp.org / E-CRISP / designcrispr.html) to design the target gene targeting site. Based on the designed target sequence (GCAACTGTCAGAAATCGATGG, SEQ ID NO: 2), the gRNA primers are designed as follows:

[0035] Upstream primer gRNA-MIC19-F: 5′-GCAACTGTCAGAAATCGATGGGTTTTAGAGCTAGAAATAGC-3′ (SEQ ID NO: 3);

[0036] Downstream primer gRNA-MIC19-R: 5′-CCATCGATTTCTGACAGTTGCAACTTGACATCCCCATTTAC-3′ (SEQ ID NO: 4).

[0037] ② Prepare the following reaction system in a sterilized PCR tube, where template DNA: pSAG1-Cas9-TgU6-sg MIC19 Plasmid: Q5 Hot Start High-Fidelity DNA Polymerase 0.25 μL; 5× Q5 Reaction Buffer 5 μL; 10 mM dNTPs 0.5 μL; upstream primer (10 μM) 1.25 μL; downstream primer (10 μM) 1.25 μL; template DNA (1-25 ng / μL) 1 μL; sterile deionized water 15.75 μL.

[0038] ③PCR reaction conditions were as follows: pre-denaturation at 98°C for 1 min; denaturation at 98°C for 10 sec, annealing at 55°C for 30 sec, extension at 72°C for 5 min, 25 cycles; complete extension at 72°C for 2 min, cooling at 15°C for 5 min.

[0039] ④After the PCR is completed, all the reaction products were transformed into DH5α (100 μL) competent cells and coated with LB / Amp + Plate, invert and culture at 37℃ overnight; pick a single colony and place it in 5ml LB / Amp + The culture was shaken at 37°C / 180 rpm for 10-12 h until the bacterial solution became turbid. 500 μL of the bacterial solution was taken for sequencing analysis. The sequencing primer was the M13 reverse primer. If the sequencing results showed that the target sequence had been completely replaced, the plasmid was successfully constructed. The pSAG1-Cas9-TgU6-sg was extracted with the Omega Endo-free Plasmid Mini Kit II.UPRT The plasmid was extracted and the concentration was determined and reserved.

[0040] (3) Preparation of MIC19-5H::DHFR::3H homologous template

[0041] ① According to the Gene ID of the gene to be knocked out, the locus of the gene was determined on ToxoDB, and the 5' homologous arm (MIC19-5H) and the 3' homologous arm MIC19-3H) were determined by the genomic sequence.

[0042] ② According to the method introduced in the instruction manual of the multi-fragment seamless ligation kit, the 5' homologous arm, the 3' homologous arm, the DHFR drug screening tag, and the seamless ligation amplification primer of the pUC19 vector were designed.

[0043] ③ According to the designed primers (Table 1), the 5' homologous arm and the 3' homologous arm fragments were amplified from the Toxoplasma ME49 genomic DNA using high-fidelity enzyme (Phanta), and the DHFR fragment was amplified from the DHFR-containing plasmid (purchased from http: / / www.addgene.org), and the linearized pUC19 vector (purchased from http: / / www.addgene.org) was linearized using the designed specific primers, and the reaction conditions were as follows:

[0044] The PCR system is as follows: 10 μM upstream primer 1 μL; 10 μM downstream primer 1 μL; Phanta® Max high-fidelity enzyme 0.5 μL; 2×Phanta buffer 12.5 μL; 10 mM dNTPs 0.5 μL; template DNA 1 μL; sterile deionized water 8.5 μL; total volume 25 μL;

[0045] The temperature system is as follows: 95℃-3min; 95℃-15s, 60℃-15s, 72℃-1Kb / min, cycle 35 times; 72℃-5min; 15℃-5min.

[0046] The above target fragments were recovered respectively, and the concentration of the recovered product was determined by NanoDrop2000.

[0047] Table 1. Primers used for constructing pUC19-MIC19-5H::DHFR::3H plasmid

[0048]

[0049] ④ According to the concentration of the recovered product, the following reaction system was prepared: 5×CE MultiS Buffer 2.0 μL; Exnase TMMultiS 1.0 μL; MIC19-5H 10 ng; MIC19-3H 10 ng; DHFR 30 ng; pUC19 25 ng; sterile deionized water to 10 μL. After mixing well, 37°C reaction for 30 min, 5 min on ice.

[0050] 5. Transform 10 μL of the ligation product into DH5α (100 μL) competent cells, and coat LB / Amp + plates, 37°C inverted culture overnight; pick single colonies in 5 ml LB / Amp + liquid medium, 37°C / 180 rpm shaking culture for 10 h until the bacterial solution is turbid; use M13 forward and reverse primers for sequencing analysis, and if the sequencing results are correct, it is considered that the pUC19-MIC19-5H::DHFR::3H plasmid construction is successful. Extract the correct bacterial solution plasmid, and store at -20°C. The correct plasmid map is shown in MIC19 .

