Antibodies to bradykinin B1 receptor ligands

By developing monoclonal antibodies that specifically bind pancreatic kinin and de-Arg10-pancreatic kinin, the problem of difficulty in inhibiting its binding to bradykinin B1 receptor in the prior art has been solved, and effective therapeutic effects on related diseases have been achieved.

CN120441698APending Publication Date: 2025-08-08SANOFI SA(FR)
View PDF 68 Cites 0 Cited by

Patent Information

Application Number
CN202510415465.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2013-02-04
Filing Date
2013-03-15
Publication Date
2025-08-08

AI Technical Summary

Technical Problem

The prior art is difficult to effectively inhibit the binding of pancreatic kinin and de-Arg10-pancreatic kinin to bradykinin B1 receptor, making it difficult to treat related diseases such as pain and fibrosis.

Method used

Develop monoclonal antibodies or antigen-binding fragments of their specific binding to pancreatic kinin and de-Arg10-pancreatic kinin, inhibiting their binding to bradykinin B1 receptor, achieving high affinity and rapid dissociation through specific amino acid sequences and conformational epitopes.

Benefits of technology

A highly effective blockade of pancreatic kinin and de-Arg10-pancreatic kinin is achieved, and it is effective in treating related diseases such as chronic pain and fibrosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120441698A_ABST
    Figure CN120441698A_ABST
Patent Text Reader

Abstract

The present invention relates to antibodies to bradykinin B1 receptor ligands, and specifically provides antibodies that can specifically bind to pancreatic kinin or de-Arg10-pancreatic kinin. The disclosure also provides pharmaceutical compositions, as well as nucleic acids encoding anti-pancreatic kinin or de-Arg10-pancreatic kinin antibodies, recombinant vectors and host cells for making such antibodies or fragments thereof. The invention also provides methods of modulating pancreatic kinin or anti-Arg10-pancreatic kinin activity in vivo or in vitro, or detecting pancreatic kinin or anti-Arg10-pancreatic kinin using the disclosed antibodies. The present disclosure further provides methods of making antibodies that can specifically bind to de-Arg-bradykinin and de-Arg10-pancreatic kinin-like polypeptides.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] This invention application is a re-divisional application of a divisional application with an application date of March 15, 2013, Chinese application number 202111098640.7, and invention name “Antibodies to bradykinin B1 receptor ligands” (original application number 201380027405.8).

[0002] Cross-reference to related applications

[0003] This application claims the benefit of U.S. Provisional Application No. 61 / 616,845, filed March 28, 2012, and French Patent Application No. 1350953, filed February 4, 2013. The contents of these applications are incorporated herein by reference in their entirety. Background of the Invention

[0004] Bradykinin B1 receptors are implicated in the pathogenesis of inflammatory diseases and chronic pain. By regulating tissue inflammation and renal fibrosis, B1 receptors are also implicated in the pathogenesis of acute kidney injury and chronic kidney disease, the leading cause of end-stage renal failure.

[0005] In humans, the primary agonists of the bradykinin B1 receptor are kinins. Kinins are bioactive peptides produced by proteolytic cleavage of the kininogen protein. The primary kinin agonists of the bradykinin B1 receptor are the decapeptide kallikrein and the nonapeptide des-Arg10-kallikrein (formed by proteolytic cleavage of the C-terminal arginine residue of kallikrein). Therefore, agents that inhibit the binding of kallikrein and des-Arg10-kallikrein to the bradykinin B1 receptor have the potential to treat or prevent bradykinin B1 receptor-mediated pathologies.

[0006] Accordingly, there is a need in the art for novel agents that can inhibit the binding of kallikrein and des-Arg10-kallikrein to the bradykinin B1 receptor for the treatment of bradykinin B1 receptor-mediated human pathologies. Summary of the Invention

[0007] The antibodies or fragments thereof provided by the present invention can specifically bind to kallidin and des-Arg10-kalidin, and can prevent kallidin and des-Arg10-kalidin from binding to bradykinin B1 receptors. Such antibodies are particularly effective in treating kallidin and des-Arg10-kalidin-related diseases or disorders (e.g., pain or fibrosis). The present invention also provides pharmaceutical compositions, as well as nucleic acids encoding anti-kalidin and des-Arg10-kalidin antibodies, recombinant expression vectors and host cells that can be used to prepare such antibodies or fragments thereof. Methods for detecting or regulating the activity of kalidin and des-Arg10-kalidin using the antibodies or fragments described in the present invention are also included in the present invention. The present invention also provides methods for preparing antibodies that can specifically bind to des-Arg9-bradykinin and des-Arg10-kalidin-like peptides.

[0008] Accordingly, in one aspect, the present invention provides an isolated monoclonal antibody or antigen-binding fragment thereof, which:

[0009] a) specifically binds to kallidin or des-Arg10-kallidin but not to bradykinin or des-Arg9-bradykinin;

[0010] b) specifically binds to kallikrein or des-Arg10-kallikrein with a KD value of less than 1x10 -10 M;

[0011] c) specifically binds to kallikrein or des-Arg10-kallikrein, with a K off Less than 1x10 4 s -1 ;or

[0012] d) specifically binds to kallidin or des-Arg10-kalidin and inhibits its binding to bradykinin B1 receptor.

[0013] In one embodiment, the antibody or antigen-binding fragment thereof binds to the N-terminal lysine residue of kallidin or des-Arg10-kalidin.

[0014] In another embodiment, the antibody or antigen-binding fragment thereof inhibits the binding of kallikrein or des-Arg10-kallikrein to the bradykinin-1 receptor.

[0015] In another embodiment, the antibody or antigen-binding fragment thereof specifically binds to mouse kallikrein-like peptide (KLP).

[0016] In another embodiment, the antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising a HCDR3 amino acid sequence selected from the group consisting of:

[0017] a) SEQ ID NO: 7 [X1Y X2 X3D X4HAM X5Y], wherein

[0018] X1 is Y, F or H,

[0019] X2 is R, D, A, V, L, I, M, F, Y or W,

[0020] X3 is Y, F, W or H,

[0021] X4 is D, E or Y, and

[0022] X5 is D or E;

[0023] b) SEQ ID NO: 63 [X1EYDGX2YX3X4LDX5], wherein

[0024] X1 is W or F

[0025] X2 is N or no amino acid;

[0026] X3 is Y or S,

[0027] X4 is D or P, and

[0028] X5 is F or Y;

[0029] c) SEQ ID NO: 13;

[0030] d) SEQ ID NO: 32;

[0031] e) SEQ ID NO: 40;

[0032] f) SEQ ID NO: 47; and

[0033] g) SEQ ID NO:55.

[0034] In another embodiment, the antibody or antigen-binding fragment thereof comprises a HCDR2 amino acid sequence selected from the group consisting of:

[0035] a) SEQ ID NO: 8 [YFX1PX2NGNTGYNQKFRG], wherein

[0036] X1 is D, R, A, V, L, I, M, F, Y, or W, and

[0037] X2 is Y, D, E, N, or Q;

[0038] b) SEQ ID NO: 64 [WX1DPENGDX2X3YAPKFQG], wherein

[0039] X1 is I or V,

[0040] X2 is T or S, and

[0041] X3 is G or D;

[0042] c) SEQ ID NO: 14

[0043] d) SEQ ID NO: 33;

[0044] e) SEQ ID NO: 41;

[0045] f) SEQ ID NO: 48; and

[0046] g) SEQ ID NO:56.

