MiR-206 related to trichomonad resistance of pigeon and application of target gene AMER3 of miR-206

Abstract

The invention discloses miR-206 related to resistance to trichomonad of pigeon and application of a target gene AMER3 of the miR-206. The application has the beneficial effects that the AMER3 gene differentially expressed in a resistance group and a susceptible group after trichomonad infection and miR-206 having a regulation relationship with the AMER3 gene are successfully screened, and the AMER3 gene is highly expressed in the resistance group, can promote proliferation and migration of pigeon craw cells, has an effect of resisting trichomonad and is negatively regulated by the miR-206; the miR-206 and the target gene AMER3 thereof can be used as molecular markers or targets for resisting trichomonas pigeonae infection, and are applied to clarification of a molecular mechanism of in-vivo immune regulation after the pigeons are infected with trichomonas pigeonae and breeding of trichomonas pigeonae anti-infection groups.

Description

Technical Field

[0001] The present invention relates to the field of non-coding RNA and its regulated target genes and application technology, specifically miR-206 and its target gene related to pigeon trichomoniasis resistance AMER3 application. Background Art

[0002] Trichomoniasis is a common parasitic disease in pigeons, primarily infecting digestive tract tissues such as the mouth, pharynx, esophagus, and crop. Trichomonas is widely transmitted and easily causes secondary infections, leading to significant economic losses. Currently, medicinal plant extracts and chemically synthesized drugs are commonly used in production to prevent and treat trichomoniasis, but these can easily lead to drug resistance and residues, which can harm human health as livestock and poultry products. MicroRNAs (miRNAs) are a class of single-stranded RNAs approximately 22 nucleotides in length that lack coding potential and are widely present in nature. The miRNA seed sequence base-pairs with the 3' UTR or CDS region of mRNA, promoting mRNA degradation or inhibiting gene translation, thereby exerting post-transcriptional regulatory effects. miRNAs are widely involved in various biological processes, including plant and animal development, cancer development, cell differentiation, apoptosis, and metabolism. Studies have shown that miRNAs play an important role in regulating the host immune response to parasitic infections. Host miRNAs in mammalian cells have been shown to regulate cellular responses to infection by various pathogens, including viruses, parasites, and bacteria. MiR-223 is specifically expressed in neutrophils of the human gastric mucosa infected with Helicobacter pylori. MiR-21 has been identified as an oncogenic miRNA due to its abnormal overexpression in many cancers. The above studies indicate that miRNAs play a key role in the host immune process, but the molecular mechanism by which miRNAs regulate Trichomonas infection and fibroblast proliferation, apoptosis, and invasion remains to be studied. Summary of the Invention

[0003] The purpose of the present invention is to solve the above problems and design miR-206 and its target gene related to pigeon trichomoniasis resistance AMER3 application.

[0004] To achieve the above-mentioned purpose, the technical solution of the present invention is to identify miR-206 related to pigeon trichomoniasis resistance, wherein the nucleotide sequence of miR-206 is SEQ ID NO. 1: TGACCTGTCCCGCTGTCCCCAGA.

[0005] In a further supplement to this technical solution, the target gene regulated is APC Membrane Recruitment Protein 3, AMER3 ), the nucleotide sequence of which is shown in SEQ ID NO.4).

[0006] Application of miR-206, which is associated with pigeon trichomoniasis resistance, as a molecular marker in the prevention of pigeon Trichomonas infection.

[0007] A use of the target gene APC membrane-bound protein 3 regulated by miR-206 as a molecular marker or target in preventing pigeon Trichomonas infection; The present invention conducts a trichomonas challenge test on one-day-old squabs, performs miRNA-mRNA analysis on oral tissues using high-throughput sequencing technology, and screens out miR-206, which is significantly associated with pigeons' resistance to trichomonas infection. The nucleotide sequence of miR-206 is shown in SEQ ID NO.1, and its target gene AMER3 (Its nucleotide sequence is SEQ ID NO.4).

[0008] The present invention further proves through experimental verification that miR-206 and AMER3 Significant differential expression between the Trichomonas resistant and susceptible groups indicates that miR-206 can be targeted and regulated AMER3 Express.

[0009] Therefore, the application of the target gene APC membrane-bound protein 3 regulated by miR-206, which is related to the immune response after pigeons are infected with Trichomonas, as a molecular marker or target in the prevention of pigeon Trichomonas infection includes the following steps: (1) Determine the infection status of pigeons with Trichomonas: Collect pharyngeal swabs from the pigeons’ mouths and count them under a microscope. The infection status of pigeons with Trichomonas can be determined based on the number of Trichomonas. (2) Prediction of the expression of resistance-related miRNAs and their target genes: Detection of the oral tissues of the tested pigeons AMER3 Gene expression level.

[0010] A fluorescent quantitative PCR kit for predicting resistance to pigeon Trichomonas infection, comprising: RNA reverse transcription reagent, fluorescent quantitative RT-PCR amplification reagent, AMER3 Gene fluorescence quantitative PCR primer pair; wherein, AMER3 The nucleotide sequences of the gene fluorescence quantitative PCR primer pairs are shown in SEQ ID NO.2 and SEQ ID NO.3; SEQ ID NO.2: TACCAGGGCAGCAAGGAATG; SEQ ID NO. 3: TTGACAAGTCGCCCCTTACC.

[0011] To further supplement this technical solution, the method for operating the kit for predicting the infection status of pigeon Trichomonas includes the following steps: (1) Extracting total RNA from oral tissue samples of pigeons to be tested; (2) Using the tailing reverse transcription kit AMER3 Reverse transcription of genes; (3) Using the amplification primers shown in SEQ ID NO.2 and SEQ ID NO.3 to carry out the AMER3 Fluorescence quantitative PCR detection of genes; (4) Detection of miRNA and AMER3 The expression level of genes predicts resistance to pigeon Trichomonas infection.

[0012] Regulatory targets of miR-206 AMER3 The expression level of the gene is also related to the resistance of pigeons to Trichomonas infection, and can also be used as a molecular marker to predict the resistance of pigeons to Trichomonas infection. When applied, miR-206 can be used alone or in combination with miR-206. AMER3 The two are used in combination to further improve the accuracy of detection.

[0013] Pigeon crop tissue is the main site of Trichomonas infection, and AMER3 High gene expression can promote the proliferation and migration of crop fibroblasts and inhibit their apoptosis. It still has the function of promoting the normal growth and development of crop tissue after infection with Trichomonas, reflecting its resistance to pigeon trichomoniasis.

[0014] Its beneficial effect is that the present invention successfully screened out the highly expressed genes in the oral tissue of the resistance group. AMER3 Genes and regulation AMER3 The gene-expressed miR-206 can be used as a molecular marker or target for pigeons to resist Trichomonas infection, and can be used to predict the pigeons' resistance to Trichomonas infection. It is also beneficial to further use it as a molecular marker for breeding pigeons to resist Trichomonas infection, and has great application prospects and theoretical value. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 For miR-206 and AMER3 Binding site information; Figure 2 This is the dual luciferase reporter gene test vector information in Example 3 of the present invention; Figure 3 For miR-206 in Example 3 of the present invention AMER3 negative regulatory effects; Figure 4 In Example 4 of the present invention AMER3 Line graph of promoting crop fibroblast proliferation; Figure 5 In Example 4 of the present invention AMER3Promote crop fibroblast migration cell diagram and bar graph; Figure 6 In Example 4 of the present invention AMER3 Inhibition of apoptosis in crop fibroblasts. Bar graph. DETAILED DESCRIPTION

[0016] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods, devices, and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods, devices, and materials are now described.

[0017] The term "polynucleotide" or "nucleotide" means deoxyribonucleotides, deoxyribonucleosides, ribonucleosides, or ribonucleotides and polymers thereof in single-stranded or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides that have binding properties similar to the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise specifically limited, the term also refers to oligonucleotide analogs, including PNA (peptide nucleic acid), DNA analogs used in antisense technology (phosphorothioates, phosphamidates, etc.). Unless otherwise specified, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (including but not limited to degenerate codon substitutions) and complementary sequences as well as explicitly specified sequences. In particular, degenerate codon substitutions can be achieved by generating a sequence in which position 3 of one or more selected (or all) codons is substituted with mixed bases and / or deoxyinosine residues.

[0018] miRNA (MicroRNA) is a class of non-coding single-stranded RNA molecules with a length of approximately 22 nucleotides encoded by endogenous genes. They are involved in post-transcriptional gene expression regulation in animals and plants. Example 1 Screening for Molecular Markers Related to Immunity in Pigeons Infected with Trichomonas 1. Test methods 1.1 Trichomonas infection and testing

[0019] One hundred and thirty-five one-day-old white king pigeons were randomly divided into a control group (35 pigeons) and a challenge group (100 pigeons) and housed in two separate isolation cages. The challenge group was inoculated intranasally with 0.5 mL of 5×10 6 Trichomonas parasites / mL. Oral swabs were collected from each pigeon 1, 2, 3, 4, and 7 days after the first inoculation, placed in 1.5 mL of normal saline (pH 6.8), and stored at room temperature. Trichomonas were counted using a hemocytometer under a microscope. The control group (C) was inoculated intranasally with an equal volume of Trichomonas-free culture medium. The experimental period was 15 days. 2. Phenotypic Testing and Sample Collection

[0020] Three days after infection, the infected pigeons were divided into susceptible and resistant groups based on the presence of Trichomonas in their oral cavity. The four individuals with the most Trichomonas were selected as the susceptible group (S). The average number of Trichomonas in the S group was 3.25×10 4 Four individuals without Trichomonas in their oral cavity were selected as the resistant group (T); the average Trichomonas count in the T group was 0. Three pigeons were selected from the C group. Three, four, and four pigeons in the C, S, and T groups, respectively, were euthanized by cervical dislocation, and oral samples were collected. RNA was extracted and then subjected to RNA sequencing. 1.3 RNA sample preparation

[0021] Total RNA was extracted from oral tissue using the TRIzol kit (Invitrogen, USA) in a sterile environment. The purity and concentration of the extracted RNA were determined using a NanoDrop 2000 UV spectrophotometer and analyzed for RNA degradation and contamination on a 1.5% agarose gel. The RIN values of the sample RNA were determined using a Bioanalyzer 2100. Library construction and sequencing requirements required a minimum of 6 μg of total RNA, a ratio of OD at 260 nm to OD at 280 nm within the range of 1.8–2.2, a RIN of ≥7 and a 28S / 18S ratio of ≥1.0, and a concentration of ≥65 ng / μL to ensure that qualified samples were used for transcriptome sequencing. Samples meeting these requirements were considered for the next step. Example 2 Analysis of regulatory relationships between miRNAs and their target genes and associated signaling pathways 1. Library Construction and Sequencing

[0022] Sample rRNA was removed using the Epicentre Ribo-Zero™ kit. The sample was then fragmented, and first-strand cDNA was synthesized using random primers and reverse transcriptase, followed by double-stranded cDNA. The purified double-stranded cDNA was end-repaired, A-terminated, and ligated with sequencing adapters. Finally, a cDNA library was amplified by PCR. After the library passed quality control, it was sequenced using an Illumina HiSeq sequencer to generate raw sequencing data. 2. miRNA screening and target gene prediction

[0023] Clean reads were generated after quality control of the raw sequencing data. Using the Columba livia 1.0 genome as the reference genome, we compared reads aligned to the reference genome with the mature sequences of known miRNAs in the miRBase (v22) database, as well as the 2nt upstream and 5nt downstream regions. A maximum of one mismatch was allowed, and reads identified in this manner were considered to be known miRNAs. MiRNA transcription start sites are often located in intergenic regions, introns, and the reverse complement of coding sequences. Their precursors possess a characteristic hairpin structure, and the mature form is formed by cleavage by Dicer / DCL enzymes. To identify miRNA biological characteristics, miRDeep2 software was used to predict novel miRNAs for sequences not identified with known miRNAs.

