A method for detecting peanut allergen Ara h1 using an electrochemical aptamer sensor based on a hydrogen-bonded organic framework.

Abstract

The application discloses a method for detecting peanut allergen Ara h1 by using an electrochemical aptamer sensor based on a hydrogen bond organic framework. The application uses a tetra-carboxyl porphyrin-based nickel hydrogen bond organic framework (PFC-73-Ni) as an electrocatalytic signal amplifier to construct an electrochemical aptamer sensor for detecting peanut allergen Ara h1 in a sample. The application can simply, quickly, highly specifically and ultra-sensitively detect the content of Ara h1 in the sample, and overcomes the defects of the prior art, such as complex operation, time and labor consumption, low sensitivity and high cost, and has extremely high practical application value.

Description

Technical Field

[0001] This invention relates to the field of analytical chemistry, and more specifically, to a method for detecting the peanut allergen Ara h1 using an electrochemical aptamer sensor based on a hydrogen-bonded organic framework. Background Technology

[0002] Food allergies, as a serious immune allergic reaction, have become a growing global concern for food safety and public health due to their rising incidence. Peanut allergen Ara h1 is widely considered a significant food allergen; even trace amounts can trigger severe, even life-threatening, reactions. Given the lack of effective treatments for food allergies, avoiding foods containing the allergen is considered the best practice for individuals with peanut allergies to prevent allergic events. To this end, many countries have regulations for labeling allergen components in pre-packaged foods; however, cross-contamination, adulteration, or mislabeling can still pose a risk of allergen ingestion. Therefore, it is crucial to develop sensitive and effective analytical methods to identify Ara h1 from foods that may contain trace amounts of peanuts.

[0003] Currently, various effective technologies have been developed for detecting food allergens, mainly including enzyme-linked immunosorbent assay (ELISA), polymerase chain reaction (PCR), and mass spectrometry (MS). However, these technologies are often time-consuming and labor-intensive, or require specialized technicians and expensive equipment. Electrochemical aptamer sensors, due to their cost-effectiveness, ease of operation, high sensitivity, and high specificity, can be considered a favorable alternative to traditional technologies. Target-specific aptamers are typically modified at the 5' or 3' end and are mainly fixed to the electrode surface via covalent bonds to enhance the specificity of the detection method. Nanomaterials at the aptamer electrode interface exhibit excellent electrocatalytic and conductive properties, which is beneficial for significantly amplifying the electrochemical detection signal, thereby endowing electrochemical aptamer sensors with ultra-high detection sensitivity. Summary of the Invention

[0004] The purpose of this invention is to solve the problems existing in the prior art and to provide an electrochemical aptamer sensor based on a hydrogen-bonded organic framework.

[0005] Another object of the present invention is to provide a method for detecting peanut allergen Ara h1 using this electrochemical aptamer sensor.

[0006] The objective of this invention can be achieved through the following technical solutions:

[0007] An electrochemical aptamer sensor based on a hydrogen-bonded organic framework has an aptamer sequence of: 5'-SH-(CH2)6-TCGCAC ATTCCGCTTCTACCGGGGGGGTCGAGCTGAGTGGATGCGAATCTGTGGGTGGGCTTCGCACACACGGACTTACG-3', where the 5'-terminal SH represents a thiol group, which is used to form Au-S bonds with Au NPs electrodeposited on the GCE electrode. The aptamer is modified on the surface of the GCE electrode to obtain an apt / DpAu / GCE electrode.

[0008] The complementary aptamer sequence is: 5'-NH3-TTTTTTCGTAAGTCCGTGTGTGCG-3', where the NH3 at the 5' end represents an amino group. This complementary aptamer is used to modify the hydrogen-bonded organic framework PFC-73-Ni, thereby obtaining the hydrogen-bonded organic framework PFC-73-Ni@cDNA.

[0009] In the technical solution of this invention, the apt / DpAu / GCE electrode is specifically prepared by the following method:

[0010] (1) Polish the glassy carbon electrode GCE with an alumina suspension, and then perform ultrasonic cleaning with a mixture of water and ethanol;

[0011] (2) Place the cleaned GCE from step (1) in a 1wt% to 2wt% HAuCl4 solution, and then electrodeposit gold nanoparticles on the electrode for 20 to 40 s at a potential of -0.3 to -0.1 V to obtain a gold nanoparticle modified electrode DpAu / GCE.

[0012] (3) The aptamer solution was added dropwise to the DpAu / GCE electrode and incubated to allow it to connect to the electrode surface through Au-S bonds. After the reaction was complete, the electrode surface was rinsed with PBS to remove unreacted aptamers.

[0013] (4) Terminate the DpAu / GCE surface with 0.5-5% BSA to obtain BSA-terminated apt / DpAu / GCE electrodes.

[0014] In the above method for preparing the apt / DpAu / GCE electrode, the incubation time in step (3) is 20 to 60 minutes, preferably 35 to 45 minutes.