[0047] In another embodiment, the antibody or antigen-binding fragment thereof comprises a HCDR1 amino acid sequence selected from the group consisting of:

[0048] a) SEQ ID NO: 9 [GYSFTDYX1IY], wherein X1 is N, W or Y;

[0049] b) SEQ ID NO: 65 [GFNIKDYYX1H], wherein X1 is L, or M;

[0050] c) SEQ ID NO: 15;

[0051] d) SEQ ID NO: 34;

[0052] e) SEQ ID NO: 42;

[0053] f) SEQ ID NO: 49; and

[0054] g) SEQ ID NO:57.

[0055] In another embodiment, the antibody or antigen-binding fragment thereof comprises a light chain variable region comprising a LCDR3 amino acid sequence selected from the group consisting of:

[0056] a) SEQ ID NO: 10 [QQ X1 X2S X3P X4T], wherein

[0057] X1 is Y, F or H,

[0058] X2 is Y, F, H or W,

[0059] X3 is Y, F, T or H, and,

[0060] X4 is W, Y, F, H or L:

[0061] b) SEQ ID NO: 66[QX1X2X3SX4PX5T], wherein

[0062] X1 is Q or N,

[0063] X2 is Y, F, D or H,

[0064] X3 is Y, F, H or W,

[0065] X4 is Y, F, T, or H, and

[0066] X5 is W, Y, F, H or L;

[0067] c) SEQ ID NO: 69 [X1QGTHFPYT], wherein X1 is L or M;

[0068] d) SEQ ID NO: 16;

[0069] e) SEQ ID NO: 35;

[0070] f) SEQ ID NO: 43;

[0071] g) SEQ ID NO: 50; and

[0072] h) SEQ ID NO:58.

[0073] In another embodiment, the antibody or antigen-binding fragment thereof comprises a LCDR2 amino acid sequence selected from the group consisting of:

[0074] a) SEQ ID NO: 11 [WASTRX1], wherein X1 is E, D, Q or N;

[0075] b) SEQ ID NO: 67 [X1ASTRX2], wherein

[0076] X1 is W or G and

[0077] X2 is E, D, Q, or N;

[0078] c) SEQ ID NO: 17;

[0079] d) SEQ ID NO: 36;

[0080] e) SEQ ID NO: 51; and

[0081] f) SEQ ID NO:59.

[0082] In another embodiment, the antibody or antigen-binding fragment thereof comprises a LCDR1 amino acid sequence selected from the group consisting of:

[0083] a) SEQ ID NO: 12 [KSSQSLL X1SSNQKN X2LA], wherein

[0084] X1 is W, H, Y, or F, and

[0085] X2 is H or Y;

[0086] b) SEQ ID NO: 68 [KSSQSLLX1X2SX3QX4NX5LA], wherein

[0087] X1 is W, H, Y or F,

[0088] X2 is S or G,

[0089] X3 is N or D,

[0090] X4 is K or R,

[0091] X5 is H or Y.

[0092] c) SEQ ID NO: 70 [KSSQSLLYSNGX1TYLN], wherein X1 is K or E;

[0093] b) SEQ ID NO: 18;

[0094] c) SEQ ID NO: 37;

[0095] d) SEQ ID NO: 44;

[0096] e) SEQ ID NO: 52; and

[0097] f) SEQ ID NO: 60.

[0098] In another embodiment, the antibody or antigen-binding fragment thereof comprises a light chain variable region comprising a LCDR3 amino acid sequence selected from the group consisting of:

[0099] a) SEQ ID NO: 10 [QQ X1 X2S X3P X4T], wherein

[0100] X1 is Y, F or H,

[0101] X2 is Y, F, H or W,

[0102] X3 is Y, F, T or H, and,

[0103] X4 is W, Y, F, H or L:

[0104] b) SEQ ID NO: 66[QX1X2X3SX4PX5T], wherein

[0105] X1 is Q or N,

[0106] X2 is Y, F, D or H,

[0107] X3 is Y, F, H or W,

[0108] X4 is Y, F, T, or H, and

[0109] X5 is W, Y, F, H or L;

[0110] c) SEQ ID NO: 69 [X1QGTHFPYT], wherein X1 is L or M;

[0111] d) SEQ ID NO: 16;

[0112] e) SEQ ID NO: 35;

[0113] f) SEQ ID NO: 43;

[0114] g) SEQ ID NO: 50; and

[0115] h) SEQ ID NO:58.

[0116] In another embodiment, the antibody or antigen-binding fragment thereof comprises a LCDR2 amino acid sequence selected from the group consisting of:

[0117] a) SEQ ID NO: 11 [WASTRX1], wherein X1 is E, D, Q or N;

[0118] b) SEQ ID NO: 67 [X1ASTRX2], wherein

[0119] X1 is W or G and

[0120] X2 is E, D, Q, or N;

[0121] c) SEQ ID NO: 17;

[0122] d) SEQ ID NO: 36;

[0123] e) SEQ ID NO: 51; and

[0124] f) SEQ ID NO:59.

[0125] In another embodiment, the antibody or antigen-binding fragment thereof comprises a LCDR1 amino acid sequence selected from the group consisting of:

[0126] a) SEQ ID NO: 12 [KSSQSLL X1SSNQKN X2LA], wherein

[0127] X1 is W, H, Y, or F, and

[0128] X2 is H or Y;

[0129] b) SEQ ID NO: 68 [KSSQSLLX1X2SX3QX4NX5LA], wherein

[0130] X1 is W, H, Y or F,

[0131] X2 is S or G,

[0132] X3 is N or D,

[0133] X4 is K or R,

[0134] X5 is H or Y.

[0135] c) SEQ ID NO: 70 [KSSQSLLYSNGX1TYLN], wherein X1 is K or E;

[0136] b) SEQ ID NO: 18;

[0137] c) SEQ ID NO: 37;

[0138] d) SEQ ID NO: 44;

[0139] e) SEQ ID NO: 52; and

[0140] f) SEQ ID NO: 60.

[0141] In another embodiment, the antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising HCDR3, HCDR2 and HCDR1 regions, the amino acid sequences of HCDR3, HCDR2 and HCDR1 being as shown in SEQ ID NOs 13, 14, and 15, respectively, and having one or more amino acid substitutions selected from the group consisting of H1, H5, H9, H11, H12, H16, H38, H40, H41, H43, H44, H66, H75, H79, H81, H82A, H83, H87, and H108 according to Kabat.

[0142] In another embodiment, the antibody or antigen-binding fragment thereof comprises a light chain variable region comprising LCDR3, LCDR2 and LCDR1 regions, the amino acid sequences of LCDR3, LCDR2 and LCDR1 regions being as shown in SEQ ID NOs 16, 17, and 18, respectively, and having one or more amino acid substitutions selected from the group consisting of L5, L9, L15, L18, L19, L21, L22, L43, L63, L78, L79, L83, L85, L100 and L104 according to Kabat.

[0143] In another embodiment, the antibody or antigen-binding fragment thereof comprises a heavy chain variable region amino acid sequence that is at least 90% identical to any sequence in the group consisting of SEQ ID NOs: 19, 20, 21, 22, 24, 25, 38, 45, 53, and 61.

[0144] In another embodiment, the antibody or antigen-binding fragment thereof comprises a light chain variable region amino acid sequence that is at least 90% identical to any sequence in the group consisting of SEQ ID NOs: 26, 27, 28, 29, 29, 30, 31, 39, 46, 54, and 62.

[0145] In another embodiment, the antibody or antigen-binding fragment thereof comprises a light chain variable region amino acid sequence that is at least 90% identical to any sequence in the group consisting of SEQ ID NOs: 26, 27, 28, 29, 29, 30, 31, 39, 46, 54, and 62.

[0146] In another embodiment, the antibody or antigen-binding fragment thereof comprises a heavy chain variable region amino acid sequence selected from the group consisting of SEQ ID NOs: 19, 20, 21, 22, 24, 25, 38, 45, 53, and 61.

[0147] In another embodiment, the antibody or antigen-binding fragment thereof comprises a light chain variable region amino acid sequence selected from the group consisting of SEQ ID NOs: 26, 27, 28, 29, 29, 30, 31, 39, 46, 54, and 62.

[0148] In another embodiment, the antibody or antigen-binding fragment thereof comprises an amino acid sequence selected from SEQ ID NOs: 26, 27, 28, 29, 29, 30, 31, 39, 46, 54, and 62.

[0149] In another embodiment, the antibody or antigen-binding fragment thereof comprises heavy and light chain variable region amino acid sequences as shown in SEQ ID NOs: 19 and 26, SEQ ID NOs: 20 and 27; SEQ ID NOs: 21 and 28; SEQ ID NOs: 22 and 28; SEQ ID NOs: 23 and 29; SEQ ID NOs: 24 and 30; SEQ ID NOs: 25 and 31; SEQ ID NOs: 38 and 39; SEQ ID NOs: 45 and 46, SEQ ID NOs: 53 and 54, or SEQ ID NOs: 61 and 62, respectively.

[0150] In another aspect, the present invention provides an antibody or an antigen-binding fragment thereof that can specifically bind to kallikrein or des-Arg10-kallikrein, and the above-mentioned antibody or antigen-binding fragment thereof competes for binding to kallikrein or des-Arg10-kallikrein with an antibody comprising heavy chain and light chain variable region amino acid sequences as shown in SEQ ID NOs: 19 and 26, SEQ ID NOs: 38 and 39, SEQ ID NOs: 45 and 46, SEQ ID NOs: 53 and 54, or SEQ ID NOs: 61 and 62, respectively.

[0151] In another aspect, the present invention provides an isolated monoclonal antibody or antigen-binding fragment thereof that competes with the antibody of any preceding claim for binding to kallidin or des-Arg10-kalidin and does not bind to bradykinin or des-Arg9-bradykinin.

[0152] In another aspect, the present invention provides an isolated monoclonal antibody or antigen-binding fragment thereof that specifically binds to a conformational epitope of kallikrein (KD) or des-Arg10-kallikrein (DAKD), wherein KD or DAKD adopts a Pro4 knot conformation that includes a tight type II turn of proline at position 4. In one embodiment, the Pro 4 knot conformation of KD or DAKD further comprises an S-shaped amino acid repeat that arranges the hydrophobic side chains of the amino acid chains into a spatial stacking pattern. In another embodiment, the antibody or antigen-binding fragment thereof comprises: (a) specific binding to kallikrein or des-Arg10-kallikrein without binding to bradykinin or des-Arg9-bradykinin; (b) specific binding to kallikrein or des-Arg10-kallikrein with a KD value of less than 1x10 -10 M; (c) specifically binds to kallikrein or des-Arg10-kallikrein, K off Less than 1x10 4 s -1 or (d) specifically binds to kallidin or des-Arg10-kalidin and inhibits its binding to the bradykinin B1 receptor.

[0153] In another aspect, the antibodies or antigen-binding fragments of the invention are conjugated to a diagnostic or therapeutic agent.

[0154] In another aspect, the present invention provides an isolated nucleic acid encoding the amino acid sequence of the antibody or antigen-binding fragment thereof of the present invention.

[0155] In another aspect, the present invention provides a recombinant expression vector comprising the nucleic acid of the present invention.

[0156] In another aspect, the present invention provides a host cell comprising the recombinant expression vector of the present invention.

[0157] In another aspect, the present invention provides a method for producing an antibody that specifically binds to kallidin or des-Arg10-kalidin, comprising: culturing the host cell of the present invention under conditions that allow the host cell to produce an antibody that specifically binds to kallidin or des-Arg10-kalidin.

[0158] In another aspect, the present invention provides a pharmaceutical composition comprising the antibody or antigen-binding fragment thereof of the present invention, and one or more pharmaceutically acceptable carriers.

[0159] In another aspect, the present invention provides a method for treating a disease or disorder associated with kallikrein or des-Arg10-kallikrein, comprising administering the pharmaceutical composition of the present invention to a subject in need thereof.

[0160] In one embodiment, the disease or disorder is chronic pain.

[0161] On the other hand, the present invention provides a method for producing antibodies that specifically bind to des-Arg9-bradykinin and des-Arg10-kallikrein-like peptide, comprising: immunizing an animal with an immunogen comprising a peptide, wherein the peptide contains the amino acid sequence shown in SEQ ID No. 11, and wherein the arginine at the amino terminus of the peptide is indirectly coupled to a carrier group via a linker, such that the animal's immune system can produce antibodies that specifically bind to des-Arg9-bradykinin, des-Arg10-kallikrein and des-Arg10-kallikrein-like peptide.

[0162] In another embodiment, the method of the present invention further comprises: isolating the antibody, isolating the nucleic acid encoding the antibody, or isolating immune cells expressing the antibody from the animal.

[0163] In one embodiment, the carrier group is a protein. In another embodiment, the protein is keyhole limpet hemocyanin (KLH). In another embodiment, the linker group comprises: [Gly-Gly-Gly]n, wherein n is at least 1.

[0164] Specifically, the present invention relates to the following:

[0165] 1. An isolated monoclonal antibody or antigen-binding fragment thereof, which:

[0166] a) specifically binds to kallidin or des-Arg10-kallidin but not to bradykinin or des-Arg9-bradykinin;

[0167] b) Specific binding to kallikrein or des-Arg10-kallikrein with a KD value of less than 1x10 -10 M;

[0168] c) specifically binds to kallikrein or des-Arg10-kallikrein, K off Less than 1x10 4 s -1 and / or

[0169] d) specifically binds to kallidin or des-Arg10-kalidin and inhibits its binding to bradykinin B1 receptor.

[0170] 2. The antibody or antigen-binding fragment thereof according to any one of the preceding claims, which binds to the N-terminal lysine residue of kallikrein or des-Arg10-kallikrein.

[0171] 3. The antibody or antigen-binding fragment of any of the preceding items, which inhibits the binding of kallikrein or des-Arg10-kallikrein to the bradykinin-1 receptor.

[0172] 4. The antibody or antigen-binding fragment thereof according to the preceding item, which specifically binds to mouse kallikrein-like peptide (KLP).

[0173] 5. The antibody or antigen-binding fragment thereof according to any of the preceding items, comprising a heavy chain variable region comprising a HCDR3 amino acid sequence selected from the group consisting of:

[0174] a) SEQ ID NO: 7 [X1Y X2 X3D X4HAM X5Y], wherein

[0175] X1 is Y, F or H,

[0176] X2 is R, D, A, V, L, I, M, F, Y or W,

[0177] X3 is Y, F, W or H,

[0178] X4 is D, E or Y, and

[0179] X5 is D or E;

[0180] b) SEQ ID NO: 63 [X1EYDGX2YX3X4LDX5], wherein

[0181] X1 is W or F

[0182] X2 is N or no amino acid;

[0183] X3 is Y or S,

[0184] X4 is D or P, and

[0185] X5 is F or Y;

[0186] c) SEQ ID NO: 13;

[0187] d) SEQ ID NO: 32;

[0188] e) SEQ ID NO: 40;

[0189] f) SEQ ID NO: 47; and

[0190] g) SEQ ID NO:55.

[0191] 6. The antibody or antigen-binding fragment thereof according to any of the preceding items, further comprising a HCDR2 amino acid sequence selected from the group consisting of:

[0192] a) SEQ ID NO: 8 [YFX1PX2NGNTGYNQKFRG], wherein

[0193] X1 is D, R, A, V, L, I, M, F, Y, or W, and

[0194] X2 is Y, D, E, N, or Q;

[0195] b) SEQ ID NO: 64 [WX1DPENGDX2X3YAPKFQG], wherein

[0196] X1 is I or V,

[0197] X2 is T or S, and

[0198] X3 is G or D;

[0199] c) SEQ ID NO: 14

[0200] d) SEQ ID NO: 33;

[0201] e) SEQ ID NO: 41;

[0202] f) SEQ ID NO: 48; and

[0203] g) SEQ ID NO:56.

[0204] 7. The antibody or antigen-binding fragment thereof according to any of the preceding items, further comprising a HCDR1 amino acid sequence selected from the group consisting of:

[0205] a) SEQ ID NO: 9 [GYSFTDYX1IY], wherein X1 is N, W or Y;

[0206] b) SEQ ID NO: 65 [GFNIKDYYX1H], wherein X1 is L, or M;

[0207] c) SEQ ID NO: 15;

[0208] d) SEQ ID NO: 34;

[0209] e) SEQ ID NO: 42;

[0210] f) SEQ ID NO: 49; and

[0211] g) SEQ ID NO:57.

[0212] 8. The antibody or antigen-binding fragment thereof according to any of the preceding items, further comprising a light chain variable region comprising a LCDR3 amino acid sequence selected from the group consisting of:

[0213] a) SEQ ID NO: 10 [QQ X1 X2S X3P X4T], wherein

[0214] X1 is Y, F or H,

[0215] X2 is Y, F, H or W,

[0216] X3 is Y, F, T or H, and,

[0217] X4 is W, Y, F, H or L;

[0218] b) SEQ ID NO: 66[QX1X2X3SX4PX5T], wherein

[0219] X1 is Q or N,

[0220] X2 is Y, F, D or H,

[0221] X3 is Y, F, H or W,

[0222] X4 is Y, F, T, or H, and

[0223] X5 is W, Y, F, H or L;

[0224] c) SEQ ID NO: 69 [X1QGTHFPYT], wherein X1 is L or M;

[0225] d) SEQ ID NO: 16;

[0226] e) SEQ ID NO: 35;

[0227] f) SEQ ID NO: 43;

[0228] g) SEQ ID NO: 50; and

[0229] h) SEQ ID NO:58.

[0230] 9. The antibody or antigen-binding fragment thereof according to any of the preceding items, further comprising a LCDR2 amino acid sequence selected from the group consisting of:

[0231] a) SEQ ID NO: 11 [WASTRX1], wherein X1 is E, D, Q or N;

[0232] b) SEQ ID NO: 67 [X1ASTRX2], wherein

[0233] X1 is W or G, and

[0234] X2 is E, D, Q, or N;

[0235] c) SEQ ID NO: 17;

[0236] d) SEQ ID NO: 36;

[0237] e) SEQ ID NO: 51; and

[0238] f) SEQ ID NO:59.

[0239] 10. The antibody or antigen-binding fragment thereof according to any of the preceding claims, further comprising a LCDR1 amino acid sequence selected from the following group:

[0240] a) SEQ ID NO: 12 [KSSQSLL X1SSNQKN X2LA], wherein

[0241] X1 is W, H, Y, or F, and

[0242] X2 is H or Y;

[0243] b) SEQ ID NO: 68 [KSSQSLLX1X2SX3QX4NX5LA], wherein

[0244] X1 is W, H, Y or F,

[0245] X2 is S or G,

[0246] X3 is N or D,

[0247] X4 is K or R,

[0248] X5 is H or Y.

[0249] c) SEQ ID NO: 70 [KSSQSLLYSNGX1TYLN], wherein X1 is K or E;

[0250] b) SEQ ID NO: 18;

[0251] c) SEQ ID NO: 37;

[0252] d) SEQ ID NO: 44;

[0253] e) SEQ ID NO: 52; and

[0254] f) SEQ ID NO: 60.

[0255] 11. The antibody or antigen-binding fragment thereof according to any one of items 1 to 4, comprising a light chain variable region comprising a LCDR3 amino acid sequence selected from the group consisting of:

[0256] a) SEQ ID NO: 10 [QQ X1 X2S X3P X4T], wherein

[0257] X1 is Y, F or H,

[0258] X2 is Y, F, H or W,

[0259] X3 is Y, F, T or H, and,

[0260] X4 is W, Y, F, H or L:

[0261] b) SEQ ID NO: 66[QX1X2X3SX4PX5T], wherein

[0262] X1 is Q or N,

[0263] X2 is Y, F, D or H,

[0264] X3 is Y, F, H or W,

[0265] X4 is Y, F, T, or H, and

[0266] X5 is W, Y, F, H or L;

[0267] c) SEQ ID NO: 69 [X1QGTHFPYT], wherein X1 is L or M;

[0268] d) SEQ ID NO: 16;

[0269] e) SEQ ID NO: 35;

[0270] f) SEQ ID NO: 43;

[0271] g) SEQ ID NO: 50; and

[0272] h) SEQ ID NO:58.

[0273] 12. The antibody or antigen-binding fragment thereof of claim 11, further comprising a LCDR2 amino acid sequence selected from the group consisting of:

[0274] a) SEQ ID NO: 11 [WASTRX1], wherein X1 is E, D, Q or N;

[0275] b) SEQ ID NO: 67 [X2ASTRX2], wherein

[0276] X1 is W or G, and

[0277] X2 is E, D, Q, or N;

[0278] c) SEQ ID NO: 17;

[0279] d) SEQ ID NO: 36;

[0280] e) SEQ ID NO: 51; and

[0281] f) SEQ ID NO:59.

[0282] 13. The antibody or antigen-binding fragment thereof of claim 12, further comprising a LCDR1 amino acid sequence selected from the group consisting of:

[0283] a) SEQ ID NO: 12 [KSSQSLLX1SSNQKN X2LA], wherein

[0284] X1 is W, H, Y, or F, and

[0285] X2 is H or Y;

[0286] b) SEQ ID NO: 68 [KSSQSLLX1X2SX3QX4NX5LA], wherein

[0287] X1 is W, H, Y or F,

[0288] X2 is S or G,

[0289] X3 is N or D,

[0290] X4 is K or R,

[0291] X5 is H or Y.

[0292] c) SEQ ID NO: 70 [KSSQSLLYSNGX1TYLN], wherein X1 is K or E;

[0293] b) SEQ ID NO: 18;

[0294] c) SEQ ID NO: 37;

[0295] d) SEQ ID NO: 44;

[0296] e) SEQ ID NO: 52; and

[0297] f) SEQ ID NO: 60.

[0298] 14. The antibody or antigen-binding fragment thereof of any one of items 1-4, which comprises a heavy chain variable region comprising HCDR3, HCDR2 and HCDR1 regions, the amino acid sequences of HCDR3, HCDR2 and HCDR1 regions being as shown in SEQ ID NOs 13, 14, and 15, respectively, and having one or more amino acid substitutions selected from the following positions according to Kabat: H1, H5, H9, H11, H12, H16, H38, H40, H41, H43, H44, H66, H75, H79, H81, H82A, H83, H87, and H108.

[0299] 15. The antibody or antigen-binding fragment thereof of claim 14, further comprising a light chain variable region comprising LCDR3, LCDR2 and LCDR1 regions, wherein the amino acid sequences of LCDR3, LCDR2 and LCDR1 regions are as shown in SEQ ID NOs 16, 17, and 18, respectively, and wherein according to Kabat, there are one or more amino acid substitutions selected from the following positions: L5, L9, L15, L18, L19, L21, L22, L43, L63, L78, L79, L83, L85, L100 and L104.

[0300] 16. The antibody or antigen-binding fragment thereof of any one of items 1-4, which comprises a light chain variable region comprising LCDR3, LCDR2 and LCDR1 regions, wherein the amino acid sequences of LCDR3, LCDR2 and LCDR1 regions are shown in SEQ ID NOs 16, 17, and 18, respectively, and according to Kabat, there are one or more substitutions selected from the following amino acid positions: L5, L9, L15, L18, L19, L21, L22, L43, L63, L78, L79, L83, L85, L100 and L104.

[0301] 17. The antibody or antigen-binding fragment thereof of any one of items 1-4, comprising a heavy chain variable region amino acid sequence that is at least 90% identical to any sequence in the group comprising SEQ ID NOs: 19, 20, 21, 22, 24, 25, 38, 45, 53, and 61.

[0302] 18. The antibody or antigen-binding fragment thereof of claim 17, further comprising a light chain variable region amino acid sequence that is at least 90% identical to any sequence in the group comprising SEQ ID NOs: 26, 27, 28, 29, 29, 30, 31, 39, 46, 54, and 62.

[0303] 19. The antibody or antigen-binding fragment thereof of any one of items 1-4, comprising a light chain variable region amino acid sequence that is at least 90% identical to any sequence in the group comprising SEQ ID NOs: 26, 27, 28, 29, 29, 30, 31, 39, 46, 54, and 62.

[0304] 20. The antibody or antigen-binding fragment thereof of any one of items 1-4, comprising a heavy chain variable region amino acid sequence selected from the group consisting of SEQ ID NOs: 19, 20, 21, 22, 24, 25, 38, 45, 53, and 61.

[0305] 21. The antibody or antigen-binding fragment thereof of claim 20, further comprising a light chain variable domain amino acid sequence selected from the group consisting of SEQ ID NOs: 26, 27, 28, 29, 29, 30, 31, 39, 46, 54, and 62.

[0306] 22. The antibody or antigen-binding fragment thereof of any one of items 1-4, comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 26, 27, 28, 29, 29, 30, 31, 39, 46, 54, and 62.

[0307] 23. The antibody or antigen-binding fragment thereof according to any one of items 1-4, wherein the amino acid sequences of the heavy and light chain variable regions are as shown in SEQ ID NO: 19 and 26, SEQ ID NO: 20 and 27; SEQ ID NO: 21 and 28; SEQ ID NO: 22 and 28; SEQ ID NO: 23 and 29; SEQ ID NO: 24 and 30; SEQID NO: 25 and 31; SEQ ID NO: 38 and 39; SEQ ID NO: 45 and 46, SEQ ID NO: 53 and 54, or SEQ ID NO: 61 and 62, respectively.

[0308] 24. An antibody or an antigen-binding fragment thereof that can specifically bind to kallikrein or des-Arg10-kallikrein, wherein the antibody or the antigen-binding fragment thereof competes for binding to kallikrein or des-Arg10-kallikrein with an antibody comprising heavy and light chain variable region amino acid sequences as shown in SEQ ID NOs: 19 and 26, SEQ ID NOs: 38 and 39, SEQ ID NOs: 45 and 46, SEQ ID NOs: 53 and 54, or SEQ ID NOs: 61 and 62, respectively.

[0309] 25. An isolated monoclonal antibody or antigen-binding fragment thereof that competes with any of the preceding antibodies for binding to kallikrein or des-Arg10-kallikrein and does not bind to bradykinin or des-Arg9-bradykinin.

[0310] 26. An isolated monoclonal antibody or antigen-binding fragment thereof that specifically binds to a conformational epitope of kallikrein (KD) or des-Arg10-kallikrein (DAKD), wherein KD or DAKD adopts a Pro4 knob conformation that includes a tight type II turn at proline 4.

[0311] 27. The antibody or antigen-binding fragment of claim 26, wherein the knobby conformation of Pro 4 of KD or DAKD further comprises an S-shaped amino acid repeat that arranges the hydrophobic side chains of the amino acid chains into a spatial stacking pattern.

[0312] 28. The antibody or antigen-binding fragment of item 26 or 27, wherein

[0313] a) specifically binds to kallidin or des-Arg10-kallidin but not to bradykinin or des-Arg9-bradykinin;

[0314] b) Specific binding to kallikrein or des-Arg10-kallikrein with a KD value of less than 1x10 -10 M;

[0315] c) specifically binds to kallikrein or des-Arg10-kallikrein, K off Less than 1x10 4 s -1 and / or

[0316] d) specifically binds to kallidin or des-Arg10-kalidin and inhibits its binding to bradykinin B1 receptor.

[0317] 29. The antibody of any preceding claim, conjugated to a diagnostic or therapeutic agent.

[0318] 30. An isolated nucleic acid encoding the amino acid sequence of any preceding antibody or antigen-binding fragment thereof.

[0319] 31. A recombinant expression vector comprising the nucleic acid of item 30.

[0320] 32. A host cell comprising the recombinant expression vector of item 31.

[0321] 33. A method for producing an antibody that specifically binds to kallidin or des-Arg10-kalidin, comprising: culturing the host cell of item 32 under conditions that allow the host cell to produce an antibody that specifically binds to kallidin or des-Arg10-kalidin.

[0322] 34. A pharmaceutical composition comprising the antibody or antigen-binding fragment thereof according to any one of items 1 to 28, and one or more pharmaceutically acceptable carriers.

[0323] 35. A method for treating a disease or disorder associated with kallikrein or des-Arg10-kallikrein, comprising administering the pharmaceutical composition of item 34 to a subject in need thereof.

[0324] 36. The method of claim 35, wherein the disease or disorder is chronic pain.

[0325] 37. A method for producing antibodies that specifically bind to des-Arg9-bradykinin and des-Arg10-kallikrein-like peptide, comprising: immunizing an animal with an immunogen comprising a peptide, wherein the peptide contains the amino acid sequence shown in SEQ ID No. 11, and wherein the arginine at the amino terminus of the peptide is indirectly coupled to a carrier group via a linker, such that the animal's immune system can produce antibodies that specifically bind to des-Arg9-bradykinin, des-Arg10-kallikrein and des-Arg10-kallikrein-like peptide.

[0326] 38. The method of claim 37, further comprising isolating the antibody, the nucleic acid encoding the antibody, or the immune cell expressing the antibody from the animal.

[0327] 39. The method of claim 37, wherein the carrier group is a protein.

[0328] 40. The method of claim 39, wherein the protein is keyhole limpet hemocyanin (KLH).

[0329] 41. The method of claim 40, wherein the linker group comprises: [Gly-Gly-Gly]n, wherein n is at least 1. BRIEF DESCRIPTION OF THE DRAWINGS

[0330] Figure 1 The results of ELISA analysis confirming the binding of EE1 antibody to kinin are shown.

[0331] Figure 2 Shown are the results of differential scanning calorimetry measurements of antibody F151.

[0332] Figure 3 The amino acid sequence alignment of the variable regions of the mouse and humanized F151 antibodies is shown. All identical residues are listed on a straight line, homologous residues are marked with a "+" sign, and non-homologous residues are left blank.

[0333] Figure 4 The electron density map of the antigen binding site of the F151 antibody / kallikrein complex is shown.

[0334] Figure 5 The electron density map of the antigen binding site of the F151 antibody / des-Arg10-kinin complex is shown.

[0335] Figure 6 A ball-and-stick representation of the Fv subunit of F151 bound to kallidin is shown.

[0336] Figure 7 An amino acid sequence alignment of the light chain variable regions of exemplary murine anti-kallikrein antibodies of the invention is shown. Amino acid residues that interact with kallikrein are marked with asterisks.

[0337] Figure 8 An amino acid sequence alignment of the heavy chain variable regions of exemplary murine anti-kallikrein antibodies of the invention is shown. Amino acid residues that interact with kallikrein are marked with asterisks.

[0338] Figure 9 Shown are the results of an in vivo experiment to determine the effect of EE1 antibody on formalin-induced acute inflammatory pain.

[0339] Figure 10 Shown are the results of an in vivo experiment determining the effect of EE1 antibody on complete Freund's adjuvant (CFA)-induced mechanical hypersensitivity.

[0340] Figure 11 Shown are the results of in vivo experiments determining the effect of EE1 antibody on complete Freund's adjuvant (CFA)-induced thermal hypersensitivity.

[0341] Figure 12 Shown are the results of in vivo experiments determining the effect of EE1 antibody on CCI-induced mechanical hypersensitivity.

[0342] Figure 13 Shown are the results of in vivo experiments determining the effect of EE1 antibody on CCI-induced thermal hypersensitivity.

[0343] Figure 14 Schematic diagram of the VL and VH expression constructs used to generate the humanized F151 variant HC3a / LC3a. The constructs contain restriction endonuclease sites for DNA, with the deduced restriction site sequences indicated in bold and underlined. The left panel shows the light chain, and the right panel shows the heavy chain.

[0344] Figure 15 Shown are alignments of the F151 heavy chain (A) and light chain (B) amino acid sequences with the closest human amino acid sequences.

[0345] Figure 16 Alignment of the F151 heavy chain (A) and light chain (B) with the heavy chain locus (1-08 & 1-18) and light chain locus (VIIB3) of the VH1 subfamily is shown. The CDR regions and cursor regions are shown in bold, and the humanizing mutations are underlined.

[0346] Figure 17 Shown are the (A) secondary and (B) tertiary structures of the main-chain polypeptide backbone conformation of kallikrein (KD) when bound to the F151 antibody, which contains a type II tight turn at proline 4 (C). DETAILED DESCRIPTION

[0347] The present invention provides antibodies that can specifically bind to kallikrein and des-Arg10-kallikrein and prevent kallikrein and des-Arg10-kallikrein from binding to the bradykinin B1 receptor. Such antibodies are particularly effective in treating diseases or disorders associated with kallikrein and des-Arg10-kallikrein (e.g., pain). The present invention also provides pharmaceutical compositions, and nucleic acids encoding anti-kallikrein and des-Arg10-kallikrein antibodies, recombinant expression vectors, and host cells for preparing such antibodies or antigen-binding fragments thereof. The present invention also includes methods for detecting or modulating the activity of kallikrein and des-Arg10-kallikrein in vitro or in vivo using the antibodies of the present invention.

[0348] I. Definition

[0349] In order for the present invention to be better understood, some terms are first defined.

[0350] The term "kallikrein" as used herein refers to a polypeptide comprising or consisting of the amino acid sequence KRPPGFSPFR (SEQ ID NO. 1).

[0351] The term "des-Arg10-kinin" as used herein refers to a polypeptide comprising or consisting of the amino acid sequence KRPPGFSPF (SEQ ID NO. 2).

[0352] The term "mouse kallikrein" or "kallikrein-like peptide" as used herein refers to a polypeptide comprising or consisting of the amino acid sequence RRPPGFSPFR (SEQ ID NO. 3).

[0353] The term "mouse des-Arg10-kallikrein" or "des-Arg10-kallikrein-like peptide" as used herein refers to a polypeptide comprising or consisting of the amino acid sequence RRPPGFSPF (SEQ ID NO. 4).

[0354] The term "bradykinin" as used herein refers to a polypeptide comprising or consisting of the amino acid sequence RPPGFSPFR (SEQ ID NO. 5).

[0355] The term "des-Arg9-bradykinin" as used herein refers to a polypeptide comprising or consisting of the amino acid sequence RPPGFSPF (SEQ ID NO. 6).

[0356] The term "antibody" as used herein refers to an immunoglobulin molecule and its polymers (e.g., IgM) comprising four polypeptide chains, two heavy (H) chains and two light (L) chains interconnected by disulfide bonds. Each heavy chain contains a heavy chain variable region (abbreviated as V H or VH) and a heavy chain constant region (abbreviated as C H The heavy chain constant region consists of three domains: C H 1, CH 2, C H 3. Each light chain contains a light chain variable region (abbreviated as V L ) and a light chain constant region (abbreviated as C L or CL). The light chain constant region comprises a domain (C L 1). V H and V L It can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDRs), and interspersed with more conserved regions, termed framework regions (FRs). H and V L It contains three CDRs and four FRs, arranged in the following order from N-terminus to C-terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.

[0357] As used herein, the term "antigen-binding fragment" of an antibody includes any naturally occurring, enzymatically produced, synthetic, or genetically engineered polypeptide or glycoprotein that can specifically bind to an antigen to form a complex. Antigen-binding fragments of an antibody can be derived, for example, from whole antibody molecules using any suitable standard technique, such as proteolytic digestion or recombinant genetic engineering techniques involving the manipulation and expression of DNA encoding the variable and optional constant domains of an antibody. Non-limiting examples of antigen-binding portions include: (i) Fab fragments; (ii) F(ab')2 fragments; (iii) Fd fragments; (iv) Fv fragments; (v) single-chain Fv (scFv) molecules; (vi) dAb fragments; and (vii) minimal recognition units composed of amino acid residues that mimic the hypervariable regions (e.g., isolated complementarity determining regions (CDRs)) of an antibody. The term "antigen-binding fragment" also includes other engineered molecules, such as diabodies, trimers, tetrabodies, and microbodies.

[0358] As used herein, the term "CDR" or "complementarity determining region" refers to the discrete antigen binding sites found in the variable regions of the heavy and light chain polypeptide chains. These specific regions have been described in Kabat et al. J. Biol. Chem. 252, 6609-6616 (1977) and Kabat et al. Sequences of protein of immunological interest (1991), as well as Chothia et al. J. Mol. Biol. 196: 901-917 (1987) and MacCallum et al. J. Mol. Biol. 262: 732-745 (1996), and their definitions include certain overlaps and subsets of amino acid residues when compared to each other. The amino acid residues that constitute the CDRs, as defined in the references cited above, are shown for comparison. In one embodiment of the present invention, the term "CDR" refers to a CDR as defined by Kabat, i.e., based on sequence comparison.

[0359] As used herein, the term "framework (FR) amino acid residues" refers to amino acids in the framework region of an Ig chain. As used herein, the term "framework region" or "FR region" encompasses amino acid residues that are part of the variable region but not part of the CDRs (e.g., CDRs according to the Kabat definition). Thus, the variable region framework is approximately 100-120 amino acids in length, but includes only those amino acids outside of the CDRs.

[0360] As used herein, the term "specific binding" refers to the ability of an antibody or antigen-binding fragment thereof to bind to an antigen as expressed by an equilibrium dissociation constant (Kd) of at least about 1x10 -6 M, 1x10 -7 M, 1x10 -8 M, 1x10 -9 M, 1x10 -10 M, 1x10 -11 M, 1x10 -12 M, or higher. The term also includes antibodies or antigen-binding fragments thereof that bind to the antigen with an affinity at least twice that of a nonspecific antigen. It should be understood, however, that antibodies or antigen-binding fragments thereof can specifically bind to two or more antigens that are related in sequence (e.g., kallikrein or des-Arg10-kallikrein and mouse kallikrein or des-Arg10-kallikrein).

[0361] The term "antigen," as used herein, refers to the binding site or epitope recognized by an antibody or antigen-binding fragment thereof.

[0362] As used herein, the term "vector" refers to a nucleic acid molecule that can transport another nucleic acid molecule to which it is attached. One type of vector is a "plasmid," which refers to a circular double-stranded DNA loop to which additional DNA segments can be attached. Another type of vector is a viral vector, in which additional DNA segments can be attached to the viral genome. Certain vectors can replicate autonomously in the host cell into which they are introduced (e.g., bacterial vectors with an origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) can be integrated into the host cell's genome upon introduction into the host cell, thereby replicating along with the host genome. In addition, certain vectors are capable of directing the expression of genes to which they are operably linked. Such vectors are referred to herein as "recombinant expression vectors" (or simply "expression vectors"). Generally speaking, expression vectors used in recombinant DNA techniques are typically plasmids. The terms "plasmid" and "vector" are used interchangeably. However, the present invention is also intended to encompass such other forms of expression vectors, such as viral vectors (e.g., replication-defective retroviruses, adenoviruses, and adeno-associated viruses), which can function equivalently to plasmids.

[0363] The term "host cell," as used herein, refers to a cell into which a recombinant expression vector has been introduced. However, it should be understood that this term refers not only to a specific parent cell but also to the progeny of such a cell. Because certain modifications may occur during subsequent passages due to mutations or environmental influences, such progeny cells are not actually identical to the parent cell but are still included within the scope of the term "host cell" as used herein.

[0364] As used herein, the terms "treat," "treating," and "treatment" refer to therapeutic or preventative measures as described herein. The method of "treatment" involves administering an antibody or antigen-binding fragment thereof of the invention to a subject having a kallikrein or des-Arg10-kallikrein-associated disease or disorder (e.g., an inflammatory disease) or prone to such a disease or disorder to prevent, cure, delay the disease or disorder, or a recurring disease or disorder, reduce its severity, or ameliorate one or more symptoms, or prolong the subject's expected survival in the absence of such treatment.

[0365] As used herein, the term "kallikrein or des-Arg10-kallikrein-associated disease or disorder" includes disease states and / or symptoms associated with disease states in which altered levels or activity of kallikrein or des-Arg10-kallikrein are observed. Exemplary kallikrein or des-Arg10-kallikrein-associated diseases or disorders include, but are not limited to, pain and fibrosis.

[0366] The term "effective amount" as used herein refers to the amount of an antibody or antigen-binding fragment thereof that binds to kallikrein or des-Arg10-kallikrein when administered to a subject, sufficient to produce a therapeutic, preventive or diagnostic effect on a kallikrein or des-Arg10-kallikrein-related disease or disorder as described herein. The therapeutically effective amount varies depending on the subject and the disease being treated, the subject's weight and age, the severity of the disease condition, the mode of administration, etc., and can be easily determined by a person of ordinary skill in the art. The dosage range for administration of the antibody or antigen-binding fragment thereof of the present invention is, for example, from about 1 ng to about 10,000 mg, about 1 μg to about 5,000 mg, about 1 mg to about 1,000 mg, and about 10 mg to about 100 mg. The dosage regimen can be adjusted to provide the optimal therapeutic response. The effective amount also refers to the amount at which the toxic or deleterious effects (i.e., side effects) of the antibody or antigen-binding fragment thereof are minimized or the beneficial effects are more pronounced.

[0367] The term "subject," as used herein, includes any human or non-human animal.

[0368] As used herein, the term "epitope" refers to an antigenic determinant that interacts with the specific antigen-binding site of the variable region of an antibody molecule, known as a paratope. A single antigen can have more than one epitope. Thus, different antibodies can bind to different regions on an antigen and may have different biological effects. Epitopes can be conformational or linear. Conformational epitopes are created by spatially close amino acids in different segments of a linear polypeptide chain. Linear epitopes are created by adjacent amino acid residues in a polypeptide chain.

[0369] It must be noted herein that, as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0370] II. Anti-kallikrein or des-Arg10-kallikrein antibodies

[0371] In one aspect, the present invention provides antibodies or fragments thereof that specifically bind to kallikrein and des-Arg10-kallikrein. The VH, VL, and CDRs of exemplary antibodies of the present invention are listed in Table 1.

[0372] Table 1. VH, VL and CDR amino acid sequences of representative anti-kallikrein or des-Arg10-kallikrein antibodies

[0373]

[0374]

[0375]

[0376]

[0377]

[0378] In some embodiments, the antibodies or antigen-binding fragments thereof described herein contain one or more CDR region amino acid sequences selected from the group consisting of SEQ ID NO: 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 32, 33, 34, 35, 36, 37, 40, 41, 42, 43, 44, 47, 48, 49, 50, 51 52, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69 or 70.

[0379] In other embodiments, the antibodies or antigen-binding fragments thereof of the present invention comprise HCDR3, HCDR2 and HCDR1 amino acid sequences selected from the following groups:

[0380] a) SEQ ID NO: 7, 8, and 9;

[0381] b) SEQ ID NO: 13, 14, and 15;

[0382] c) SEQ ID NOs: 32, 33, and 34;

[0383] d) SEQ ID NO: 40, 41, and 42;

[0384] e) SEQ ID NO: 47, 48, and 49;

[0385] f) SEQ ID NOs: 55, 56, and 57; and

[0386] g) SEQ ID NO: 63, 64, and 65.

[0387] In other embodiments, the antibodies or antigen-binding fragments thereof of the present invention contain LCDR3, LCDR2 and LCDR1 amino acid sequences selected from the following groups:

[0388] a) SEQ ID NO: 10, 11, and 12;

[0389] b) SEQ ID NOs: 16, 17, and 18;

[0390] c) SEQ ID NOs: 35, 36, and 37;

[0391] d) SEQ ID NOs: 43, 17, and 44;

[0392] e) SEQ ID NO: 50, 51, and 52;

[0393] f) SEQ ID NO: 58, 59, and 60;

[0394] g) SEQ ID NOs: 66, 67, and 68; and

[0395] h) SEQ ID NO: 69, 25, and 70.

[0396] In other embodiments, the antibodies or antigen-binding fragments thereof of the present invention comprise HCDR3, HCDR2, HCDR1, LCDR3, LCDR2 and LCDR1 amino acid sequences selected from the following groups:

[0397] a) SEQ ID NO: 7, 8, 9, 10, 11, and 12;

[0398] b) SEQ ID NO: 13, 14, 15, 16, 17, and 18;

[0399] c) SEQ ID NOs: 32, 33, 34, 35, 36, and 37;

[0400] d) SEQ ID NO: 40, 41, 42, 43, 17, and 44;

[0401] e) SEQ ID NO: 47, 48, 49, 50, 51, and 52; and

[0402] f) SEQ ID NO: 55, 56, 57, 58, 59, and 60.

[0403] In other embodiments, the present invention provides humanized antibodies or antigen-binding fragments thereof, comprising one or more CDR regions (or conservatively modified mutations) derived from a murine antibody disclosed herein. Any humanization method can be used to produce the humanized antibodies of the present invention. Suitable humanization methods are disclosed and specifically illustrated in Example 4.

[0404] In a specific embodiment, the humanized antibody or antigen-binding fragment thereof described herein comprises:

[0405] A heavy chain variable region comprising HCDR3, HCDR2 and HCDR1 regions, wherein the amino acid sequences of HCDR3, HCDR2 and HCDR1 are shown in SEQ ID NOs: 13, 14 and 15, respectively, and wherein one or more amino acid substitutions are selected from the group consisting of H1, H5, H9, H11, H12, H16, H38, H40, H41, H43, H44, H66, H75, H79, H81, H82A, H83, H87 and H108: and / or

[0406] A light chain variable region comprising LCDR3, LCDR2 and LCDR1 regions, wherein the amino acid sequences of the LCDR3, LCDR2 and LCDR1 regions are shown in SEQ ID NOs: 16, 17 and 18, respectively, and wherein the amino acid substitution is at one or more positions selected from the group consisting of L5, L9, L15, L18, L19, L21, L22, L43, L63, L78, L79, L83, L85, L100 and L104 (according to the Kabat numbering convention).

[0407] In other embodiments, the antibody or antigen-binding fragment thereof comprises a VH region having an amino acid sequence as shown in SEQ ID NO: 19, 20, 21, 22, 24, 25, 38, 45, 53 and / or 61.

[0408] In other embodiments, the antibody or antigen-binding fragment thereof comprises a VL region having an amino acid sequence as shown in SEQ ID NO: 26, 27, 28, 29, 29, 30, 31, 39, 46, 54 and / or 62.

[0409] In other embodiments, the antibody or antigen-binding fragment thereof comprises a VH and VL region amino acid sequence selected from SEQ ID NOs: 19 and 26, SEQ ID NOs: 20 and 27; SEQ ID NOs: 21 and 28; SEQ ID NOs: 22 and 28; SEQ ID NOs: 23 and 29; SEQ ID NOs: 24 and 30; SEQ ID NOs: 25 and 31; SEQ ID NOs: 38 and 39; SEQ ID NOs: 45 and 46, SEQ ID NOs: 53 and 54, or SEQ ID NOs: 61 and 62, respectively.

[0410] In some embodiments, the antibody or antigen-binding fragment thereof comprises one or more CDR region amino acid sequences selected from SEQ ID NO: 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 32, 33, 34, 35, 36, 37, 40, 41, 42, 43, 44, 47, 48, 49, 50, 51, 52, 55, 56, 57, 58, 59 and 60, wherein the one or more CDR regions have at least one or more amino acid substitutions.

[0411] "Conservative amino acid substitutions" in the CDR amino acid sequences of the antibodies of the invention (e.g., SEQ ID NOs: 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 32, 33, 34, 35, 36, 37, 40, 41, 42, 43, 44, 47, 48, 49, 50, 51 52, 55, 56, 57, 58, 59, and 60) are also encompassed by the present invention, i.e., the amino acid sequence modification does not eliminate the binding of the antibody to the antigen, such as kallikrein or des-Arg10-kallikrein. Conservative amino acid substitutions include substitutions of one amino acid with an amino acid of the same class, where the class of amino acids is defined by the common physicochemical properties of the side chain amino acids and the high frequency of substitutions found in homologous proteins in nature, which can be determined, for example, by a standard Dayhoff frequency exchange matrix or a BLOSUM matrix. Six general classifications of amino acid side chains have been established, including: Class I (Cys); Class II (Ser, Thr, Pro, Ala, Gly); Class III (Asn, Asp, Gln, Glu); Class IV (His, Arg, