Multifunctional bioactive peptide P3 from saccharomyces cerevisiae and application of multifunctional bioactive peptide P3
Through the development of gene-encoded polypeptide P3, the high abundance protein limitation and high cost problems of yeast active peptide production are solved, and the multifunctional bioactive peptide P3 with anti-cancer, antibacterial and antioxidant activities are provided. It is used to prepare anti-tumor drugs and antioxidants, solving the problems of melanoma treatment and oxidative stress.
Patent Information
- Application Number
- CN202410173076.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-02-07
- Publication Date
- 2025-08-08
AI Technical Summary
The prior art has problems of high abundance protein limitation, complex purification steps and high cost when producing yeast active peptides. Moreover, the research on active peptides of Saccharomyces cerevisiae is relatively limited. Traditional chemotherapy is poor in efficacy on melanoma, and chronic diseases caused by oxidative stress lack effective antioxidants.
Through polypeptide encoding gene mining and experimental verification, a multifunctional bioactive peptide P3 derived from Saccharomyces cerevisiae was developed. The amino acid sequence is ISCFSLICNRHF. It has anti-cancer, antibacterial and antioxidant activities, and is used to prepare anti-tumor drugs, antibacterial and antioxidant.
The multifunctional bioactive peptide P3 can effectively inhibit melanoma cell proliferation, inhibit bacterial proliferation, and have the ability to eliminate oxidative free radicals, providing efficient solutions for the treatment of melanoma and antioxidant.
Smart Images

Figure CN120441658A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, and in particular relates to a multifunctional bioactive peptide P3 derived from Saccharomyces cerevisiae and uses thereof. Background Art
[0002] Bioactive peptides are small proteins formed by two or more amino acids linked by peptide bonds. They exhibit one or more biological activities in vivo, including antioxidant, antibacterial, antiviral, antitumor, immune, and blood pressure regulation. Current methods for producing bioactive peptides include chemical synthesis, bioextraction, and enzymatic hydrolysis. A drawback of chemical synthesis is that it may lack the necessary modifications for bioactivity, thus failing to guarantee activity; while bioextraction requires complex purification steps. Enzymatically degraded fragments are typically fragments of highly abundant proteins, and their sequence diversity is often limited by the type of abundant protein, the enzyme's own degradation sites, and abundance constraints. Advances in high-throughput sequencing technology and reduced costs have enabled more efficient annotation of gene sequences, enabling the development of active peptides through synthetic biology approaches such as experimental verification and rational design. Producing peptides from peptide-encoding genes offers advantages such as high purity, ease of purification, ease of scale-up, and ease of genetic modification for enhanced performance. Therefore, the development of gene-encoded peptides is of great significance to research in this field.
[0003] Melanoma (Mel) is a highly malignant skin tumor derived from abnormal melanocytes. It has a low incidence rate but a high mortality rate. Mel can metastasize to lymph nodes through blood vessels. The incidence rate of melanoma in China is nearly 0.9 / 100,000, with approximately 20,000 new melanoma patients each year. At present, the incidence rate of melanoma in my country is increasing year by year, and the 5-year disease-free survival (DFS) rate of patients is only 12.3%, and the median overall survival (OS) of patients with advanced melanoma is only 20 months. Traditional chemotherapy is not effective in treating melanoma, so the development of new drugs to treat melanoma is of great significance.
[0004] Oxidative stress is a major cause of many chronic diseases, including cardiovascular disease, Alzheimer's disease and cancer. Excessive accumulation of reactive oxygen species (ROS) can lead to oxidative damage to cellular biomolecules, such as DNA fragmentation, protein denaturation and membrane lipid peroxidation. Studies have shown that supplementation with antioxidants may help maintain the balance between free radical damage and antioxidant defense, thereby helping to prevent some chronic diseases. Therefore, the development of antioxidants is very necessary. Antioxidant peptides have become one of the most widely studied natural antioxidants due to their high safety, easy availability and good antioxidant effect, and have been used in many fields such as medicine, health care, food and cosmetics. At present, antioxidant peptides from different biological sources have been reported, but research on antioxidant peptides from yeast is still relatively limited (Mirzaei M, Shavandi A, Mirdamadi S, et al. Bioactive peptides from yeast: A comparative review on production methods, bioactivity, structure-function relationship, and stability. Trends in Food Science & Technology, 2021, 118: 297-315).
[0005] Yeast cells are rich in protein, accounting for 30-60% of their dry cell weight. For a long time, research on yeast-derived peptides has focused on identifying various bioactive peptides from yeast extracts, such as those with diverse biological activities such as antioxidants, ACE inhibitors, anti-diabetics, chronic disease prevention, and immune response. However, most of these peptides are derived from yeast cell extracts and enzymatic hydrolysis fragments, and their activity and production are limited by complex techniques, high costs, and limited sequence sources. Saccharomyces cerevisiae is a model eukaryote with a known genome sequence, simple genetic manipulation, mature large-scale fermentation technology, the ability to utilize a variety of inexpensive materials, and biosafety. Therefore, the development of yeast-derived peptides based on genome sequence information offers significant advantages and potential for application. Summary of the Invention
[0006] The present invention obtains a multifunctional bioactive peptide P3 derived from Saccharomyces cerevisiae and its use based on polypeptide encoding gene mining combined with experimental verification. The multifunctional bioactive peptide P3 has triple activities of anticancer, antibacterial and antioxidant. Therefore, it can be used to prepare drugs with tumor cell inhibition or anti-tumor activity, as a candidate component or material basis for drugs for treating melanoma, and can also be used to prepare antibacterial and antioxidant agents.
[0007] In order to achieve the above object, the present invention provides a multifunctional bioactive peptide P3 derived from Saccharomyces cerevisiae, whose amino acid sequence is ISCFSLICNRHF.
[0008] Preferably, the bioactive peptide P3 has a linear analytical structure, a molecular weight of 1439.7024 Da, is an α-helical peptide, and has a net charge of 0.995609 at pH 7.0.
[0009] The present invention also provides a use of the multifunctional bioactive peptide P3 according to any one of the above technical solutions in preparing a preparation for inhibiting tumor cell activity, wherein the amino acid sequence of the multifunctional bioactive peptide P3 is ISCFSLICNRHF.
[0010] The tumor cells are melanoma cells, preferably mouse melanoma cell line B16 cells.
[0011] Preferably, the survival rate of B16 cells decreases with increasing concentration of the bioactive peptide P3. When the concentration of P3 is 200 μg / mL, the cell survival rate is <50%.
[0012] The present invention also provides a use of the multifunctional bioactive peptide P3 according to any one of the above technical solutions in the preparation of a preparation for inhibiting bacterial proliferation, wherein the amino acid sequence of the multifunctional bioactive peptide P3 is ISCFSLICNRHF.
[0013] Preferably, the bacterium is Escherichia coli DH5α.
[0014] Preferably, the survival rate of Escherichia coli DH5α decreases with increasing concentration of the bioactive peptide P3. When the concentration of P3 is 600 μg / mL, the bacterial survival rate is <50%.
[0015] The present invention also provides a use of the multifunctional bioactive peptide P3 according to any of the above technical solutions in preparing a preparation having antioxidant activity and capable of effectively scavenging oxidative free radicals, wherein the amino acid sequence of the multifunctional bioactive peptide P3 is ISCFSLICNRHF.
[0016] Preferably, the bioactive peptide P3 has an ability to scavenge oxidative free radicals similar to that of vitamin E or C when the concentration is 0.25-1 mM.