[0015] In the above method for preparing the apt / DpAu / GCE electrode, the concentration of the aptamer solution in step (3) is 0.5 to 2.5 μM; preferably, the concentration of the aptamer solution is 1.5 to 2.5 μM.

[0016] In the technical solution of this invention, the cDNA-modified hydrogen-bonded organic framework PFC-73-Ni@cDNA is mainly prepared by the following method:

[0017] (a) Under light-protected conditions, the ligand 5,10,15,20-tetrakis(4-carboxyphenyl)nickelporphyrin was ultrasonically dispersed in N,N-dimethylformamide, and then 1,2,4-trichlorobenzene was added and mixed to obtain a precursor mixture.

[0018] (b) The precursor mixture was reacted at 95–105 °C for 45–48 h, then centrifuged and soaked in dichloromethane for 20–24 h, and centrifuged again to obtain a purple-red precipitate PFC-73-Ni.

[0019] (c) The purple-red precipitate PFC-73-Ni was washed, dried, and then prepared into an aqueous solution;

[0020] (d) Preparation of PFC-73-Ni@cDNA: Add PBS solution to the PFC-73-Ni aqueous solution prepared in step (c), and activate -COOH by shaking at room temperature for 10-20 min to obtain a mixture; then add the complementary aptamer solution to the above mixture, and shake at room temperature for 3-4 h to obtain PFC-73-Ni@cDNA solution.

[0021] In the above method for preparing organic framework PFC-73-Ni@cDNA, the mass ratio of ligands 5,10,15,20-tetra(4-carboxyphenyl)nickelporphyrin, N,N-dimethylformamide and 1,2,4-trichlorobenzene in step (a) is (15-25) mg:(1-5) g:(2-10) g.

[0022] In the above method for preparing organic framework PFC-73-Ni@cDNA, the volume ratio of PBS solution, PFC-73-Ni aqueous solution and complementary aptamer solution in step (d) is 3-8:3-8:1-5;

[0023] The PBS solution contains EDC and NHS, with EDC concentrations of 380–420 mM and NHS concentrations of 80–120 mM; the concentration of the PFC-73-Ni aqueous solution is 0.5–2 mg / mL, and the concentration of the complementary aptamer solution is 5–15 μM.

[0024] A method for detecting peanut allergen Ara h1 using the above-mentioned electrochemical aptamer sensor based on a hydrogen-bonded organic framework, the method comprising:

[0025] (1) Standard preparation: PFC-73-Ni@cDNA solution was dropped onto the surface of the apt / DpAu / GCE electrode at a temperature of 30-40℃ and incubated for 30-40 min. The electrode obtained in this step was labeled as: PFC-73-Ni@cDNA / apt / DpAu / GCE electrode; the PFC-73-Ni@cDNA / apt / DpAu / GCE electrode was incubated in Ara h1 solution of different concentrations for 10-20 min.

[0026] (2) In a solution containing 100–200 μg mL -1 In hydroquinone solutions, the electrochemical differential pulse voltammetry response corresponding to different concentrations of Ara h1 was tested in the voltage range of 0.0–0.5 V to obtain standard curves;

[0027] (3) Sample detection: Replace the Ara h1 samples of unknown concentration with Ara h1 samples of different concentrations in step (1), and detect them according to the method in step (1). Measure the DPV signal and substitute it into the standard curve prepared in step (2) to calculate the Ara h1 concentration in the sample.

[0028] In the above detection method, in step (1), Ara h1 is incubated on the surface of the PFC-73-Ni@cDNA / apt / DpAu / GCE electrode for 5 to 25 min, preferably 18 to 22 min; the concentration of the PFC-73-Ni@cDNA solution is 1.2 mg / mL;

[0029] In step (2), the concentration of PBS buffer is 0.01–0.1 M and the pH value is 6.0–8.5; the concentration range of Ara h1 is 0–120 nM and the DPV voltage for measuring HQ is 0–0.5 V.

[0030] The present invention relates to the application of the electrochemical aptamer sensor based on a hydrogen-bonded organic framework in the determination of peanut allergen Ara h1.

[0031] Beneficial effects:

[0032] This invention proposes an electrochemical aptamer sensor targeting Ara h1. It primarily utilizes an amide reaction to modify cDNA onto PFC-73-Ni, preparing a covalent organic framework composite material (PFC-73-Ni@cDNA) with excellent electrocatalytic activity. Combining the advantages of both, a novel electrochemical aptamer sensor for Ara h1 detection was prepared, enabling ultrasensitive detection of Ara h1 in food samples. The electrochemical aptamer sensor features a simple operating procedure and high sensitivity and specificity. Through extensive experiments, this invention identified a detection scheme and corresponding detection conditions that significantly simplify the preparation steps of the electrochemical aptamer sensor and improve detection sensitivity. This allows for rapid, highly sensitive, and highly selective detection of Ara h1, overcoming the drawbacks of existing detection methods such as cumbersome procedures, time-consuming detection, and high costs. The method of this invention has been successfully applied to the determination of Ara h1 in blood samples, demonstrating significant practical application value. Attached Figure Description

[0033] The above and / or additional aspects and advantages of the present invention will become apparent and readily understood from the description of the embodiments taken in conjunction with the following drawings, in which:

[0034] Figure 1 The preparation of PFC-73-Ni and PFC-73-Ni@cDNA in this invention is shown.