[0051] 6. Use high-fidelity enzyme to perform PCR amplification of the target fragment MIC19-5H::DHFR::3H, using pUC19-MIC19-5H::DHFR::3H plasmid as the amplification template, and MIC19-5H-F upstream primer and MIC19-3H-R downstream primer as the amplification primers. Gel cut and recover the target fragment, and determine the concentration and reserve.

[0052] (4) Obtaining of Toxoplasma gene knockout strain ME49 Figure 1

[0053] 1. Electroporate the pSAG1-Cas9-TgU6-sg Δmic19 plasmid in step (2) and the MIC19-5H::DHFR::3H homologous template in step (3) into the Toxoplasma ME49 strain, and use ethyl pyrimidine for drug screening of the library.

[0054] 2. After 3-5 generations of drug screening, place the worms in a 96-well plate containing host cells for single colony screening (2 pieces of 96-well plates), and inoculate 2 (calculated amount) tachyzoites per well; the remaining worms can be extracted for genomic DNA (genomic DNA extraction method refers to the genomic DNA extraction kit operation instruction), and the homologous arm integration efficiency and gene knockout efficiency are detected using the primers in Table 2. PCR1 band indicates that the 5' homologous arm of MIC19 is integrated into the Toxoplasma genome, PCR2 band indicates that the 3' homologous arm of MIC19 is integrated into the Toxoplasma genome, and PCR3 band detects whether the knockout gene MIC19 is still in the genome. If the control group ME49 has a PCR3 band, and the transfection experimental group has no PCR3 band, it indicates that MIC19 is successfully knocked out.​

[0055] Table 2. ME49 MIC19 PCR primers for identification of monoclonal insect strains

[0056]

[0057] ③ After 12 days of culture in a 96-well plate, observe whether a single clone exists. Use a sterile pipette tip to scrape the host cells containing the single clone from the well and add them to a 24-well plate containing host cells for continued culture. When 70% of the host cells in the 24-well plate are lysed, transfer 150 μL of the worms in the well to a new 24-well plate for culture, and use the rest for DNA extraction to identify the clone.

[0058] ④ Use PCR1, PCR2 and PCR3 to detect the selected monoclonal insect strain. If PCR1 and PCR2 have specific bands but PCR3 has no target band, it means that the monoclonal insect strain is the gene knockout strain ME49. Δmic19 ; will be determined as ME49 Δmic19 Δ Continue to expand the strain to T25 culture flasks; perform PCR1, PCR2, and PCR3 tests on the knockout strain in the T25 culture flask again. If the knockout phenotype is still present, it can be frozen after expansion. The PCR reaction system is as follows:

[0059] Prepare the following reaction system in a sterile PCR tube: 2× Master Mix 12.5 μL; 10 μM upstream primer 1.0 μL; 10 μM downstream primer 1.0 μL; gDNA 2.0 μL; sterile deionized water 8.5 μL;

[0060] The PCR reaction conditions were as follows: pre-denaturation at 98°C for 5 min; denaturation at 98°C for 30 sec; annealing at Tm-5°C for 30 sec, extension at 72°C for 2 min, complete extension at 72°C for 10 min, 35 cycles; cooling at 15°C for 5 min.

[0061] ⑤PCR product identification: After amplification, take 10 μL of PCR product, add 1 μL of 10× nucleic acid loading buffer, mix well, apply sample, 1.0% agarose gel, 1× TAE buffer, 120V, electrophoresis for 20 minutes, observe with gel imaging system, and the PCR identification results are as follows: mic19 As shown, it indicates ME49 Figure 2 The monoclonal insect strain was successfully constructed.

[0062] Example 2: Toxoplasma gondii ME49 Δmic19 Application of insect strains

[0063] (1) ME49 Δmic19Knockout strain in vitro cell plaque assay

[0064] ①HFF cells were plated in 6-well plates, and after the cells were fully grown, 200 tachyzoites per well were added to the ME49 Δmic19 strain and the wild type starting strain ME49 strain were cultured in a cell incubator for 12 days.

[0065] ②The cell supernatant was discarded, and PBS was added for washing 3 times, 1 mL of 4% paraformaldehyde was added per well for fixation for 15 minutes, the formaldehyde was discarded, and 2 mL of 0.2% crystal violet-PBS was added per well for staining for 2 hours.

[0066] ③The staining solution was discarded, and the 6-well plate was placed in an oven for drying, and then photographic analysis was performed, as shown in Δmic19 , the ME49 Figure 3 Δ strain and the wild type starting strain infected cell wells had a large number of plaques, indicating that the strain proliferated in the cells, and the host cells died and broke, indicating that the deletion of MIC19 did not affect the proliferation ability of Toxoplasma in vitro.