[0024] We used the miRDeep2 software package to obtain possible precursor sequences by aligning reads to the position information on the genome. Based on the distribution information of reads on the precursor sequence (based on the characteristics of miRNA production) and the precursor structure energy information, we used a Bayesian model to score and finally predicted new miRNAs. 3. Analysis of miRNA and gene expression patterns

[0025] In the process of differentially expressed miRNA detection, |log2(FC)|≥1.00 was used; P- The value ≤ 0.05 was used as the screening standard. The fold change (FC) represents the ratio of the expression levels between two samples (groups). P The value can be expressed as the probability of no difference in expression. Since the differential expression analysis of miRNA is an independent statistical hypothesis test of a large number of miRNA expression levels, there will be a false positive problem. Therefore, during the analysis process, the Benjamini-Hochberg correction method was used to correct the significance of the original hypothesis test. P The values were corrected, and the false discovery rate (FDR) was finally used as the key indicator for screening differentially expressed miRNAs. 4. Prediction of miRNA target genes

[0026] Based on the known miRNAs, newly predicted miRNAs and pigeon gene sequence information, target genes were predicted using miRanda and targetscan. Example 3 Verification of the targeting relationship between miRNA and its target gene 1. Vector Construction

[0027] Based on the previous miRNA target gene prediction results, candidate target genes were determined and miR-206 and target genes were predicted using gene biological prediction software. AMER3 3'-UTR binding site information ( Figure 1 ), synthesize the candidate target gene 3'-UTR fragment and sequence it, use the restriction endonuclease XbaI to cut it, and connect it to the GP-miRGLO vector ( Figure 2 ), which contains the firefly luciferase gene (firefly-luciferase) and the Renilla luciferase gene (hRluc-neo fusion). According to the prediction results of miR-206 target genes and AMER3 The 3'-UTR region sequence of the gene was used to construct the wild-type vector GP-miRGLO / AMER3 -wt and mutant vector GP-miRGLO / AMER3 -mut, constructed by Suzhou Genema Gene Co., Ltd. 2. Cell Transfection

[0028] 293T cells were transfected in 24-well plates, with at least three replicates for each plasmid. Transfection was performed according to the instructions of Lipofectamine 3000 transfection reagent. 3. Dual luciferase reporter gene assay

[0029] Build AMER3 -wt or AMER3 -mut vector, co-transfected with miR-206 mimics or negative control 293T cells, and luminescence values were detected using Promega's dual luciferase assay kit on a UV multifunctional microplate reader 48 hours after transfection. AMER3 Gene targeting and inhibition of gene expression ( Figure 3 ).

[0030] Example 4 AMER3 Effects on crop fibroblasts 1. Cell Proliferation

[0031] 5×10 per well 4 Cells were seeded at a concentration of 100 cells / well in a 96-well cell culture plate for transfection, with five replicates per group. Cell proliferation was measured 24, 48, and 72 hours after transfection. Before testing, 10 μl of CCK-8 solution was added to each well and incubated in a cell culture incubator for another 2 hours. The absorbance at 450 nm was measured using a microplate reader. AMER3 Genes can promote the proliferation of crop fibroblasts ( Figure 4 ). 2. Cell Migration

[0032] Transwell cell chambers with a pore size of 8 μm were placed in a 24-well culture plate to prepare a density of 5×10 4 100 μL of cell suspension was added to the upper chamber and 500 μL of complete culture medium was added to the lower chamber. After culturing for 24 hours, the culture medium was discarded and the cells were fixed with paraformaldehyde for 30 minutes and stained with crystal violet for 15 minutes. The cells were observed and photographed under a microscope and the number of migrated cells was counted. AMER3 Genes can promote crop fibroblast migration ( Figure 5 ). 3. Apoptosis

[0033] Cells were seeded in a 6-well plate and cultured for 24 h. The cell culture medium was collected into a centrifuge tube and digested with EDTA-free trypsin. The cells were collected and added with the previously collected cell culture medium. The tubes were centrifuged at 1000 rpm for 5 min and washed twice with PBS. The cells were resuspended in the diluted Binding Buffer to a concentration of 1-5 × 10 6 / ml, take 100μL cell suspension and put it into flow cytometry tube, add 5μL Annexin V / FITC, mix well and incubate at room temperature in the dark for 5 minutes, then add 5μL propidium iodide (PI) and 400μL PBS, and immediately perform flow cytometry detection. The results showed that AMER3 Genes can inhibit apoptosis of crop fibroblasts ( Figure 6 ).

[0034] Pigeon crop tissue is the main site of Trichomonas infection, and AMER3 High gene expression can promote the proliferation and migration of crop fibroblasts and inhibit their apoptosis. It still has the function of promoting the normal growth and development of crop tissue after infection with Trichomonas, reflecting its resistance to pigeon trichomoniasis.

[0035] The above technical solutions only reflect the preferred technical solutions of the technical solutions of the present invention. Any changes that may be made to certain parts thereof by those skilled in the art all reflect the principles of the present invention and fall within the scope of protection of the present invention.

Claims

1. miR-206 associated with pigeon trichomoniasis resistance, characterized in that The nucleotide sequence of miR-206 is SEQ ID NO.1: TGACCTGTCCCGCTGTCCCCAGA.

2. The miR-206 associated with pigeon trichomoniasis resistance according to claim 1, characterized in that The target gene regulated by miR-206 is APC membrane-bound protein 3.

3. Application of miR-206, which is associated with pigeon trichomoniasis resistance, as a molecular marker in the prevention of pigeon trichomoniasis infection.

4. A use of the target gene APC membrane-bound protein 3 regulated by miR-206 as claimed in claim 2 as a molecular marker or target in the prevention of pigeon Trichomonas infection.

5. The use of the target gene APC membrane-bound protein 3 regulated by miR-206 according to claim 4 as a molecular marker or target in the prevention of pigeon Trichomonas infection, characterized in that: The specific operation method includes the following steps: Step (1) determining the infection status of pigeons with Trichomonas: collecting oral pharyngeal swabs from pigeons and counting them under a microscope, and determining the infection status of pigeons with Trichomonas according to the number of Trichomonas; Step (2) predicting the expression of the resistance-related target gene APC membrane-bound protein 3 regulated by miR-206: detecting the expression level of the target gene in the oral tissue of the pigeon to be tested.

6. A fluorescent quantitative PCR kit for predicting anti-pigeon trichomonas infection, characterized in that , including RNA reverse transcription reagents, fluorescent quantitative RT-PCR amplification reagents, and fluorescent quantitative PCR primers of APC membrane-bound protein 3 gene.

7. A fluorescent quantitative PCR kit for predicting anti-pigeon trichomonas infection according to claim 6, characterized in that, in, The nucleotide sequences of the fluorescent quantitative PCR primers for the APC membrane-bound protein 3 gene are shown in SEQ ID NO.2 and SEQ ID NO.3; SEQ ID NO.2: TACCAGGGCAGCAAGGAATG; SEQ ID NO. 3: TTGACAAGTCGCCCCTTACC.

8. A fluorescent quantitative PCR kit for predicting anti-pigeon trichomonas infection according to claim 7, characterized in that, The operation method includes the following steps: (1) Extracting total RNA from oral tissue samples of pigeons to be tested; (2) Reverse transcription of the APC membrane-bound protein 3 gene was performed using a tailing reverse transcription kit; (3) using the amplification primers shown in SEQ ID NO. 2 and SEQ ID NO. 3 to perform fluorescence quantitative PCR detection of the APC membrane-bound protein 3 gene; (4) Compare the expression levels of the detected miRNA and APC membrane-bound protein 3 genes with those of the control group’s oral tissue to predict the resistance to pigeon Trichomonas infection.

Images