[0035] Figure 2 The XRD pattern of the powder successfully prepared by PFC-73-Ni in this invention is shown.

[0036] Figure 3 The image shows the powder XRD patterns before and after cDNA modification of PFC-73-Ni in this invention.

[0037] Figure 4 The TEM image of PFC-73-Ni and the corresponding high-angle annular dark field elemental mapping are shown.

[0038] Figure 5 A flowchart illustrating the fabrication process of the electrochemical aptamer sensor of this invention is shown.

[0039] Figure 6 A schematic diagram showing the feasibility results of the electrochemical aptamer sensor proposed in this invention is displayed;

[0040] A: DPV response of different electrodes (a: bare GCE), (b: DpAu / GCE), (c: apt / DpAu / GCE), (d: Ara h1 / apt / DpAu / GCE), (e: PFC-73-Ni@cDNA / Ara h1 / apt / DpAu / GCE) to the oxidation of HQ to PBQ. B: DPV response of (a: bare GCE), (b: DpAu / GCE), (c: apt / DpAu / GCE), (d: Ara h1 / apt / DpAu / GCE), (e: PFC-73-Ni@cDNA / Ara h1 / apt / DpAu / GCE) to 0.1 M KCl and 5.0 mM [Fe(CN)6] 3- / 4- CV curves were acquired in redox probe solutions. C: Different electrodes (a: bare GCE), (b: DpAu / GCE), (c: apt / DpAu / GCE), (d: Ara h1 / apt / DpAu / GCE), (e: PFC-73-Ni@cDNA / Ara h1 / apt / DpAu / GCE) were used in 0.1 M KCl and 5.0 mM [Fe(CN)6]2 solutions. 3- / 4- EIS curves were collected in the redox probe solution.

[0041] Figure 7 This diagram shows the DPV response results of the electrochemical aptamer sensor proposed in this invention at 0 nM Ara h1.

[0042] Figure 8 A schematic diagram showing the optimized conditions of the electrochemical aptamer sensor proposed in this invention is displayed.

[0043] A: Optimization of aptamer incubation time, B: Optimization of material incubation time, C: Optimization of Ara h1 incubation time, D: Optimization of PFC-73-Ni@cDNA concentration, E: Optimization of HQ concentration, and F: Optimization of aptamer concentration.

[0044] Figure 9 A schematic diagram showing the pH optimization results of the electrochemical aptamer sensor in this invention is displayed;

[0045] Figure 10 This diagram illustrates the optimized reaction time of PFC-73-Ni with cDNA in this invention.

[0046] Figure 11 This shows a schematic diagram of the standard curve results for the electrochemical aptamer sensor proposed in this invention;

[0047] A: DPV response of the electrochemical aptamer sensor incubated in 0.01M PBS buffer (pH 7.4) containing 160 μg / mL HQ with different concentrations of Ara h1 (from 1 nM to 120 nM). B: Relationship between DPV peak current response and Ara h1 concentration; C: Calibration curve of DPV peak current against the logarithm of Ara h1 concentration (error bar: SD, n = 6).

[0048] Figure 12 A schematic diagram showing the specific results of the electrochemical aptamer sensor proposed in this invention is displayed;

[0049] Figure 13 A schematic diagram showing the reproducibility results of the electrochemical aptamer sensor proposed in this invention is displayed.

[0050] Figure 14 A schematic diagram showing the stability results of the electrochemical aptamer sensor proposed in this invention is displayed.

[0051] Figure 15 The diagram shows the detection process and results of the electrochemical aptamer sensor proposed in this invention in food samples;

[0052] A: Flowchart of the electrochemical aptamer sensor for the analysis of Ara h1 in food samples. B: Detection rate of Ara h1 in foods that do not contain Ara h1, foods that may contain Ara h1, and foods containing Ara h1. C: Schematic diagram comparing the analytical results of the electrochemical aptamer sensor proposed in this invention with those of commercial ELISA kits. Detailed Implementation

[0053] Embodiments of the present invention are described in detail below. Examples of these embodiments are shown in the accompanying drawings, wherein the same or similar reference numerals denote the same or similar elements or elements having the same or similar functions throughout. The embodiments described below with reference to the accompanying drawings are exemplary and are only used to explain the present invention, and should not be construed as limiting the present invention.

[0054] It should be noted that the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of indicated technical features. Therefore, a feature defined as "first" or "second" may explicitly or implicitly include one or more of that feature. Furthermore, in the description of this invention, unless otherwise stated, "a plurality of" means two or more.

[0055] Reagents and materials:

[0056] Unless otherwise specified, all reagents and instruments used were commercially available products, such as those from Sigma. All DNA sequences were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0057] The detailed base sequence is as follows. Here, the aptamer sequence is: 5'-SH-(CH2)6-TCGCACATTCCGCTTCTACCGGGGGGGTCGAGCTGAGTGGATGCGAATCTGTGGGTGGGCTTCGCACACACGGACT TACG-3',

[0058] The complementary aptamer sequence is: 5'-NH3-TTTTTTCGTAAGTCCGTGTGTGCG-3'.

[0059] instrument

[0060] Analysis was performed using a CHI760E electrochemical workstation (Shanghai Chenhua Instruments Co., Ltd., China). Detection was conducted under the following conditions: initial voltage: 0V; final voltage: 0.5V; potential increase: 0.004V; increase: 0.05V; pulse width: 0.05s; sampling width: 0.0167s; pulse period: 0.5s; rest time: 2s; sensitivity: 1×10⁻⁶. -5 .

[0061] Example 1 Preparation and validation of PFC-73-Ni@cDNA:

[0062] PFC-73-Ni and cDNA-modified PFC-73-Ni were prepared using 5,10,15,20-tetrakis(4-carboxyphenyl)nickel porphyrin as monomers; the preparation process is as follows: Figure 3 As shown, the details are as follows:

[0063] (a) In a brown glass bottle, 20 mg of ligand 5,10,15,20-tetra(4-carboxyphenyl)nickelporphyrin was ultrasonically dispersed in 3 ml of N,N-dimethylformamide, followed by the addition of 6 ml of 1,2,4-trichlorobenzene and ultrasonication for 30 s to obtain a precursor mixture.

[0064] (b) The precursor mixture was reacted at 100°C for 48 h, centrifuged at 5000 rpm, and the resulting product was soaked in dichloromethane for 24 h and centrifuged at 5000 rpm to obtain a purple-red precipitate PFC-73-Ni.

[0065] (c) After washing three times with dichloromethane, it was dried under vacuum at 60°C and then prepared into an aqueous solution with a concentration of 1 mg / mL.

[0066] (d) Preparation of PFC-73-Ni@cDNA: In an enzyme-free tube, add 500 μL of freshly prepared PBS solution (containing 400 mM EDC and 100 mM NHS) to 0.5 mL of PFC-73-Ni solution (1 mg / mL), and vortex at room temperature for 20 min to activate the -COOH group. Then, add 200 μL of 10 μM cDNA solution to the above solution, and vortex at room temperature for 4 h to obtain the PFC-73-Ni@cDNA solution.

[0067] Finally, the successful synthesis of PFC-73-Ni@cDNA powder (obtained by centrifuging and drying PFC-73-Ni@cDNA solution) was confirmed by powder XRD experiments, TEM images, and corresponding high-angle ring dark-field elemental mapping. Figure 2 As shown, the simulated and actual XRD diffraction peaks of PFC-73-Ni overlap well, indicating that PFC-73-Ni was successfully prepared and has a good crystal structure. Figure 3 As shown: After cDNA modification of PFC-73-Ni, the diffraction peak positions of the PFC-73-Ni crystal did not change, indicating that the original crystal structure was preserved after cDNA modification of PFC-73-Ni. Furthermore, TEM images of PFC-73-Ni@cDNA and corresponding high-angle ring dark-field elemental mapping diagrams are shown. Figure 4 This indicates that PFC-73-Ni@cDNA contains C, N, O, and Ni, which is consistent with the theoretical value, indicating that the cDNA was successfully modified onto PFC-73-Ni.

[0068] Example 2: Construction and Feasibility Analysis of Electrochemical Aptamer Sensors

[0069] According to the method of embodiments of the present invention, the electrochemical aptamer sensor is constructed as follows: Figure 5 As shown, the details are as follows:

[0070] (1) Polish the glassy carbon electrode GCE with an alumina suspension, and then ultrasonically treat it with pure water and ethanol in a mass ratio of 1:1.

[0071] (2) Place the clean GCE in a 1% HAuCl4 solution, and then electrodeposit gold nanoparticles on the electrode for 30s at a potential of -0.2V to obtain the gold nanoparticle modified electrode DpAu / GCE.

[0072] (3) Add the aptamer solution to the DpAu / GCE electrode and incubate for 40 min to allow it to connect to the electrode surface through Au-S bonds. After the reaction is complete, rinse the electrode surface with PBS to remove unreacted aptamers.

[0073] (4) The DpAu / GCE surface was terminated with 1% BSA to obtain the BSA-terminated apt / DpAu / GCE electrode.

[0074] (5) At 37℃, 5 μL of PFC-73-Ni@cDNA solution was subsequently dropped onto the surface of the apt / DpAu / GCE electrode (diameter 3 mm, area 7.064*10). -2 cm 2 After incubation for 40 min, the electrode obtained in this step is labeled as: PFC-73-Ni@cDNA / apt / DpAu / GCE electrode; the PFC-73-Ni@cDNA / apt / DpAu / GCE electrode is incubated for 20 min in different concentrations of Ara h1 solution at 0, 1, 2, 5, 10, 20, 50, 80, 100, and 120 nM for 20 min respectively to obtain the electrochemical aptamer sensor described in this invention;

[0075] Next, according to the method of the present invention embodiments, the feasibility analysis of the electrochemical aptamer sensor is as follows: Figure 6 As shown, the details are as follows:

[0076] (1) To demonstrate the feasibility of the electrochemical aptamer sensor, a solution containing 160 μg mL was prepared. -1 Different modified electrodes were characterized using differential pulse voltammetry (DPV) in 0.01 M PBS (pH 7.4) containing hydroquinone (HQ). PFC-73-Ni was able to achieve the electrochemical oxidation of HQ. HQ has been widely used as an electrochemical signal generator for biomarkers, including proteins, and has been shown not to interfere with the detection of the target entity. Figure 6 As shown in Figure A, the electrochemical aptamer sensor exhibits a high DPV current response peak at approximately 0.228 V (curve d) due to the catalytic oxidation of HQ to p-benzoquinone (PBQ) by PFC-73-Ni. Conversely, when GCE (curve a), DpAu / GCE (curve b), or apt / DpAu / GCE (curve c) are used as sensing electrodes, there is almost no DPV current response peak at approximately 0.228 V. This phenomenon suggests that the signal amplification can be attributed to the excellent catalytic and electron transfer capabilities exhibited by PFC-73-Ni. In the presence of Ara h1, PFC-73-Ni produces a low current signal near 0.228 V (curve e), which can be attributed to the higher affinity of Ara h1 for apt, leading to the detachment of PFC-73-Ni@cDNA from the electrode surface. Subsequently, the test was repeated 20 times with the absence of Ara h1 as the blank signal. The DPV current response ranged from 10.8 to 12.09 μA, with a relative standard deviation (RSD) of 2.43%. Figure 7Therefore, in subsequent studies, DPV current peaks above 10.8 μA were considered as background interference.

[0077] (2) Cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS) measurements were performed after each modification step used in the construction of the electrochemical aptamer sensor to characterize the interfacial properties of the electrode. The diameter of the semicircle in the EIS Nyquist plot corresponds to the electron transfer resistance (Ret). Figure 6 Figures B and C show that, compared to bare GCE (curve a), DpAu / GCE (curve b) increases the electrode conductivity, which can be attributed to the excellent conductivity and high surface-to-volume ratio of AuNPs. However, the negatively charged phosphate backbone of apt inhibits electron transfer within the redox couple, leading to an increase in Ret and a decrease in current for apt / DpAu / GCE (curve c). Furthermore, when PFC-73-Ni@cDNA binds to apt / DpAu / GCE, the CV signal increases and the Ret signal decreases (curve d), due to the excellent interfacial charge transfer properties of PFC-73-Ni. This phenomenon further indicates that PFC-73-Ni has the ability to enhance the electrochemical signal of electrochemical aptamer sensors.

[0078] The above results indicate that the proposed electrochemical aptamer sensor is feasible.

[0079] Example 4

[0080] 1. Optimization of experimental conditions for electrochemical aptamer sensors:

[0081] According to the method of the present invention, the optimization results of the conditions for electrochemical aptamer sensing are as follows: Figure 8 and Figure 9 As shown, the details are as follows:

[0082] To achieve optimal analytical performance, experimental conditions were optimized using DPV in 0.01M PBS, including optimization of aptamer incubation time, material incubation time, Ara h1 incubation time, PFC-73-Ni@c DNA concentration, HQ concentration, aptamer concentration, and pH value of the electrochemical aptamer sensor. Figure 8 AF and Figure 9As shown in the figure. The results showed that the optimal detection conditions were: aptamer incubation time 40 min, material incubation time 40 min, Ara h1 incubation time 20 min, PFC-73-Ni@cDNA concentration 1.2 mg / ml, HQ concentration 160 μg / ml, aptamer concentration 1 μM, and electrochemical aptamer sensor pH 7.4. Finally, the optimal reaction time of PFC-73-Ni and cDNA was also optimized. In the experiment, the Ara h1 concentration was 50 nM, and the results showed that the optimal DPV current response was obtained after 4 h of reaction. Figure 10 Therefore, all subsequent experiments were conducted under these conditions.

[0083] 2. Construction of the standard curve for electrochemical aptamer sensing:

[0084] According to the method of the present invention, the construction result of the standard curve of the electrochemical aptamer sensor is as follows: Figure 12 As shown, the details are as follows:

[0085] like Figure 11 As shown in A, in a solution containing 160 μg mL -1 Electrochemical signals at different Thr concentrations were detected by DPV in 0.01M PBS (pH 7.4) containing hydroquinone (HQ). Here, a, b, c, d, e, f, g, h, i, and j represent Ara h1 concentrations of 0 nM, 1 nM, 2 nM, 5 nM, 10 nM, 20 nM, 50 nM, 80 nM, 100 nM, and 120 nM, respectively. This indicates that the response current gradually decreases with increasing Ara h1 concentration. This is because high concentrations of Ara h1 have a greater affinity for apt than PFC-73-Ni@cDNA, causing PFC-73-Ni@cDNA to detach from the electrode surface. Furthermore, curve fitting was performed on the response current and Ara h1 concentration, as shown in the figure. Figure 11 As shown in B. Here, for ease of calculation, the logarithm of the Ara h1 concentration is used to fit the linear equation of the response current ( Figure 11 C). The results showed that within the concentration range of 1–120 nM Ara h1, there was a good linear relationship between the current intensity and the logarithm of the Ara h1 concentration, with the linear equation being i(μA) = -3.19LogC. Arah1+10.48, with a detection limit of 0.26 nM. The limit of detection (LODs) is calculated as: LODs = 3SB / K (where SB is the standard deviation of the blank signal peak current (repeated 20 times), and K is the slope of the calibration curve obtained from the linear equation). As shown in Table 1, compared with most nanomaterial-based detection methods, the self-made electrochemical aptamer sensor is simpler, has a lower detection limit, and a wider detection range. This can be attributed to the excellent electrocatalytic performance of PFC-73-Ni and its simple aptamer design. Therefore, this electrochemical aptamer sensor exhibits outstanding advantages in detecting nanomolar quantities of Thr.

[0086] Table 1. Comparison of different sensors used for Ara h1 detection

[0087] Graphene-gold nanocomposite materials Electrochemistry 5-150 (nM) 1.66 (nM) Gold nanoparticles Colorimetry 125-4000 (ng / mL) 25 (ng / mL) Graphene quantum dots fluorescence 200-2000 (ng / mL) 56 (ng / mL) Biodegradable gold / corn protein membrane Raman scattering - 0.14 (mg / mL) Black Scale Nanosheets Paper-based microfluidics 50-1000 (ng / mL) 21.6 (ng / mL) Gold nanoparticles Electrochemistry 12.6-2000 (ng / mL) 3.8 (ng / mL) quantum dots Electrochemistry 25-1000 (ng / mL) 3.5 (ng / mL) PFC-73-Ni Electrochemistry 1-120 (nM) 0.26 (nM) This work

[0088] 3. Specificity assessment of electrochemical aptamer sensors:

[0089] According to the method of embodiments of the present invention, the specificity results of the electrochemical aptamer sensor are as follows: Figure 12 As shown, the details are as follows:

[0090] Several interfering proteins, including conjugated glycinin (7S), ovalbumin (OVA), bovine serum albumin (BSA), the peanut allergen Ara h2, and a mixture of these proteins containing 80 nM Ara h1, as well as 80 nM Ara h1 alone, were used to validate the specificity of the electrochemical aptamer sensor for Ara h1. In the specific detection, the Ara h1 solution used in the standard curve preparation was replaced with the sample to be tested; all other steps remained unchanged. Figure 12 As shown, the current signals caused by these interfering proteins are close to the blank peak and do not affect the experimental results, indicating that the electrochemical aptamer sensor of the present invention has good specificity.

[0091] 4. Reproducibility study of electrochemical aptamer sensors:

[0092] According to the method of the present invention, the reproducibility results of the electrochemical aptamer sensor are as follows: Figure 13 As shown, the details are as follows:

[0093] In practical applications, the reproducibility of electrochemical aptamer sensors is also crucial. Repeatability and reproducibility test results show that the current response of 80 nM Ara h1 did not change significantly across different batches and experimental times, with a relative standard deviation (RSD) of 6.41%, indicating that the constructed electrochemical biosensor has good reproducibility. Figure 13 ).

[0094] 5. Stability assessment of the electrochemical aptamer sensor:

[0095] According to the method of the present invention, the stability results of the electrochemical aptamer sensor are as follows: Figure 14 As shown, the details are as follows:

[0096] In practical applications, the reproducibility of electrochemical aptamer sensors is also crucial. Repeatability and reproducibility test results show that the current response of 80 nM Ara h1 did not change significantly across different batches and experimental times, with a relative standard deviation (RSD) of 7.20%, indicating that the constructed electrochemical biosensor possesses good stability. Figure 14 ).

[0097] Example 5: Spike detection of actual food samples:

[0098] According to the method of the present invention, the actual blood sample spiked detection results of the electrochemical aptamer sensor are shown in Table 2, as detailed below:

[0099] The feasibility of the electrochemical aptamer sensor was validated using three non-peanut-based food products. Pretreated spiked samples were diluted 10-fold before electrochemical detection. The first step was to determine the Ara h1 level in blank food samples based on the calibration curve of the constructed electrochemical sensor. Subsequently, the same food samples with added standards were analyzed, and the background values ​​of the blank samples were subtracted. As shown in Table S2, the recoveries of the three non-peanut-based food products ranged from 95.00% to 107.42% (RSD of 4.29% to 7.99%), demonstrating the potential for accurate detection and quantification of Ara h1 in real samples.

[0100] Table 2. Spike Detection Experiments on Food Samples

[0101]

[0102] Example 6: Food Sample Detection

[0103] According to the method of Embodiment 5 of the present invention, the food sample detection research process and results are as follows: Figure 15 As shown in Table 3, the details are as follows:

[0104] To further verify the practicality of the constructed sensor, we analyzed pre-packaged food samples and ingredients, selecting 45 different food products that were either free of Ara h1, possibly containing Ara h1, or contained Ara h1 for testing. These foods were purchased from local supermarkets, and the testing process was as follows: Figure 15As shown in A. The specific method is as follows: (1) Standard curve preparation: same as in Example 5; (2) At 37°C, 5 μL of diluted food sample supernatant was dropped onto the surface of the PFC-73-Ni@cDNA / apt / DpAu / GCE electrode and incubated for a period of time. The modified electrode was placed in 0.01M PBS buffer containing 160 μg / mL HQ, and the electrochemical differential pulse voltammetry response corresponding to the diluted food supernatant was tested. The result was substituted into the standard curve to calculate the Ara h1 concentration in the food sample.

[0105] like Figure 15 As shown in Figure B, Ara h1 was not detected in foods labeled as Ara h1-free, while the detection rates of Ara h1 in foods possibly containing Ara h1 and foods confirmed to contain Ara h1 were 13.3% and 86.7%, respectively. The detection rate of Ara h1 in food samples was less than 100%, possibly due to uneven distribution of Ara h1 in a small portion of the samples after pretreatment, resulting in the absence of Ara h1 in the test solution. Detailed test results for all foods possibly containing or containing Ara h1 are shown in Table 4. In addition, 12 positive samples were selected for validation using a commercially available ELISA kit. Figure 15 C). The results showed that the detection results of the electrochemical ligand sensor had a good correlation with ELISA (R). 2 =0.973). However, the LOD of the electrochemical sensor (0.26 nM) is lower than that of commercially available ELISA kits (0.79 nM). The results indicate that this sensor is a simple and sensitive sensing platform with good accuracy in detecting Ara h1 in food samples.

[0106] Table 3. Detection results of Ara h1 in 50 food samples using electrochemical aptamers

[0107]

[0108]

[0109]

[0110] Table 4. Detection results of 12 food samples using commercially available ELISA kits.

[0111]

[0112]

[0113] In the description of this specification, references to terms such as "one embodiment," "some embodiments," "example," "specific example," or "some examples," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of the invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples.

[0114] Although embodiments of the invention have been shown and described, those skilled in the art will understand that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the claims and their equivalents.

Claims

1. An electrochemical aptamer sensor based on a hydrogen-bonded organic framework, characterized in that, The aptamer sequence is: 5'-SH-(CH2)6-TCGCACATTCCGCTTCTACCGGGGGGGTCGAGCTGAGTGGATGCGAATCTGTGGGTGGGCTTCGCACACACGGACTTACG-3', where the 5' end SH represents a thiol group, which is used to form an Au-S bond with Au NPs electrodeposited on the GCE electrode. The aptamer is modified on the surface of the GCE electrode to obtain the apt / DpAu / GCE electrode. The complementary aptamer sequence is: 5'-NH3-TTTTTTCGTAAGTCCGTGTGTGCG-3', where the NH3 at the 5' end represents an amino group. This complementary aptamer is used to modify the hydrogen-bonded organic framework PFC-73-Ni, thereby obtaining the hydrogen-bonded organic framework PFC-73-Ni@cDNA.

2. The electrochemical aptamer sensor based on a hydrogen-bonded organic framework according to claim 1, characterized in that, The apt / DpAu / GCE electrode is specifically prepared by the following method: (1) Polish the glassy carbon electrode GCE with an alumina suspension, and then perform ultrasonic cleaning with a mixture of water and ethanol; (2) Place the cleaned GCE from step (1) in a 1wt%~2wt% HAuCl4 solution, and then electrodeposit gold nanoparticles on the electrode for 20~40 s at a potential of -0.3~-0.1 V to obtain the gold nanoparticle modified electrode DpAu / GCE; (3) The aptamer solution was added dropwise to the DpAu / GCE electrode and incubated to allow it to connect to the electrode surface through Au-S bonds. After the reaction was complete, the electrode surface was rinsed with PBS to remove unreacted aptamers. (4) Terminate the DpAu / GCE surface with 0.5~5% BSA to obtain BSA-terminated apt / DpAu / GCE electrodes.

3. The electrochemical aptamer sensor based on a hydrogen-bonded organic framework according to claim 2, characterized in that, The incubation time in step (3) is 20 to 60 minutes.

4. The electrochemical aptamer sensor based on a hydrogen-bonded organic framework according to claim 3, characterized in that, The incubation time in step (3) is 35~45 min.

5. The electrochemical aptamer sensor based on a hydrogen-bonded organic framework according to claim 2, characterized in that, The concentration of the aptamer solution in step (3) is 0.5~2.5 μM.

6. The electrochemical aptamer sensor based on a hydrogen-bonded organic framework according to claim 5, characterized in that, The concentration of the aptamer solution in step (3) is 1.5~2.5 μM.

7. The electrochemical aptamer sensor based on a hydrogen-bonded organic framework according to claim 1, characterized in that, The cDNA-modified hydrogen-bonded organic framework PFC-73-Ni@cDNA was mainly prepared by the following method: (a) Under light-protected conditions, the ligand 5,10,15,20-tetra(4-carboxyphenyl)nickelporphyrin was ultrasonically dispersed in N,N-dimethylformamide, and then 1,2,4-trichlorobenzene was added and mixed to obtain a precursor mixture. (b) The precursor mixture was prepared at 95-105 °C. o The reaction was carried out under C conditions for 45-48 hours, followed by centrifugation and soaking in dichloromethane for 20-24 hours. After centrifugation again, a purple-red precipitate, PFC-73-Ni, was obtained. (c) The purple-red precipitate PFC-73-Ni was washed, dried, and then prepared into an aqueous solution; (d) Preparation of PFC-73-Ni@cDNA: Add PBS solution to the PFC-73-Ni aqueous solution prepared in step (c), and activate -COOH by shaking at room temperature for 10-20 min to obtain a mixture; then add the complementary aptamer solution to the above mixture, and shake at room temperature for 3-4 h to obtain PFC-73-Ni@cDNA solution.

8. The electrochemical aptamer sensor based on a hydrogen-bonded organic framework according to claim 7, characterized in that, In step (a), the mass ratio of ligand 5,10,15,20-tetra(4-carboxyphenyl)nickelporphyrin, N,N-dimethylformamide and 1,2,4-trichlorobenzene is (15~25) mg : (1~5) g : (2~10) g.

9. The electrochemical aptamer sensor based on a hydrogen-bonded organic framework according to claim 7, characterized in that, In step (d), the volume ratio of PBS solution, PFC-73-Ni aqueous solution and complementary aptamer solution is 3~8:3~8:1~5; The PBS solution contains EDC and NHS, with EDC concentrations of 380–420 mM and NHS concentrations of 80–120 mM; the PFC-73-Ni aqueous solution concentration is 0.5–2 mg / mL, and the complementary aptamer solution concentration is 5–15 μM.

10. A method for detecting peanut allergen Ara h1 using an electrochemical aptamer sensor based on a hydrogen-bonded organic framework as described in any one of claims 1 to 9, characterized in that, The method includes: (1) Standard curve preparation: at a temperature of 30~40 o At C, PFC-73-Ni@cDNA solution was dropped onto the surface of the apt / DpAu / GCE electrode and incubated for 30-40 min. The electrode obtained in this step was labeled as: PFC-73-Ni@cDNA / apt / DpAu / GCE electrode; the PFC-73-Ni@cDNA / apt / DpAu / GCE electrode was incubated in Ara h1 solutions of different concentrations for 10-20 min. (2) In a solution containing 100~200 μg mL −1 In hydroquinone solutions, the electrochemical differential pulse voltammetry response corresponding to different concentrations of Ara h1 was tested in the voltage range of 0.0–0.5 V to obtain standard curves; (3) Sample detection: Replace the Ara h1 samples of unknown concentration with Ara h1 samples of different concentrations in step (1), and detect them according to the method in step (1). Measure the DPV signal and substitute it into the standard curve prepared in step (2) to calculate the Ara h1 concentration in the sample.

11. The method according to claim 10, characterized in that, In step (1), Ara h1 was incubated on the surface of the PFC-73-Ni@cDNA / apt / DpAu / GCE electrode for 5~25 min; the concentration of the PFC-73-Ni@cDNA solution was 1.2 mg / mL; In step (2), the concentration of PBS buffer is 0.01~0.1 M, the pH value is 6.0~8.5, the concentration range of Ara h1 is 0~120 nM, and the DPV voltage for measuring HQ is 0~0.5 V.

12. The method according to claim 11, characterized in that, Incubate for 18-22 minutes.

13. The application of the hydrogen-bonded organic framework-based electrochemical aptamer sensor as described in claim 1 in the determination of peanut allergen Arah1.

Images