[0067] (2) Mouse virulence test of ME49 mic19 knockout strain

[0068] ①ME49 Δmic19 strain and wild type starting strain ME49 tachyzoites were cultured in vitro using HFF cells, and after 30-50% of the tachyzoites escaped from the cells, the culture medium in the original culture bottle was discarded, and the escaped tachyzoites and residual culture medium were washed away with PBS, and fresh culture medium without FBS was added.

[0069] ②The cells were scraped off with a disposable cell scraper, and the suspension was blown repeatedly 8-10 times with a 5 mL syringe to break the tachyzoite bubbles and release the tachyzoites, and the tachyzoites were purified by filtering with a sterile 3 μm pore size filter membrane; the tachyzoite suspension was counted and diluted using a cell counting plate.

[0070] ③According to 100 tachyzoites per mouse, 7-week-old female ICR mice were inoculated intraperitoneally, 10 mice per group, and the survival of the mice was recorded every day, and the results were statistically analyzed after 30 days, as shown in Δmic19 . From the experimental results, it can be seen that the mice inoculated with ME49 Figure 4 Δ knockout strain had no mouse death within 30 days, and the survival rate was 100%, while the mice inoculated with wild type ME49 had 60% mortality within 30 days, indicating that the virulence of ME49 mic19 knockout strain was much lower than that of the starting strain.

[0071] (3) Immune protection of ME49 Δmic19 knockout strain on mice

[0072] ME49 Δmic19 The knockout strain was inoculated into ICR mice at a dose of 1 x 10 4 The ICR mice were inoculated with 1 x 10 5 ME49 wild type strain or 1 x 10 4 RH wild type strain.

[0073] The death of the mice was observed and recorded, and the mortality rate was calculated after 30 days. The results of the immunization experiment are shown in Table 1 Δmic19 (30-day immunization group), Figure 5 (75-day immunization group). The mice in the RH control group and the ME49 control group all died within 30 days after infection, while the mice immunized with ME49 Figure 6 could all survive after 30 days of re-infection with a high dose of RH or ME49 wild type strain, indicating that the ME49 Δmic19 Δmic19 strain has good protective effect against the virulence of the wild type strain in mice.

Claims

1. Use of a Toxoplasma gondii gene knockout strain in the preparation of a Toxoplasma gondii vaccine, characterized in that: The parasite strain is a MIC19 gene deleted strain of Toxoplasma gondii ME49 strain. The MIC19 gene encodes a microneme protein, and its nucleotide sequence is shown in SEQ ID NO:

1. The loss of the gene function weakens the virulence of Toxoplasma gondii.

2. The use according to claim 1, characterized in that The method for constructing the Toxoplasma gondii gene knockout strain comprises the following steps: (1) Using the Toxoplasma gondii gene editing plasmid pSAG1-Cas9-TgU6-sg UPRT As a template, CRISPR design tools were used to screen the efficient target sites of MIC19 gene, and primers were designed according to the target sites for site-directed mutagenesis. UPRT Replaced with MIC19 gene target-specific gRNA, construct pSAG1-Cas9-TgU6-sg MIC19 plasmids; (2) Using the genome of the worm strain as a template, primers were designed to amplify the upstream and downstream homologous arms of the MIC19 gene respectively; DHFR was amplified from a plasmid containing a DHFR drug screening tag; the upstream and downstream homologous arms and DHFR were inserted into the linearized vector pUC19 by seamless cloning to construct a homologous recombination template containing the upstream and downstream homologous arms of the MIC19 gene and DHFR; (3) The pSAG1-Cas9-TgU6-sg constructed in step (1) MIC19 The plasmid and the homologous recombination template constructed in step (2) were co-electroplated into the Toxoplasma gondii ME49 strain, and the Toxoplasma gondii MIC19 gene knockout strain was obtained through drug screening, monoclonal culture and PCR identification.

3. The use according to claim 2, characterized in that: The sequence of the targeting site is shown in SEQ ID NO:

2.

4. The use according to claim 3, characterized in that: The primer sequences of the target sites are shown in SEQ ID NO: 3 and SEQ ID NO:

4.

5. The use according to claim 2, characterized in that: The primer sequences of the upstream and downstream homology arms of the MIC19 gene are: MIC19-5H-F: as shown in SEQ ID NO: 5; MIC19-5H-R: as shown in SEQ ID NO: 6; MIC19-3H-F: as shown in SEQ ID NO: 7; MIC19-3H-R: as shown in SEQ ID NO:

8.

6. The use according to claim 1, wherein the Toxoplasma gondii gene knockout strain can proliferate in vitro, has reduced virulence in vivo, and can induce an immune protection response in animals.

Images