High-performance adenine base editor and construction method and application thereof

By performing amino acid mutations on TadA8e and fusing them with nCas9 or enOgeIscBD61A, a low-toxic and high-performance adenine base editor was developed, which solved the problem of high off-targeting of RNA, achieved efficient and accurate A-G single-base replacement, and broadened its application.

CN120424918APending Publication Date: 2025-08-05FUDAN UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510619890.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-13
Publication Date
2025-08-05

AI Technical Summary

Technical Problem

The existing adenine base editor (ABE) has high risk of cytotoxicity due to the high off-targeting of RNA, which limits its safety and efficiency in clinical applications.

Method used

By saturating the key amino acids of the deoxyadenosine deaminase TadA8e, a low-toxic deoxyadenosine deaminase (such as 46E, 84E, 52L, 53R, 62P, 52L53R) is optimized and fused with nCas9 or enOgeIscBD61A to form a high-performance adenine base editor, reducing RNA off-targeting and improving DNA editing efficiency and accuracy.

Benefits of technology

It realizes efficient and accurate A-G single-base replacement of the adenine base editor, reduces the cytotoxicity caused by off-target RNA and broadens its application scope.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120424918A_ABST
    Figure CN120424918A_ABST
Patent Text Reader

Abstract

The invention relates to a high-performance adenine base editor as well as a construction method and application thereof. According to the invention, deoxyadenosine deaminase (46E, 84E, 52L, 53R, 62P and 52L53R) obtained through optimization is fused at the tail end of mutant nuclease represented by Cas9 or OgeIscB, and the obtained new fusion protein can realize accurate and effective A-G base mutation on adenine located in a front spacer sequence. Various fusion proteins obtained by the method disclosed by the invention are low in DNARNA (deoxyribonucleic acid) off-target, high in DNA editing efficiency and accurate in window, and an adenine base editor developed on the basis of OgeIscB is smaller in volume, so that the application of an adenine single base editing tool is effectively widened.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field The present invention relates to the field of gene editing technology, and in particular to a high-performance adenine base editor and a construction method and application thereof. Background Art New gene editing technologies, such as CRISPR / Cas9, offer advantages such as high editing efficiency, significantly advancing the field. Since 2016, researchers have developed a variety of DNA base editing tools based on CRISPR / Cas9 and CRISPR / Cas12a (Cpf1), enabling efficient and precise point mutations at the DNA level without generating double-strand breaks. Currently, two main types of base editors have been reported: cytosine base editors (CBEs, which can mediate C·G to T·A mutations) and adenine base editors (ABEs, which can mediate A·T to G·C mutations). ABEs fuse a directed evolutionary dimer or monomer of the Escherichia coli adenosine deaminase (ecTadA*) with a mutant nuclease (e.g., spCas9 carrying a D10A or mutation, known as nspCas9, or a functionally inactive Cas12a, known as dCas12a). The resulting fusion protein can, under the guidance of a single guide RNA (sgRNA), mediate the A·T to G·C mutation. In recent years, researchers have discovered a variety of new CRISPR systems, such as Casd12f, Cas12j, and TnpB, which are only 400 to 700 amino acids in size. In addition, researchers have also discovered a new IscB system, which has homology with the Cas9 system. The above new CRISPR or CRISPR-like systems have significant DNA cutting activity in mammalian cells. [1-7] , so it is expected to be used in the miniaturization research of base editors. For ABE, since E. coli-derived adenosine deaminase has a very high affinity for single-stranded RNA, it will cause serious RNA off-target and ultimately lead to cytotoxicity. Researchers have found that high-dose injection of E. coli-derived adenosine deaminase mutant TadA8e into zebrafish embryos will cause embryonic survival and morphological abnormalities. [8] Currently, the development and optimization of ABE tools are mostly based on this deaminase. Therefore, the safety risks caused by RNA off-target greatly limit the clinical application of ABE base editors. References are as follows:

[0001] Karvelis,T.et al.PAM recognition by miniature CRISPR-Casd12fnucleases triggers programmabledouble-stranded DNA target cleavage.NucleicAcids Research48,5016-5023(2020).

[0002] Kim,D.Y.et al.Efficient CRISPR editing with a hypercompact Casd12f1and engineered guide RNAs delivered by adeno-associated virus.NatureBiotechnology(2021).

[0003] Xu,X.S.et al.Engineered miniature CRISPR-Cas system for mammaliangenome regulation and editing.Mol Cell 81,4333-+(2021).

[0004] Karvelis,T.et al.Transposon-associated TnpB is a programmable RNA-guided DNA endonuclease.Nature(2021).

[0005] Altae-Tran,H.et al.The widespread IS200 / IS605 transposon familyencodes diverse programmable RNA-guided endonucleases.Science 374,57-65(2021).

[0006] Wu,Z.et al.Programmed genome editing by a miniature CRISPR-Casd12fnuclease.Nat Chem Biol 17,1132-1138(2021).

[0007] Han, DY et al. Development of miniature base editors using engineeredIscB nickase. Nature Methods (2023).

[0008] Xue, NNet al. Improving adenine and dual base editors through introduction of TadA-8e and Rad51DBD. Nature Communications (2023). Summary of the Invention The purpose of the present invention is to provide a high-performance adenine base editor and its construction method and application in order to develop a high-performance adenine base editor ABE. Specifically, it relates to the modification and optimization of a deoxyadenosine deaminase, as well as a variety of adenine base editors and their construction methods and applications. The present invention obtains a variety of high-performance adenine base editors by saturating the key amino acids that exert DNA editing activity of the deaminase TadA8e. The adenine base editors in the present invention are mainly fusion proteins that produce gene point mutations. In order to reduce the cytotoxicity of TadA8e caused by RNA off-target, the present invention optimizes a variety of low-toxic deoxyadenosine deaminases (46E, 84E, 52L, 53R, 62P, 52L53R) by saturation mutation of the key amino acids of the deaminase TadA8e that exert DNA editing activity. The present invention fuses the optimized low-toxicity deoxyadenosine deaminases to the N-terminus of the nCas9 mutant nuclease and the enOgeIscB D61A The N-terminus and C-terminus of the mutant small nuclease were synthesized to produce a new fusion protein. This invention has developed a high-performance adenine base editor that can effectively achieve single-base substitutions of AG. This invention can effectively broaden the application of adenine base editing tools. The purpose of the present invention can be achieved by the following technical solutions: The first object of the present invention is to provide a deoxyadenosine deaminase, and to obtain a variety of high-performance deoxyadenosine deaminases by saturation mutation of the key amino acids that enable the deaminase TadA8e to exert DNA editing activity. The deoxyadenosine deaminases include 46E, 84E, 52L, 53R, 62P, and 52L53R. The amino acid sequence of the deaminase 46E is shown in SEQ ID NO.1, the amino acid sequence of the deaminase 84E is shown in SEQ ID NO.2, the amino acid sequence of the deaminase 52L is shown in SEQ ID NO.3, the amino acid sequence of the deaminase 53R is shown in SEQ ID NO.4, the amino acid sequence of the deaminase 62P is shown in SEQ ID NO.5, and the amino acid sequence of the deaminase 52L53R is shown in SEQ ID NO.6. The second object of the present invention is to provide an adenine base editor, wherein the multiple low-toxicity deoxyadenosine deaminases 46E, 84E, 52L, 53R, 62P and 52L53R obtained by the above optimization are placed in the N-terminal fusion site of the mutant nuclease nCas9 mutant nuclease, or enOgeIscB D61A The N-terminal and C-terminal fusion sites of the mutant small nuclease are fused to form a fusion protein. In one embodiment of the present invention, the amino acid sequence of nCas9 is shown in SEQ ID NO.7, and the enOgeIscB D61A The amino acid sequence is shown in SEQ ID NO.8. In one embodiment of the present invention, the adenine base editor includes ABE8e-N46E, ABE8e-F84E, ABE8e-H52L, ABE8e-D53R, ABE8e-A62P, ABE8e-H52L / D53R, and their amino acid sequences are shown in SEQ ID NO.9-SEQ ID NO.14. In one embodiment of the present invention, the adenine base editor comprises 52L53R-enIscB D61A -52L53R, the amino acid sequence of which is shown in SEQ ID NO.15. The third object of the present invention is to provide a method for constructing an adenine base editor, the specific steps of which are as follows: The various low-toxicity deoxyadenosine deaminases 46E, 84E, 52L, 53R, 62P or 52L53R obtained by the above optimization were respectively placed at the N-terminus of nCas9 to form a fusion, and adenine base editors ABE8e-N46E, ABE8e-F84E, ABE8e-H52L, ABE8e-D53R, ABE8e-A62P or ABE8e-H52L / D53R were constructed. The fourth object of the present invention is to provide a method for constructing an adenine base editor, the specific steps of which are as follows: The various low-toxicity deoxyadenosine deaminases 52L53R obtained by the above optimization were placed in enOgeIscB D61AThe N-terminus and C-terminus formed a fusion to construct the adenine base editor 52L53R-enIscB D61A -52L53R. The fifth object of the present invention is to provide an application of an adenine base editor, which is used as an adenine base editor ABE for mutation of AG bases at specific sites on the DNA level. The sixth object of the present invention is to provide a polynucleotide encoding the fusion protein in the adenine base editor. The seventh object of the present invention is to provide a vector containing the above-mentioned polynucleotide. The eighth object of the present invention is to provide a host cell containing the adenine base editor or the vector. The ninth object of the present invention is to provide a kit comprising reagents for constructing the adenine base editor. The principles of the present invention are as follows: The present invention fuses the optimized low-toxicity deoxyadenosine deaminase (TadA8e-N46E, TadA8e-F84E, TadA8e-H52L, TadA8e-D53R, TadA8e-A62P, TadA8e-H52L / D53R, hereinafter referred to as 46E, 84E, 52L, 53R, 62P, 52L53R) to the N-terminus of the nCas9 mutant nuclease and enOgeIscB D61A The N-terminus and C-terminus of the mutant small nuclease, the resulting new fusion protein can achieve effective AG base mutations for adenine located at different positions of the pre-spacer sequence. The different fusion proteins obtained by the method of the present invention have low DNA\RNA off-target, high DNA editing efficiency and precise window. Among them, the adenine base editor developed based on OgeIscB is smaller in size, which effectively broadens the application of adenine single-base editing tools. Compared with the prior art, the adenine base editor of the present invention has low DNA\RNA off-target, high DNA editing efficiency and precise window. Among them, the adenine base editor developed based on OgeIscB is smaller in size, which can achieve more precise and safer AG single-base replacement, effectively broadens the application of adenine single-base editing tools, and has high application value. Compared with the prior art, the beneficial effects of the present invention are as follows: 1. The present invention performs saturation mutagenesis on the key amino acids that enable the deaminase TadA8e to exert DNA editing activity, and obtains a variety of high-performance deoxyadenosine deaminases. 2. This invention has developed a high-performance adenine base editor based on nCas9 and a high-performance adenine base editor based on enOgeIscB. D61AA high-performance miniaturized adenine base editor based on . BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 The three-dimensional crystal structure of TadA8e and DNA, as well as a schematic diagram of the key amino acids that enable TadA8e to exert its DNA editing activity; Figure 2 RNA off-target assessment of TadA8e mutants with significant ABE activity was performed using a fluorescence reporter system. The vertical axis represents the mean fluorescence intensity (MFI) of mCherry, with n = 3 replicates per group. Figure 3 The three-dimensional crystal structure of TadA8e and DNA, as well as a schematic diagram of the key protein domains that TadA8e uses to exert DNA editing activity. The yellow portion of the figure indicates the key domains. Figure 4 (a) The RNA editing activity of mutants obtained by library screening was verified using a fluorescence reporter system. The horizontal axis represents the mean fluorescence intensity (MFI) of mCherry. (b) The mean fluorescence intensity (MFI) of TadA8e, TadA8e-H52L, TadA8e-D53R, and TadA8e-H52L / D53R in the fluorescence reporter system. (c) The TadA8e mutants obtained by the final screening were fused to the N-terminus of nCas9 to construct the ABE tool and target the endogenous S1 site (containing multiple adenines). The heat map shows the average editing efficiency of three biological replicates of TadA8e mutants, with n = 3 replicates per group. Figure 5 RNA off-target detection of ABE8e mutant. The horizontal axis represents the position of RNA off-target, and the vertical axis represents the efficiency of off-target editing. In the figure, n represents the number of off-target positions, and n = 3 replicates per group. Figure 6 The DNA base editing characteristics of the ABE8e mutant were analyzed. The deaminases used were optimized low-toxic deoxyadenosine deaminases (46E, 84E, 52L, 53R, 62P, and 52L53R). Twelve gRNAs were used to detect base editing characteristics, with n = 3 replicates per group. Figure 7 This is a gRNA-dependent DNA off-target assay for the ABE8e mutant. The deaminases used were optimized, low-toxic deoxyadenosine deaminases (46E, 84E, 52L, 53R, 62P, and 52L53R). The assay targets four positions with sequence similarity to HPE6, with n = 3 replicates per group. Figure 8This is a gRNA-dependent DNA off-target assay for the ABE8e mutant. The deaminases used were optimized low-toxic deoxyadenosine deaminases (46E, 84E, 52L, 53R, 62P, and 52L53R). The detection position was a position similar to the HPE8 sequence. n = 3 replicates per group. Figure 9 For gRNA-independent DNA off-target detection of the ABE8e mutant, the deaminases were optimized with multiple low-toxic deoxyadenosine deaminases (46E, 84E, 52L, 53R, 62P, and 52L53R). Six off-target sites were detected by R-loop assay, with n = 3 replicates per group. Figure 10 52L53R-enIscB D61A -52L53R DNA base editing characteristics. The deaminase used was the optimized low-toxic deoxyadenosine deaminase 52L53R. Eight gRNAs were used to test the base editing characteristics. n = 3 replicates per group; Figure 11 52L53R-enIscB D61A -52L53R gRNA-dependent DNA off-target detection, using the optimized low-toxicity deoxyadenosine deaminase 52L53R as the deaminase, and detecting 15 positions with sequence similarity to PCSK9-S1, with n = 3 replicates per group; Figure 12 52L53R-enIscB D61A -52L53R gRNA-dependent DNA off-target detection. The deaminase was the optimized low-toxic deoxyadenosine deaminase 52L53R. The detection positions were 15 positions similar to the TTR-S1 sequence, with n=3 replicates per group. DETAILED DESCRIPTION The present invention is described in detail below with reference to the accompanying drawings and specific embodiments. This embodiment is implemented based on the technical solution of the present invention, and provides a detailed implementation method and specific operation process, but the protection scope of the present invention is not limited to the following embodiments. In the following examples, the sequence references are as follows: The amino acid sequence of deoxyadenosine deaminase 46E is shown in SEQ ID NO.1: SEVEFSHEYWMRHALTLAKRARDEREVPVGAVLVLNNRVIGEGWERAIGLHDPTAHAEIMALRQGGLVMQNYRLIDATLYVTFEPCVMCAGAMIHSRIGRVVFGVRNSKRGAAGSLMNVLNYPGMNHRVEITEGILADECAALLCDFYRMPRQVFNAQKKAQSSINS; The amino acid sequence of deoxyadenosine deaminase 84E is shown in SEQ ID NO.2: SEVEFSHEYWMRHALTLAKRARDEREVPVGAVLVLNNRVIGEGWNRAIGLHDPTAHAEIMALRQGGLVMQNYRLIDATLYVTEEPCVMCAGAMIHSRIGRVVFGVRNSKRGAAGSLMNVLNYPGMNHRVEITEGILADECAALLCDFYRMPRQVFNAQKKAQSSINS; The amino acid sequence of deoxyadenosine deaminase 52L is shown in SEQ ID NO.3: SEVEFSHEYWMRHALTLAKRARDEREVPVGAVLVLNNRVIGEGWNRAIGLLDPTAHAEIMALRQGGLVMQNYRLIDATLYVTFEPCVMCAGAMIHSRIGRVVFGVRNSKRGAAGSLMNVLNYPGMNHRVEITEGILADECAALLCDFYRMPRQVFNAQKKAQSSIN; The amino acid sequence of deoxyadenosine deaminase 53R is shown in SEQ ID NO.4: SEVEFSHEYWMRHALTLAKRARDEREVPVGAVLVLNNRVIGEGWNRAIGLHRPTAHAEIMALRQGGLVMQNYRLIDATLYVTFEPCVMCAGAMIHSRIGRVVFGVRNSKRGAAGSLMNVLNYPGMNHRVEITEGILADECAALLCDFYRMPRQVFNAQKKAQSSIN; The amino acid sequence of deoxyadenosine deaminase 62P is shown in SEQ ID NO.5: SEVEFSHEYWMRHALTLAKRARDEREVPVGAVLVLNNRVIGEGWNRAIGLHDPTAHAEIMPLRQGGLVMQNYRLIDATLYVTFEPCVMCAGAMIHSRIGRVVFGVRNSKRGAAGSLMNVLNYPGMNHRVEITEGILADECAALLCDFYRMPRQVFNAQKKAQSSIN; The amino acid sequence of deoxyadenosine deaminase 52L53R is shown in SEQ ID NO.6: SEVEFSHEYWMRHALTLAKRARDEREVPVGAVLVLNNRVIGEGWNRAIGLLRPTAHAEIMALRQGGLVMQNYRLIDATLYVTFEPCVMCAGAMIHSRIGRVVFGVRNSKRGAAGSLMNVLNYPGMNHRVEITEGILADECAALLCDFYRMPRQVFNAQKKAQSSIN; The amino acid sequence of nCas9 is shown in SEQ ID NO.7: enOgeIscB D61A The amino acid sequence of is shown in SEQ ID NO.8: AVVYVISKSGKPLMPTTRCGHVRILLKEGKARVVERKPFTIQLTYESAEETQPLVLGIAPGRTNIGMSVVTESGESVFNAQIRTRNKDVPKLMKDRKQYRMAHRRLKRRCKRRRRAKAAGTAFEEGEKQRLLPGCFKPITCKSIRNKEARFNNRKRPVGWLTPTANHLLVTHLNVVKKVQKILPVAKVVLELNRFSFMAMNNPKVQRWQYQRGPLYGKGSVEEAVSMQQDGHCLFCKHGIDHYHHVVPRRKNGSETLENRVGLCEEHHRLVHTDKEWEANLASKKSGMNKKYHALSVLNQIIPYLADQLADMFPGNFCVTSGQDTYLFREEHGIPKDHYLDAYCIACSALTDAKKVSSPKGRPYMVRQFRRHDRQACHKANLNRRYYMGGKLVATNRHKAMDQKTDSLEEYRAAHSAADVSKLTVKHPSAQYKDMSRIMPGSILVSGEGKLFTLRRSEGRNKGQVNYFVSTEGIKYWARKCQYLRNNGGLQIY; The amino acid sequence of the open reading frame ABE8e-N46E is shown in SEQ ID NO.9: The amino acid sequence of the open reading frame ABE8e-F84E is shown in SEQ ID NO.10: The amino acid sequence of the open reading frame ABE8e-H52L is shown in SEQ ID NO.11: The amino acid sequence of the open reading frame ABE8e-D53R is shown in SEQ ID NO.12: The amino acid sequence of the open reading frame ABE8e-A62P is shown in SEQ ID NO.13: The amino acid sequence of the open reading frame ABE8e-H52L / D53R is shown in SEQ ID NO.14: Open reading frame 52L53R-enIscB D61A The amino acid sequence of -52L53R is shown in SEQ ID NO.15: The plasmid sequence of the RNA off-target fluorescent reporter system is shown in SEQ ID NO.16: The plasmid sequence of the RNA off-target analysis reporter system is shown in SEQ ID NO.17: The gRNA sequence of ABE site 1 is shown in SEQ ID NO. 18: GAACACAAAGCATAGACTGC, whose PAM sequence is GGG; The gRNA sequence of ABE site 7 is shown in SEQ ID NO. 19: GAATACTAAGCATAGACTCC, whose PAM sequence is AGG; The gRNA sequence of ABE site 8 is shown in SEQ ID NO. 20: GTAAACAAAGCATAGACTGA, whose PAM sequence is GGG; The gRNA sequence of ABE site 9 is shown in SEQ ID NO. 21: GAAGACCAAGGATAGACTGC, whose PAM sequence is TGG; The gRNA sequence of ABE site 12 is shown in SEQ ID NO. 22: GTAGAAAAAGTATAGACTGC, whose PAM sequence is AGG; The gRNA sequence of ABE site 25 is shown in SEQ ID NO. 23: AGTAAACAAAGCATAGACTG, whose PAM sequence is AGG; The gRNA sequence of SOD is shown in SEQ ID NO. 24: GCCAGACTTAAATCACAGAT, Its PAM sequence is GGG; The gRNA sequence of CHD1-699 is shown in SEQ ID NO.25: AAGGCACAGCCTGTCGAAGC, whose PAM sequence is AGG; The gRNA sequence of RHOA-Y42C is shown in SEQ ID NO. 26: GAACTATGTGGCAGATATCG, whose PAM sequence is AGG; The gRNA sequence of UBE is shown in SEQ ID NO.27: GTACAGTTAGTACTCAGCAG, whose PAM sequence is TGG; The gRNA sequence of HPE6 is shown in SEQ ID NO. 28: GTATAATCCAAAGATGGTCA, whose PAM sequence is AGG; The gRNA sequence of HPE8 is shown in SEQ ID NO. 29: GAAGTATTCATTATAGTCAA, whose PAM sequence is GGG; The sequence of HPE6-OT1 is shown in SEQ ID NO.30: ATGTATTCCAAAGATGGTCA; the sequence of HPE6-OT2 is shown in SEQ ID NO.31: GTATTACCAAAGATGGTCTGGG; the sequence of HPE6-OT3 is shown in SEQ ID NO.32: ATATAATCTTAAGATGGTCAAGG; the sequence of HPE6-OT5 is shown in SEQ ID NO.33: GTATTACCAAAGATGGTCATGG; the sequence of HPE8-OT is shown in SEQ ID NO.34: GAAGCATTCATTATAGTCAAAGG; the vector sequence of SaCas-U6-SITE1 is shown in SEQ ID NO.35: TGGTAGACAGCATGTGTCCTA; The vector sequence of SaCas-U6-SITE2 is shown in SEQ ID NO.36: ATTTACAGCCTGGCCTTTGGGG; The vector sequence of SaCas-U6-SITE3 is shown in SEQ ID NO.37: TGTCAGGTAATGTGCTAAACA; The vector sequence of SaCas-U6-SITE4 is shown in SEQ ID NO.38: GTGGAGGAGGGTGCATGGGGT; The vector sequence of SaCas-U6-SITE5 is shown in SEQ ID NO.39: TCTGCTTCTCCAGCCCTGGC; The vector sequence of SaCas-U6-SITE6 is shown in SEQ ID NO.40: GATGTTCCAATCAGTACGCA; The gRNA sequence of MSTN1 is shown in SEQ ID NO.41: GACTACTTACACTCTG, whose PAM sequence is TAGGCA; The gRNA sequence of MSTN3 is shown in SEQ ID NO.42: CACCAAAAAGATCCAG, whose PAM sequence is AAGGGA; The gRNA sequence of ALDH1A3-S1 is shown in SEQ ID NO. 43: AGTGGAAGAAGGAGAT, whose PAM sequence is AAGGTA; The gRNA sequence of ALDH1A3-S2 is shown in SEQ ID NO. 44: GCTCTGCAGGAACAGG, whose PAM sequence is CAGGTA; The gRNA sequence of VEGFA-S2 is shown in SEQ ID NO.45: GAGACAGCCAAGGTCA, whose PAM sequence is CAGGAA; The gRNA sequence of VEGFA-S3 is shown in SEQ ID NO.46: AGAAATAGAGACCTCA, whose PAM sequence is CAGGAA; The gRNA sequence of TTR-S1 is shown in SEQ ID NO.47: TTAGCTAGGAAGTGAC, whose PAM sequence is CAGGAA; The gRNA sequence of PCSK9-S1 is shown in SEQ ID NO.48: TATCCAGCAGAAGGAT, whose PAM sequence is CAGGAA; The sequence of PCSK9-OT1 is shown in SEQ ID NO. 49: TATTCAGCAGAAGGAT; The sequence of PCSK9-OT2 is shown in SEQ ID NO. 50: TATCCAGGAGAAGGAT; The sequence of PCSK9-OT3 is shown in SEQ ID NO. 51: TGTCCAACAGAAGGAT; The sequence of PCSK9-OT4 is shown in SEQ ID NO. 52: TTTCCAGCAGCAGGAT; The sequence of PCSK9-OT5 is shown in SEQ ID NO. 53: GATCCTGCAGAAGGAT; The sequence of PCSK9-OT6 is shown in SEQ ID NO. 54: TATCCAGCAAATGGAT; The sequence of PCSK9-OT7 is shown in SEQ ID NO. 55: TATCCAACAGAGGGAT; The sequence of PCSK9-OT8 is shown in SEQ ID NO. 56: TATCCAGCATAAGAAT; The sequence of PCSK9-OT9 is shown in SEQ ID NO. 57: TAACTAGCAGAAGGAT; The sequence of PCSK9-OT10 is shown in SEQ ID NO. 58: TTTCCAGCAAAAGGAT; The sequence of PCSK9-OT11 is shown in SEQ ID NO. 59: AATCCAGCAGAAGGCT; The sequence of PCSK9-OT13 is shown in SEQ ID NO.60: TAGCAAGCAGAAGGAT; the sequence of PCSK9-OT14 is shown in SEQ ID NO.61: TATCTAGCAGAAGGAG; the sequence of PCSK9-OT15 is shown in SEQ ID NO.62: TATCCAGAAGAAGGTT. The sequence of TTR-OT1 is shown in SEQ ID NO.63: TTAGCTAGGAAGTTAC; The sequence of TTR-OT2 is shown in SEQ ID NO. 64: TTAGCTGGGAAGTGAC; The sequence of TTR-OT3 is shown in SEQ ID NO. 65: TTAGCTAGGTAGTGCC; the sequence of TTR-OT4 is shown in SEQ ID NO. 66: TTCACTAGGAAGTGAC; The sequence of TTR-OT5 is shown in SEQ ID NO. 67: TTAACTAGGATGTGAC; The sequence of TTR-OT6 is shown in SEQ ID NO. 68: TTAGCTAGAATGTGAC; The sequence of TTR-OT7 is shown in SEQ ID NO. 69: ATAGCTAGAAAGTGAC; The sequence of TTR-OT8 is shown in SEQ ID NO. 70: TTAGCTAGGAACTGTC; The sequence of TTR-OT9 is shown in SEQ ID NO. 71: TTGGCTAGGAAGTGAT; The sequence of TTR-OT10 is shown in SEQ ID NO. 72: ATAGCTAGCAAGTGAC; The sequence of TTR-OT11 is shown in SEQ ID NO. 73: TTAGGTAGGAACTGAC; The sequence of TTR-OT12 is shown in SEQ ID NO. 74: TTAGCTACAAAGTGAC; The sequence of TTR-OT13 is shown in SEQ ID NO. 75: TTAGCCAGGAAGTCAC; The sequence of TTR-OT14 is shown in SEQ ID NO. 76: TTAGCTAGGAAGTATC; The sequence of TTR-OT15 is shown in SEQ ID NO. 77: TTAGCTAGGAAGTGGT; The forward primer sequence for R-loop 1 amplification is shown in SEQ ID NO. 78: gcagtctcctgcttctctgtga; the reverse primer sequence for R-loop 1 amplification is shown in SEQ ID NO. 79: cccagatgagaggatgaaggca; the forward primer sequence for R-loop 2 amplification is shown in SEQ ID NO. 80: cccctgccagcctagcgttg; the reverse primer sequence for R-loop 2 amplification is shown in SEQ ID NO. 81: ccaagttgcctgtccttcctagct; The forward primer sequence for R-loop3 amplification is shown in SEQ ID NO. 82: ctgcacctagcctccatgtcctatt; The reverse primer sequence for R-loop3 amplification is shown in SEQ ID NO. 83: cttatctccttaagtgttcagctgcttt; The forward primer sequence for R-loop4 amplification is shown in SEQ ID NO. 84: tgtgagcccatcaggtattcaa; The reverse primer sequence for R-loop4 amplification is shown in SEQ ID NO. 85: ggcctcaggggaataaatcat; The forward primer sequence for R-loop5 amplification is shown in SEQ ID NO. 86: ggatcccagggaaacgcccatgc; The reverse primer sequence for R-loop5 amplification is shown in SEQ ID NO. 87: gccaaacttgtcaaccagtatcccgg; The forward primer sequence for R-loop6 amplification is shown in SEQ ID NO. 88: gctgggagattgacatgcatttcgacc; The reverse primer sequence for R-loop6 amplification is shown in SEQ ID NO.89: gaccaaagcgccgatggatgtgg. The following describes some embodiments of the present invention in detail with reference to the accompanying drawings. In the absence of conflict, the following embodiments and features in the embodiments may be combined with each other. Example 1 This embodiment provides a method for screening low-toxicity deoxyadenosine deaminase, and the specific steps are as follows: S1. Based on the structural positional relationship between deaminase TadA8e and DNA, the key amino acids for DNA editing activity were determined. Figure 1 , the key amino acids are V28, V30, N46, A48, F84, N108, R111; S2. After fusing TadA8e with nCas9, saturation mutagenesis of the key amino acids obtained in step S1 was performed to screen for deoxyadenosine deaminase mutants with significant ABE editing activity (Zhang SQ et al. Nature Communications (2023)). The screened deoxyadenosine deaminase mutants were co-transfected with an RNA off-target fluorescent reporter system (plasmid sequence shown in SEQ ID NO. 16) into HEK29T cells. After culturing for 48 hours, the mCherry fluorescence intensity of the cells was analyzed by flow cytometry. Mutants N46E and F84E with strong mCherry fluorescence were considered to be low-toxic deoxyadenosine deaminases, see Figure 2 ; S3. The low-toxicity deoxyadenosine deaminase screened in step S2 was placed at the N-terminus of nCas9 to obtain fusion proteins ABE8e-N46E and ABE8e-F84E (the amino acid sequences of the open reading frames are shown in SEQ ID NO. 9 to SEQ ID NO. 10); S4. Based on the key protein functional domains of TadA8e, see Figure 3 , the key protein domain includes H52, D53, P54, T55, A56, H57, A58, E59, I60, M61, A62, L63, R64, Q65, and G66; S5. Based on the key protein functional domain of the deaminase in the base editor obtained in step S4, a TadA8e saturation mutation library was constructed for amino acids. The library was co-transfected into HEK29T cells with an RNA off-target fluorescent reporter system (the plasmid sequence is shown in SEQ ID NO. 16). After 48 hours of cell culture, mutants with strong mCherry fluorescence, i.e., low-toxicity deoxyadenosine deaminase, were selected by flow cytometry. 28 TadA8e mutants were initially screened out. The fluorescent reporter system was again used to co-transfect the 28 TadA8e mutants and fluorescence analysis was performed. The results showed that 22 of the TadA8e mutants were able to restore mCherry fluorescence intensity to varying degrees. Figure 4a; S7. We observed that the H52L and D53R mutants of TadA8e exhibited higher A·T to G·C DNA editing activity, with the D53R mutant exhibiting a more precise editing window. Combining the H52L and D53R mutations revealed that the TadA8e-H52L / D53R mutant almost completely restored mCherry fluorescence intensity compared to single amino acid mutations, indicating that the RNA editing activity of the TadA8e-H52L / D53R mutant was further reduced. Figure 4 b; S8. The TadA8e mutants obtained by screening were placed at the N-terminus of nCas9 to obtain fusion proteins ABE8e-H52L, ABE8e-D53R, ABE8e-A62P, and ABE8e-H52L / D53R. (The amino acid sequences of the open reading frames are shown in SEQ ID NO. 11 to SEQ ID NO. 14). Figure 4 c. Example 2 This example provides a method for analyzing the RNA off-target editing activity of low-toxic deoxyadenosine deaminase, and the specific steps are as follows: ABE8e-N46E, ABE8e-F84E, ABE8e-H52L, ABE8e-D53R, ABE8e-A62P, ABE8e-H52L / D53R adenine base editors obtained in Example 1 and existing tools ABE8e-28G46C, ABE8e-GGATY, ABE8e-N46L, ABE8e-mu, ABE8e-V106W, ABE8e-N108Q / L145T, among which ABE8e-28G46C, ABE8e-GGATY, and ABE8e-N46L do not have ABE editing activity and serve as positive controls. They were co-transfected into 293T cells with the RNA off-target analysis reporter system (plasmid sequence as shown in SEQ ID NO.17). After 72 hours of cell culture, RNA was extracted for library construction and analysis. The sequencing results of the library are compared with the gene sequence of the reporter system to analyze the efficiency, location and quantity of RNA off-target. The results are as follows Figure 5The results showed that the overall off-target editing levels of RNA of ABE8e-N46E, ABE8e-F84E, ABE8e-H52L, ABE8e-D53R, ABE8e-A62P, and ABE8e-H52L / D53R were low, with 17, 35, 178, 128, 25, and 5 adenosine editing sites detected, respectively. In the positive control groups ABE8e-28G46C, ABE8e-GGATY, and ABE8e-N46L, the adenosine editing sites were 3, 3, and 5, respectively, and ABE8e-H52L / D53R was close to the positive control group. The numbers of adenosine editing sites of other existing tools ABE8e-mu, ABE8e-V106W, and ABE8e-N108Q / L145T were 116, 305, and 29, respectively. Example 3 This example provides a method for transfecting HEK293T cells with an ABE8e mutant and a gRNA expression vector and detecting point mutation characteristics. The specific steps are as follows: S1. ABE8e-N46E, ABE8e-F84E, ABE8e-H52L, ABE8e-D53R, ABE8e-A62P, and ABE8e-H52L / D53R obtained in Example 1 were co-transfected with 12 sgRNAs selected from the human genome (the 12 gRNAs were ABEsite1, ABE site7, ABE site8, ABE site9, ABE site12, ABE site25, SOD, CHD1-699, RHOA-Y42C, UBE, HPE6, and HPE8, and the gRNA vector sequences were shown in SEQ ID NO.18 to SEQ ID NO.29. The vectors were digested with BsaI and ligated with the annealed products of the gRNA primers) into cultured 293T cells. After 72 hours of cell culture, double-positive cells expressing both EGFP and mCherry were collected by FACS. S2. Extract the genome from the double-positive cells collected in step S1 and perform targeted PCR using primers that specifically amplify the gRNA target site information. Next-generation sequencing is used to analyze the editing efficiency and window of the ABE8e mutant at multiple sites, and the results are summarized and analyzed. The results are as follows Figure 6ABE8e-H52L exhibited a similar DNA editing window across the A2 to A12 region of the 12 endogenous sites, with an A·T to G·C editing efficiency exceeding 20%, comparable to that of ABE8e. ABE8e-D53R, on the other hand, exhibited a narrower DNA editing window from A3 to A8, with the highest editing activity at A5. The editing window for ABE8e-H52L / D53R was primarily located in the A4 to A7 region, while that for ABE8e-N46E, ABE8e-F84E, and ABE8e-A62P was primarily located in the A5 to A6 region, with the highest editing activity at A5. The optimized ABE8e mutants, particularly ABE8e-H52L / D53R, exhibited high editing efficiency and precise editing windows. Example 4 This example provides a gRNA-dependent off-target analysis method for an ABE8e mutant at the HPE6 position, and the specific steps are as follows: S1. DNA editing activity was detected at the four gRNA-dependent off-target (OT) sites identified by the EndoV-seq method in Example 2. The OT sites are located in the HPE6 (HPRT exon 6) region. ABE8e-N46E, ABE8e-F84E, ABE8e-H52L, ABE8e-D53R, ABE8e-A62P, and ABE8e-H52L / D53R obtained in Example 1 were co-transfected with HPE6 gRNA into cultured 293T cells. After 72 hours of cell culture, double-positive cells expressing both EGFP and mCherry were collected by FACS. S2. The four off-target (OT) sites similar to the HPE6 gRNA identified by the EndoV-seq method are HPE6-OT1, HPE6-OT2, HPE6-OT3, and HPE6-OT5. The gRNA-dependent off-target editing efficiency produced by the OT position is detected. The sequences of HPE6-OT1, HPE6-OT2, HPE6-OT3, and HPE6-OT5 are shown in SEQ ID NO.30 to SEQ ID NO.33. The sequences of the above sites are close to the sgRNA sequence of HPE6. The genome of the double-positive cells collected in step S1 was extracted, and directional PCR was performed using primers that can specifically amplify the off-target site information. The editing efficiency of the ABE8e mutant at the multiple off-target sites was analyzed by second-generation sequencing, and the results were analyzed. The results are as follows Figure 7As shown, ABE8e exhibited significant off-target editing at the four OT sites of HPE6, with editing efficiencies ranging from 9.91% to 45.5% (average 22.1%). In contrast, the off-target editing efficiencies of the ABE8e-N46E, ABE8e-F84E, ABE8e-A62P, and ABE8e-H52L / D53R mutants were significantly reduced, with average off-target editing efficiencies of 1.43%, 0.81%, 1.09%, and 5.99% at the HPE6 OT site, respectively. The optimized ABE8e mutants exhibited lower gRNA-dependent off-target editing efficiencies across multiple off-target sites compared to ABE8e. Example 5 This example provides a gRNA-dependent off-target analysis method for an ABE8e mutant at the HPE8 position, and the specific steps are as follows: S1. DNA editing activity was detected at a gRNA-dependent off-target (OT) site identified by EndoV-seq in Example 2. The OT site is located in the HPE8 (HPRT exon 8) region. ABE8e-N46E, ABE8e-F84E, ABE8e-H52L, ABE8e-D53R, ABE8e-A62P, and ABE8e-H52L / D53R, screened in Example 1, were co-transfected with the HPE8 gRNA into cultured 293T cells. After 72 hours of cell culture, double-positive cells expressing both EGFP and mCherry were collected by FACS. S2. An off-target (OT) site, HPE8-OT, similar to the HPE8 gRNA, was identified by the EndoV-seq method. The gRNA-dependent off-target editing efficiency at this position was detected. The sequence of HPE8-OT is shown in SEQ ID NO.34. The sequence of this site is close to the sgRNA sequence of HPE8. The genome of the double-positive cells collected in step S1 was extracted, and directional PCR was performed using primers that can specifically amplify off-target site information. The editing efficiency of the ABE8e mutant at multiple off-target sites was analyzed by second-generation sequencing, and the results were analyzed. The results are as follows Figure 8 As shown, the off-target editing efficiency of ABE8e at the HPE8 OT site was 21.3%. N46E 、ABE8e F84E 、ABE8e A62P and ABE8e H52L / D53R The off-target editing efficiency of the mutants was significantly reduced, with the average off-target editing efficiencies at the HPE8 OT site being 6.84%, 3.72%, 2.24% and 13.6%, respectively. Example 6 This example provides a gRNA-independent off-target analysis method for ABE8e mutants, and the specific steps are as follows: S1. ABE8e-N46E, ABE8e-F84E, ABE8e-H52L, ABE8e-D53R, ABE8e-A62P, and ABE8e-H52L / D53R obtained in Example 1 were co-transfected with SaCas-U6-SITE1 to SaCas-U6-SITE6 (vector sequences are shown in SEQ ID NOs. 35 to 40, and the vectors were digested with BsaI and ligated with the annealed products of the SITE1 to SITE6 primers) into cultured 293T cells. After 72 hours of cell culture, double-positive cells expressing both EGFP and mCherry were collected by FACS. S2. Extract the genome from the double-positive cells collected in step S1 and perform targeted PCR using primers that specifically amplify off-target sites (primer sequences are shown in SEQ ID NO. 78 to SEQ ID NO. 89). Analyze the editing efficiency of the ABE8e mutant at various off-target sites using next-generation sequencing and analyze the results. The results are as follows Figure 9 As shown in the figure, the ABE8e-N46E, ABE8e-F84E, ABE8e-A62P and ABE8e-H52L / D53R mutants had significantly reduced non-Cas9-dependent off-target editing activity compared to ABE8e, and their average off-target editing efficiencies were 0.85%, 0.81%, 0.86% and 1.12%, respectively, which were close to the background level (0.88%), while the average off-target editing efficiency of ABE8e was 5.16%. Example 7 This embodiment provides a 52L53R-enIscB D61A The method for transfecting HEK293T cells with -52L53R and gRNA expression vectors and detecting point mutation characteristics is as follows: S1. The TadA8e-H52L / D53R double-point mutant deaminase obtained by the previous screening was combined with the miniaturized enIscB D61A Double-end fusion of nucleases to obtain the miniaturized ABE tool 52L53R-enIscB D61A-52L53R; and co-transfected with eight gRNAs (MSTN1, MSTN3, ALDH1A3-S1, ALDH1A3-S2, VEGFA-S2, VEGFA-S3, TTR-S1, and PCSK9-S1; gRNA vector sequences are shown in SEQ ID NOs. 41 to 48, digested with BsaI and ligated with the annealed products of the gRNA primers) into cultured 293T cells. After 72-96 hours of cell culture, cells expressing both EGFP and mCherry were harvested by FACS. S2. Extract the genome of the double-positive cells collected in step S1 and perform directional PCR using primers that can specifically amplify the gRNA target site information. D61A -52L53R editing efficiency and window at multiple sites, and summarize and analyze the results. The results are as follows Figure 10 As shown, 52L53R-enIscB D61A -52L53R retains the same structure as the classic TadA8e-enIscB D61A -TadA8e miniaturized ABE has comparable editing activity and a more precise editing window. D61A -52L53R's DNA editing activity window is mainly concentrated in the range of A5 to A8, with an editing efficiency of >40%; while TadA8e-enIscB D61A -The DNA editing activity window of TadA8e is between A3 and A12, which has a wider editing window. Example 8 This embodiment provides a 52L53R-enIscB D61A -52L53R gRNA-dependent off-target analysis method at the PCSK9 position, the specific steps are as follows: S1, 52L53R-enIscB D61A -52L53R was co-transfected with PCSK9 gRNA into cultured 293T cells. After 72 hours of cell culture, double-positive cells expressing both EGFP and mCherry were collected by FACS. S2. The DNA editing activity of 14 gRNA-dependent off-target (OT) sites identified by the EndoV-seq method in Example 2 was detected, namely PCSK9-OT1, PCSK9-OT2, PCSK9-OT3, PCSK9-OT4, PCSK9-OT5, PCSK9-OT6, PCSK9-OT7, PCSK9-OT8, PCSK9-OT9, PCSK9-OT10, PCSK9-OT11, PCSK9-OT13, PCSK9-OT14, PCSK9-OT15, and the sequences are shown in SEQ ID NO.49 to SEQ ID NO.62. The sequences of the above sites are close to the sgRNA sequence of PCSK9. The genome of the double-positive cells collected in step S1 was extracted, and directional PCR was performed using primers that can specifically amplify off-target site information. 52L53R-enIscB was analyzed by second-generation sequencing. D61A -52L53R editing efficiency at multiple off-target sites and analyze the results. The results are as follows Figure 11 As shown, 52L53R-enIscB D61A The average off-target editing efficiency of -52L53R at all off-target sites was 2.3%, which was comparable to that of 8e-enIscB. D61A -8e (average off-target editing efficiency of 3.7%) has lower gRNA-dependent off-target editing efficiency than the overall, especially at the PCSK9-OT1, PCSK9-OT9, and PCSK9-OT14 positions. Example 9 This embodiment provides a 52L53R-enIscB D61A -52L53R gRNA-dependent off-target analysis method at the TTR position, the specific steps are as follows: S1, 52L53R-enIscB D61A -52L53R was co-transfected with PCSK9 gRNA into cultured 293T cells. After 72 hours of cell culture, double-positive cells expressing both EGFP and mCherry were collected by FACS. S2. Detect DNA editing activity at 15 gRNA-dependent off-target (OT) sites identified by the EndoV-seq method in Example 2, namely TTR-OT1, TTR-OT2, TTR-OT3, TTR-OT4, TTR-OT5, TTR-OT6, TTR-OT7, TTR-OT8, TTR-OT9, TTR-OT10, TTR-OT11, TTR-OT12, TTR-OT13, TTR-OT14, TTR-OT15, and the sequences are shown in SEQ ID NO.63 to SEQ ID NO.77. The sequences of the above sites are close to the sgRNA sequence of TTR. The genome of the double-positive cells collected in step S1 was extracted, and directional PCR was performed using primers that can specifically amplify off-target site information. By second-generation sequencing, 52L53R-enIscB was analyzed. D61A -52L53R editing efficiency at multiple off-target sites and analyze the results. The results are as follows Figure 12 As shown, 52L53R-enIscB D61A The average off-target editing efficiency of -52L53R at all off-target sites was 4.8%, which was comparable to that of 8e-enIscB. D61A -8e (average off-target editing efficiency of 8.1%) has lower gRNA-dependent off-target editing efficiency than the overall. Therefore, the adenine base editor of the present invention has low DNA\RNA off-target effect, high DNA editing efficiency and precise window. Among them, the adenine base editor developed based on OgeIscB is smaller in size and can achieve more precise and safer AG single-base replacement, effectively broadening the application of adenine single-base editing tools and has high application value. The above description of the embodiments is intended to facilitate understanding and use of the invention by those skilled in the art. It will be apparent that those skilled in the art can readily make various modifications to these embodiments and apply the general principles described herein to other embodiments without requiring inventive effort. Therefore, the present invention is not limited to the above-described embodiments. Improvements and modifications made by those skilled in the art based on the disclosure of the present invention, without departing from the scope of the present invention, should be within the scope of protection of the present invention.

Claims

1. A deoxyadenosine deaminase, characterized in that Saturation mutagenesis of the key amino acids that contribute to the DNA editing activity of the deaminase TadA8e was performed to obtain a variety of high-performance deoxyadenosine deaminases, including 46E, 84E, 52L, 53R, 62P, and 52L53R. The amino acid sequence of the deaminase 46E is shown in SEQ ID NO.1, the amino acid sequence of the deaminase 84E is shown in SEQ ID NO.2, the amino acid sequence of the deaminase 52L is shown in SEQ ID NO.3, the amino acid sequence of the deaminase 53R is shown in SEQ ID NO.4, the amino acid sequence of the deaminase 62P is shown in SEQ ID NO.5, and the amino acid sequence of the deaminase 52L53R is shown in SEQ ID NO.

6.

2. An adenine base editor, characterized in that The multiple low-toxicity deoxyadenosine deaminases 46E, 84E, 52L, 53R, 62P and 52L53R obtained by optimizing claim 1 are placed in the N-terminal fusion site of the mutant nuclease nCas9 mutant nuclease, or enOgeIscB D61A The N-terminal and C-terminal fusion sites of the mutant small nuclease are fused to form a fusion protein.

3. An adenine base editor according to claim 2, characterized in that The amino acid sequence of nCas9 is shown in SEQ ID NO.7, and the enOgeIscB D61A The amino acid sequence is shown in SEQ ID NO.

8.

4. An adenine base editor according to claim 2, characterized in that The adenine base editors include ABE8e-N46E, ABE8e-F84E, ABE8e-H52L, ABE8e-D53R, ABE8e-A62P, and ABE8e-H52L / D53R, and their amino acid sequences are shown in SEQ ID NO.9-SEQ ID NO.

14.

5. An adenine base editor according to claim 2, characterized in that The adenine base editor includes 52L53R-enIscB D61A -52L53R, the amino acid sequence of which is shown in SEQ ID NO.

15.

6. A method for constructing an adenine base editor according to any one of claims 2 to 4, characterized in that: The specific steps are as follows: A plurality of low-toxicity deoxyadenosine deaminases 46E, 84E, 52L, 53R, 62P or 52L53R obtained by optimization according to claim 1 are respectively placed at the N-terminus of nCas9 to form a fusion, thereby constructing adenine base editors ABE8e-N46E, ABE8e-F84E, ABE8e-H52L, ABE8e-D53R, ABE8e-A62P or ABE8e-H52L / D53R.

7. A method for constructing an adenine base editor according to claim 2, claim 3 or claim 5, characterized in that: The specific steps are as follows: The multiple low-toxicity deoxyadenosine deaminases 52L53R obtained by optimization of claim 1 are placed in enOgeIscB D61A The N-terminus and C-terminus formed a fusion to construct the adenine base editor 52L53R-enIscB D61A -52L53R.

8. A use of an adenine base editor according to any one of claims 2 to 5, characterized in that: The adenine base editor is used as an adenine base editor ABE, which is used for mutation of AG bases at specific sites at the DNA level.

9. A polynucleotide, characterized in that Encoding a fusion protein related to the adenine base editor described in any one of claims 2-5.

10. A kit, characterized in that Comprising reagents for constructing the adenine base editor described in any one of claims 2-5.