[0017] Compared with the prior art, the advantages and positive effects of the present invention are:
[0018] Based on the discovery of polypeptide-encoding genes combined with experimental verification, the present invention has obtained a multifunctional bioactive peptide P3 with triple anticancer, antibacterial, and antioxidant activities. When dissolved in ultrapure water, this multifunctional bioactive peptide P3 effectively inhibits the proliferation of cancer cells in the mouse melanoma cell line B16 and bacteria in Escherichia coli DH5α. It also has the ability to scavenge oxidative free radicals. Therefore, this multifunctional bioactive peptide P3 can be used to prepare drugs with tumor cell inhibition or anti-tumor activity, as a candidate component or material basis for melanoma treatment drugs, and can also be used to prepare antibacterial and antioxidant agents. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] Figure 1 A molecular structure diagram of the polypeptide P3 provided in an embodiment of the present invention;
[0020] Figure 2 A secondary structure diagram of the polypeptide P3 provided in an embodiment of the present invention;
[0021] Figure 3 The net charge of the polypeptide P3 under different pH conditions provided in the embodiments of the present invention;
[0022] Figure 4 The invention provides an embodiment of the identification of chemically synthesized polypeptide P3 using high performance liquid chromatography;
[0023] Figure 5 Identification of chemically synthesized polypeptide P3 using mass spectrometry provided in an embodiment of the present invention;
[0024] Figure 6 The inhibitory effect of polypeptide P3 on B16 cells at different concentrations provided in the examples of the present invention;
[0025] Figure 7 The inhibitory effect of polypeptide P3 on Escherichia coli DH5α at different concentrations provided in the embodiments of the present invention;
[0026] Figure 8 The relative antioxidant capacity of the polypeptide P3 at different concentrations provided in the examples of the present invention. DETAILED DESCRIPTION
[0027] The following is a clear and complete description of the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts are within the scope of protection of the present invention.
[0028] Example 1 Gene Annotation of Polypeptide P3
[0029] The Saccharomyces cerevisiae genome was analyzed and the coding sequence of the potential polypeptide P3 was found as follows:
[0030] ATTTCTTGTTTTTCCCTCATTTGCAATCGCCATTTTTAG; located on chromosome 15 of Saccharomyces cerevisiae at chromosomal coordinates chrXV:54338-54376(+), it is 39 bases long. The coding sequence for polypeptide P3 is highly conserved and identical across a variety of industrial alcoholic yeast strains, including whiskey yeast, champagne yeast, wine yeast, Scotch whisky yeast, and high-temperature whisky yeast.
[0031] Example 2 Artificial Synthesis of Polypeptide P3
[0032] The polypeptide P3 contains 12 amino acids, and its amino acid sequence is ISCFSLICNRHF. Its 3-letter amino acid expression is as follows:
[0033] Ile-Ser-Cys-Phe-Ser-Leu-Ile-Cys-Asn-Arg-His-Phe;
[0034] Its molecular structure is Figure 1 As shown, the molecular weight is 1439.7024Da, the isoelectric point is 8.265, and the net charge of polypeptide P3 at pH = 7.0 is 0.995609 (as shown in Figure 3 As shown in Figure 2, the hydrophilic value of the polypeptide is 0.8833, and the hydrophilic residue ratio is 41.67%. In addition, the secondary structure of the polypeptide P3 predicted by alphafold2 is an α-helical peptide, as shown in Figure 2. Figure 2 shown.
[0035] Based on the amino acid sequence of the known polypeptide P3, the peptide was synthesized artificially using conventional solid phase chemical synthesis. Figure 4 As shown) and mass spectrometry (results as shown Figure 5 The results showed that the purity of the chemically synthesized polypeptide P3 was >95%, indicating that the sequence of the polypeptide P3 was accurate.
[0036] Example 3 Study on the inhibitory effect of polypeptide P3 on mouse melanoma cells B16
[0037] 1) Experimental Materials
[0038] a. Cells and Reagents
[0039] B16-F10 mouse melanoma cells (B16) were purchased from the Cell Bank of the Chinese Academy of Sciences. Cell culture flasks and 96-well plates were purchased from Thermo Fisher Scientific. MEM basal medium (https: / / www.thermofisher.cn / cn / zh / home / technical-resources / media-formulation.92.html), fetal bovine serum (FBS, https: / / www.thermofisher.cn / order / catalog / product / 10099141C?SID=srch-srp-10099141C), and trypsin were purchased from Gibco. CCK-8 cell viability assay kit was purchased from Dojin Bio, Japan.
[0040] b.Main equipment
[0041] Cell culture incubator (Thermo Fisher), biological safety cabinet (Labconco), microplate reader (Biotek);
[0042] c. Sample preparation
[0043] In this test of the anti-tumor activity of polypeptide P3, sterilized double-distilled water (abbreviated as ddH2O) was used as the solvent, and polypeptide P3 dry powder was used as the solute. A polypeptide P3 aqueous solution (concentration of 4 mg / mL) was prepared, and the polypeptide was completely dissolved by 40 kHz ultrasound for 30 seconds. The P3 solution was then sterilized by filtration membrane to obtain the P3 solution, which was then gradiently diluted.
[0044] 2) Experimental methods
[0045] a. B16 cell viability test
[0046] B16 cells were cultured in MEM medium containing 10% FBS at 37°C and 5% carbon dioxide. When the cells reached 80% confluence, they were digested with trypsin and centrifuged. The harvested cells were plated at 3×10 4 Cells were seeded into 96-well plates at a density of 10 cells per well. After 24 hours of adherence, the cells were treated with various concentrations of the sample for 24 hours (N = 3). CCK-8 reagent was then added according to the manufacturer's instructions and incubated for 1 hour. OD values were read at 450 nm using a microplate reader. Relative cell viability values were calculated by comparing the mean OD values of the sample group to the blank control group, thereby determining the cytotoxicity of the sample.
[0047] Relative cell activity % = (OD value of sample group / OD value of blank control group) × 100%
[0048] b. Statistical methods
[0049] All results are expressed as mean ± SD. Differences in measurement data were compared using the unpaired t-test, and differences were considered statistically significant when P < 0.05. In the graphs and tables, * represents P < 0.05, ** represents P < 0.01, and *** represents P < 0.001.
[0050] The results are as follows Figure 6 As shown, 10 μg / mL of P3 can inhibit B16 cells (p<0.05). As the concentration of peptide P3 increases, the survival rate of B16 cells gradually decreases. When the peptide concentration is 200 μg / mL, the cell survival rate is 49.95%. At this concentration, the cell survival rate is <50%, indicating that this concentration of peptide P3 has a significant killing effect on B16 cells. Therefore, peptide P3 has anti-cancer activity.
[0051] Example 4 Study on the inhibitory effect of polypeptide P3 on Escherichia coli DH5α
[0052] The experimental steps are as follows:
[0053] 1) Prepare LB medium (peptone -10g / L, sodium chloride -10g / L, yeast extract -5g / L), sterilize at 121℃ for 20 minutes and set aside; ddH2O, sterilize at 121℃ for 20 minutes and set aside;
[0054] 2) Prepare the polypeptide P3 aqueous solution: Use sterilized ddH2O as the solvent and the polypeptide P3 dry powder as the solute to prepare the polypeptide P3 aqueous solution (concentration of 4 mg / mL). Ultrasonicate at 40 kHz for 30 seconds to completely dissolve the polypeptide. Then filter the solution to sterilize it. Store the resulting solution in a refrigerator at -20°C.
[0055] 3) DH5α activation: In a 5 mL centrifuge tube, add 1 mL of LB medium and 50 μL of DH5α culture stock solution and incubate at 37°C for 12 h. Transfer the culture solution to 100 mL of culture medium and incubate overnight.
[0056] 4) Bacterial solution dilution: Determine the OD600 of the bacterial solution obtained in step 3, dilute the bacterial solution to 0.2 with ddH2O, and then dilute it 10-fold with ddH2O to obtain the final diluted bacterial solution for antibacterial activity testing;
[0057] 5) Peptide solution dilution: 4 mg / mL peptide P3 aqueous solution was diluted with ddH2O to 0.8, 1.6, 2.4, and 3.2 mg / mL for subsequent antibacterial activity testing;
[0058] 6) Antibacterial activity detection of polypeptide P3: 100 μL LB medium, 50 μL final diluted bacterial solution, and 50 μL of each concentration of polypeptide P3 aqueous solution (0, 0.8, 1.6, 2.4, 3.2, 4 mg / mL) were added to each well of a 96-well plate, so that the final P3 concentration in each well was 0, 0.2, 0.4, 0.6, 0.8, and 1 mg / mL (three wells for each concentration); 100 μL LB medium and 100 μL ddH2O were added to three empty wells as blank controls; the 96-well plate was placed in a 37°C constant temperature incubator, and the OD600 of each well was measured after incubation for 6 h.
[0059] 7) Calculation of cell viability: Subtract the average absorbance of the blank control from the average absorbance at each concentration to obtain the corrected absorbance at each concentration. Then, divide the corrected absorbance at each concentration by the corrected absorbance when the P3 concentration is 0 to obtain the cell viability.
[0060] The results are as follows Figure 7 As shown, 200 μg / mL of P3 exhibited an inhibitory effect on E. coli DH5α (p<0.001). As the concentration of peptide P3 increased, the survival rate of DH5α gradually decreased. When the peptide concentration was 600 μg / mL, the cell survival rate was 42.77%. At this concentration, the cell survival rate was <50%, indicating that this concentration of peptide P3 had a significant killing effect on E. coli DH5α. Therefore, peptide P3 has antibacterial activity.
[0061] Example 5 Study on the Antioxidant Capacity of Polypeptide P3
[0062] The relative antioxidant capacity of P3 was measured using the Biyuntian-S0121-total antioxidant capacity test kit (ABTS rapid method). The experimental steps are as follows:
[0063] 1) Dilution of hydrogen peroxide solution and peroxidase, and preparation of ABTS working solution:
[0064] c. Dilute the hydrogen peroxide solution 1000 times with ddH2O. Add 1 μL of hydrogen peroxide solution to 999 μL of ddH2O and mix well.
[0065] d. Based on the number of samples to be tested, dilute an appropriate amount of peroxidase 10-fold with assay buffer. Add 30 μL of peroxidase to 270 μL of assay buffer and mix thoroughly to prepare 300 μL of peroxidase working solution. The peroxidase working solution should be prepared fresh.
[0066] e. Prepare ABTS working solution (for 15 assays, total volume 2550 μL): 2280 μL of assay buffer, 150 μL of ABTS solution, and 120 μL of 1 / 1000 hydrogen peroxide solution. Store the prepared ABTS working solution at room temperature in the dark and use within 30 minutes. If the absorbance of the standard at zero concentration is low during the assay, this indicates that the hydrogen peroxide may be partially degraded. Consider adjusting the dilution factor of the hydrogen peroxide to 500x or lower.
[0067] 2) Preparation of samples to be tested:
[0068] A 4 mg / mL (2.223 mM) aqueous solution of P3 polypeptide was diluted to 0.1, 0.25, 0.5, 1, 1.5, and 2 mM for later use.
[0069] 3) Preparation of standard curve measurement:
[0070] Dilute 10 mM Trolox standard solution with ddH2O to 0.15, 0.3, 0.6, 0.9, 1.2, and 1.5 mM for later use;
[0071] 4) Determination of antioxidant capacity:
[0072] a. Add 20 μL of peroxidase working solution to each well of a 96-well plate;
[0073] b. Add 10 μL of ddH2O to the blank control wells, 10 μL of various concentrations of Trolox standard solution to the standard curve test wells, and 10 μL of various concentrations of P3 solution to the sample test wells, and mix gently.
[0074] c. Add 170μL of LABTS working solution to each well and mix gently;
[0075] d. A414 was measured after incubation at room temperature for 6 minutes;
[0076] e. Calculate the ΔA414 of each point of the standard: ΔA414 = A414 空白对照 -A414 标准品 , use ΔA414 and Trolox standard solution concentration to make a standard curve; the standard curve can be expressed by the formula y=ax+b (y is ΔA414, x is Trolox standard solution concentration, a is the slope, y is the intercept); the sample's ΔA414=A414 空白对照 -A414 样品, calculate how many mM of Trolox standard P3 is equivalent to according to the standard curve formula, and divide this value by the sample concentration to obtain the relative antioxidant capacity relative to Trolox; if the absorbance measured by the sample is outside the range of the standard curve, for example, the blank control is 1.5, and the ΔA414 of the sample is less than 0.2 or greater than 1.4, the sample needs to be appropriately concentrated or diluted before measurement.
[0077] The results are as follows Figure 8 As shown, when the concentration of P3 is 0.1, 0.25, 0.5, 1, 1.5, and 2 mM, the relative antioxidant capacity measured relative to Trolox is 0.80, 0.93, 0.99, 0.95, 0.86, and 0.72, respectively. Trolox is an analog of vitamin E and has an antioxidant capacity similar to that of vitamin E. The antioxidant capacity of vitamin C is 1.0, indicating that the ability of polypeptide P3 to scavenge oxidative free radicals is similar to that of vitamin E and vitamin C. However, the advantage of polypeptides is that the synthesis route is short, and they can be fermented and produced in yeast or other microbial host bacteria through gene expression, which is easy to amplify and easy to genetically modify to obtain better active peptide variants. In addition, P3 has multiple biological activities and therefore has good development and application prospects. The polypeptide development method based on genome sequence mining provided by the present invention can also provide a method for reference for the development and utilization of other bioactive peptides.
Claims
1. A multifunctional bioactive peptide P3 derived from Saccharomyces cerevisiae, characterized in that: Its amino acid sequence is ISCFSLICNRHF.
2. The multifunctional bioactive peptide P3 according to claim 1, characterized in that The bioactive peptide P3 is a linear peptide with a molecular weight of 1439.7024 Da, an α-helical peptide, and a net charge of 0.995609 at pH 7.
0.
3. Use of the multifunctional bioactive peptide P3 according to claim 1 or 2 in the preparation of a preparation for inhibiting tumor cell activity, characterized in that: The amino acid sequence of the multifunctional bioactive peptide P3 is ISCFSLICNRHF.
4. The use according to claim 3, characterized in that The tumor cells are melanoma cells, preferably mouse melanoma cell line B16 cells.
5. The use according to claim 4, characterized in that The survival rate of B16 cells decreased with the increase of the concentration of bioactive peptide P3. When the concentration of P3 was 200 μg / mL, the cell survival rate was <50%.
6. Use of the multifunctional bioactive peptide P3 according to claim 1 or 2 in the preparation of a preparation for inhibiting bacterial proliferation, characterized in that: The amino acid sequence of the multifunctional bioactive peptide P3 is ISCFSLICNRHF.
7. The use according to claim 6, characterized in that The bacteria is Escherichia coli DH5α.
8. The use according to claim 7, characterized in that The survival rate of Escherichia coli DH5α decreased with the increase of the concentration of bioactive peptide P3. When the concentration of P3 was 600 μg / mL, the bacterial survival rate was <50%.
9. Use of the multifunctional bioactive peptide P3 according to claim 1 or 2 in the preparation of a preparation having antioxidant activity and capable of effectively scavenging oxidative free radicals, characterized in that: The amino acid sequence of the multifunctional bioactive peptide P3 is ISCFSLICNRHF.
10. The use according to claim 9, characterized in that When the concentration of the bioactive peptide P3 is 0.25-1 mM, its ability to scavenge oxidative free radicals is similar to that of vitamin E or C.