Method for regulating and controlling flowering behaviors of plants in low-temperature environment
By spraying ethylene inhibitor solution in a low temperature environment to regulate plant flowering behavior, the problem of delayed flowering period caused by low temperature was solved, economic and environmentally friendly flowering period regulation was achieved, and economic benefits were significantly improved.
Patent Information
- Application Number
- CN202510597132.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-09
- Publication Date
- 2025-08-08
AI Technical Summary
The delay in plant flower bud differentiation in low-temperature environments leads to delayed flowering period and increases production costs and risks. The existing light temperature regulation methods consume high energy and are unstable in flower quality and yield.
Under low temperature environment (10-20℃), spray ethylene inhibitor solution with a concentration of no more than 2 μL/L, such as 1-methylcyclopropylene, to regulate plant flowering behavior.
Effectively advance the plant flowering period by 5-6 days, reduce production costs, is environmentally friendly and easy to promote, and significantly improve economic benefits.
Smart Images

Figure CN120436036A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to botany, and in particular to a method for regulating the flowering behavior of plants in a low-temperature environment. Background Art
[0002] Flowering period regulation is a technological field of significant economic and ecological importance in modern agriculture and horticulture. With increasing consumer demand, scientifically controlling plant flowering time has become a key technology for increasing product added value. In the floriculture industry, precise control of flowering periods allows for integration with key consumer nodes. This precise regulation across time and space not only ensures market supply, but also reduces production risks and maintains the stable operation of the industry chain.
[0003] Temperature, as a core environmental factor, directly influences plant growth and development by affecting physiological processes such as assimilation, absorption, and respiration. Ambient temperature can affect the growth, development, and flowering of different species. Take chrysanthemums, for example. Autumn chrysanthemums, a typical short-day variety that accounts for the vast majority of chrysanthemum varieties, are extremely sensitive to ambient temperature. 20°C is the ideal temperature for flowering. Excessively high or low temperatures are a major factor hindering flower bud differentiation and development in autumn chrysanthemums. Night temperatures (minimum temperatures) above 15°C are ideal for flower bud initiation, while 10°C is the critical minimum temperature for flower bud differentiation in autumn chrysanthemums. If ambient temperatures are too low, even under inductive short-day conditions, flower bud differentiation can be delayed or even absent. In the context of global climate change, the frequent occurrence of abnormally low temperatures has greatly increased the complexity of regulating the flowering period of ornamental flowers, particularly chrysanthemums. While light and temperature regulation can be used to meet temperature requirements during cultivation, thereby regulating flowering and ensuring normal flowering, this also significantly increases production energy costs, consumes significant manpower and material resources, and compromises flower quality and yield. Therefore, an efficient, low-cost, ecological and safe way to regulate the flowering period of chrysanthemum needs to be provided. Summary of the Invention
[0004] Purpose of the invention: The purpose of the present invention is to provide a method for regulating plant flowering behavior in a low-temperature environment that can effectively solve the problem of delayed flower bud differentiation under low temperatures.
[0005] Technical solution: The method of regulating plant flowering behavior in a low-temperature environment with an average daily temperature of 10-20°C described in the present invention specifically comprises: spraying 5-50 mL of an ethylene inhibitor solution with a concentration of no more than 2 μL / L on the surface of the entire plant every 1-3 days at the beginning of flower bud differentiation in the late vegetative growth stage of the plant.
[0006] Preferably, the plant is a Magnoliales plant; the Magnoliales plant is a plant of the Asteraceae family of the Asterales or a plant of the Cruciferae family of the Brassicales; the plant of the Asteraceae family of the Asterales is chrysanthemum, and the plant of the Cruciferae family of the Brassicales is Arabidopsis thaliana; the chrysanthemum grown to the late vegetative growth stage is a chrysanthemum with 18-20 leaves, and the Arabidopsis thaliana grown to the late vegetative growth stage is an Arabidopsis thaliana with 5-6 leaves.
[0007] Preferably, the spraying of the ethylene inhibitor solution is stopped after the plant completes flower bud differentiation.
[0008] Preferably, the sprayed ethylene inhibitor solution is a solution containing any one of 1-methylcyclopropene, aminooxyacetic acid, aminoethoxyvinylglycine, pyrazinamide and derivatives thereof.
[0009] Preferably, the sprayed ethylene inhibitor solution is a 1-methylcyclopropene-water solution with a concentration of 0.3-1.2 μL / L.
[0010] Beneficial effects: Compared with the existing technology, the present invention has the following significant advantages: 1. This method effectively solves the problem of late flowering of plants caused by low temperature. Experimental data show that the flowering period of chrysanthemum 'Shenma' can be advanced by 5-6 days, and the flowering period of Arabidopsis thaliana can be advanced by 4-5 days, which can bring significant economic benefits; 2. The ethylene inhibitor 1-methylcyclopropene selected by this method is safe and environmentally friendly, has environmentally friendly characteristics, and is low in cost. It is an economical and reliable method for regulating plant flowering behavior and is easy to promote. BRIEF DESCRIPTION OF THE DRAWINGS
[0011] Figure 1 This is a diagram of the autumn chrysanthemum variety 'Shenma' grown in a long-day culture room at the late vegetative stage with 18-20 leaves;
[0012] Figure 2 This is a statistical chart of the results of 1-aminocyclopropanecarboxylic acid determination in plants during flower bud differentiation;
[0013] Figure 3 This is the statistical result of the expression level of the ethylene signaling pathway gene CmTEM1 in plants during flower bud differentiation;
[0014] Figure 4 The statistical results of the expression levels of downstream flowering genes in plants during flower bud differentiation are shown in Figure 2, where A represents the CmFTL3 gene and B represents the CmAFL1 gene;
[0015] Figure 5 This is a representative plant image of the bud stage phenotype of 'Shenma';
[0016] Figure 6 This is a representative plant image of the flowering phenotype of 'Shenma';
[0017] Figure 7 This is a statistical chart of the number of days to flowering from the late vegetative growth stage to the bud stage of the 'Shenma' plant;
[0018] Figure 8 Representative plant images of Arabidopsis Col-0 phenotype;
[0019] Figure 9 The figures show the statistical results of flowering time (left) and rosette leaf number (right) of Arabidopsis Col-0 plants. DETAILED DESCRIPTION
[0020] The technical solution of the present invention is further described below.
[0021] Example 1: Ethylene inhibitor 1-methylcyclopropene (1-MCP) regulates chrysanthemum flowering period under low temperature environment
[0022] 40 plants of the autumn chrysanthemum variety 'Shenma' were selected and grown in a long-day culture room with 16h light / 8h dark until the late vegetative growth stage, that is, when the leaves were 18-20, and then randomly divided into a normal temperature control group (23℃ / CK), a normal temperature ethylene inhibitor group (23℃ / 1-MCP), a relatively low temperature control group (15℃ / CK), and a relatively low temperature ethylene inhibitor group (15℃ / 1-MCP), with 10 plants in each group. The plants were treated in a transparent incubator, as shown in Figure 2. Figure 1 As shown;
[0023] Move into a short-day environment of 8h light / 16h dark and start spraying in a closed environment. Among them, all control groups are sprayed with sterile water, and all ethylene inhibitor groups are sprayed with 1.0μL / L 1-MCP aqueous solution. The spraying volume is 30mL. Spraying is done once every 2 days. During the period, continuous observation is carried out. After 20 days, spraying is stopped and short-day cultivation is continued until buds appear.
[0024] 1. Determination of 1-aminocyclopropanecarboxylic acid in plants during flower bud differentiation
[0025] During the spraying process, during the flower bud differentiation period, i.e., on the 0th, 1st, 3rd, 7th, and 10th days of flower bud differentiation, the third to fourth mature leaves of each group were taken from the top, weighed fresh, and then quickly frozen in liquid nitrogen. After grinding and crushing, the ACC content was extracted and determined using a plant 1-aminocyclopropanecarboxylic acid (ACC) ELISA kit. The experimental results are as follows. Figure 2 As shown, the relatively low temperature environment of 15℃ induced the synthesis of ethylene precursor ACC in large quantities, thereby inducing the production of ethylene.
[0026] 2. Determination of the expression levels of ethylene signaling pathway genes and downstream genes during flower bud differentiation
[0027] During the spraying process, during the flower bud differentiation period, i.e., on days 0, 10, and 15 of flower bud differentiation, the third to fourth mature leaves were taken from the top of each group, and total RNA was extracted using a plant total RNA extraction kit and reverse transcribed to obtain cDNA at a concentration of 50 ng / μL.
[0028] The expression of ethylene signaling pathway genes and downstream flowering genes was determined using a SYBR Green Pro TaqHS premixed qPCR kit. The primers for the ethylene signaling pathway gene CmTEM1, the downstream flowering genes CmFTL3 and CmAFL1, and the internal reference gene CmEF1α are shown in Table 1. The RT-qPCR reaction system is shown in Table 2. The reaction conditions are shown in Table 3.
[0029] Table 1 RT-qPCR reaction primers
[0030] Primer name Sequence (5'-3') qCmEF1α-F TTTTGGTATCTGGTCCTGGAG qCmEF1α-R CCATTCAAGCGACAGACTCA qCmTEM1-F ACATCGATTTCAAGACGAAAGCTGC qCmTEM1-R AGCCCCAACAACTCCAATTCTATG qCmAFL1-F TCTGGTAGAGCAGCAAAACCCCGA qCmAFL1-R AAGGGGGCAAGACTATTGATGGTT qCmFTL3-F TGGTTTTTGTGCTATTCCGG qCmFTL3-R TCTCCGTCGTCCACCAAATC
[0031] Table 2 RT-qPCR reaction system
[0032]
[0033]
[0034] Table 3 RT-qPCR reaction conditions
[0035]
[0036] Three replicate RT-qPCR reactions were performed to obtain the average Ct value for each gene, and 2 -ΔΔCT Methods The relative transcription levels of downstream flowering genes were calculated, and the CmEF1α gene was used as an internal reference gene for normalization of transcript abundance.
[0037] 3. Flowering phenotype analysis
[0038] Representative images of bud stage of 3 random plants in each group are shown in Figure 2. Figure 5 Representative images of the flowering period are shown in Figure 6 As shown in the figure, the statistical results of the bud appearance time from the late vegetative growth stage to the bud stage of all plants are as follows Figure 7 As shown in the results, spraying 1-MCP had no significant effect on the flowering time of chrysanthemum 'Shenma' under culture conditions of 23℃, while spraying the ethylene inhibitor 1-MCP under culture conditions of relatively low temperature of 15℃ could significantly advance the flowering time by 5-6 days compared with the corresponding low temperature CK group, that is, spraying 1-MCP can effectively regulate the flowering period of chrysanthemum under low temperature environment.
[0039] Combined with Figure 3-4The real-time fluorescence quantitative assay results shown in the figure show that CmTEM1 showed a significant upregulation in the 15°C low-temperature environment compared to the 23°C control. This indicates that low temperature induces significant ethylene production, and CmTEM1 upregulates its expression in response to ethylene. However, the addition of the ethylene inhibitor 1-MCP to low temperature effectively reduces ethylene production and signal transduction. CmAFL1 and CmFTL3, flowering-promoting factors in chrysanthemum, showed significant downregulation in expression after low temperature treatment, but treatment with 1-MCP at low temperature rescued this downregulation. This result is consistent with the flowering phenotype observed in the previous study and the conclusion that the relatively low temperature of 15°C induces ethylene production.
[0040] In summary, spraying the ethylene inhibitor 1-MCP can effectively alleviate the late flowering phenomenon of chrysanthemums caused by low temperature environments and regulate the flowering period of chrysanthemums under low temperature environments.
[0041] Example 2: Ethylene inhibitor 1-methylcyclopropene (1-MCP) regulates the flowering period of Arabidopsis thaliana under low temperature conditions
[0042] A total of 40 wild-type Arabidopsis thaliana Col-0 plants were selected and grown in a long-day culture chamber with 16 h light / 8 h dark until the late vegetative growth stage, i.e., when they had 5-6 leaves. They were then randomly divided into a normal temperature control group (23°C / CK), a normal temperature ethylene inhibitor group (23°C / 1-MCP), a relatively low temperature control group (16°C / CK), and a relatively low temperature ethylene inhibitor group (16°C / 1-MCP), with 10 plants in each group, and the treatments were carried out in a transparent incubator.
[0043] Then, spraying treatment was started. All control groups were sprayed with sterile water, and all ethylene inhibitor groups were sprayed with 0.5 μL / L 1-MCP aqueous solution. The spraying volume was 10 mL. The spraying was done once every 2 days, and observation was continued until bolting.
[0044] Representative phenotypes of each group of plants are shown in Figure 8 As shown in the figure, the statistical results of the time consumed from the start of treatment to the bolting period are as follows Figure 9 As shown in the left figure, the statistical results of the number of rosette leaves of all plants are as follows Figure 9 As shown in the right figure, the results show that at a relatively low temperature of 16°C, Arabidopsis sprayed with the ethylene inhibitor 1-MCP can significantly bloom 4-5 days earlier than the corresponding low-temperature CK group, that is, spraying 1-MCP can also effectively regulate the flowering period of Arabidopsis under low temperature environments.
Claims
1. A method for regulating plant flowering behavior in a low temperature environment with an average daily temperature of 10-20°C, characterized in that: The method comprises the following steps: spraying 5-50 mL of an ethylene inhibitor solution having a concentration not higher than 2 μL / L on the surface of the entire plant every 1-3 days at the beginning of flower bud differentiation in the late vegetative growth stage of the plant.
2. The method according to claim 1, characterized in that The plant is a Magnoliaceae plant.
3. The method according to claim 2, characterized in that The Magnoliaceae plant is a plant of the family Asteraceae of the order Asterales or a plant of the family Cruciferae of the order Brassicales.
4. The method according to claim 3, characterized in that The plant of the family Asteraceae is chrysanthemum.
5. The method according to claim 4, characterized in that The chrysanthemums that have grown to the late stage of vegetative growth are chrysanthemums with 18-20 leaves.
6. The method according to claim 3, characterized in that The plant of the family Cruciferae is Arabidopsis thaliana.
7. The method according to claim 6, characterized in that The Arabidopsis thaliana grown to the late vegetative growth stage is Arabidopsis thaliana with 5-6 leaves.
8. The method according to claims 1-7, wherein the spraying of the ethylene inhibitor solution is stopped after the plant completes flower bud differentiation.
9. The method according to claims 1-7, wherein the sprayed ethylene inhibitor solution is a solution containing any one of 1-methylcyclopropene, aminooxyacetic acid, aminoethoxyvinylglycine, pyrazinamide and derivatives thereof.
10. The method according to claim 9, wherein the ethylene inhibitor solution sprayed is a 1-methylcyclopropene-water solution with a concentration of 0.3-1.2 μL / L.
Citation Information
Patent Citations
1-methylcyclopropene liquid preparation
CN101715760A
Small molecular inhibitor pyrazinamide used in plant ethylene synthesis and application thereof
CN103524434A
Application of exogenous ACC in delaying citrus flowering time and increasing flowering number
CN116998347A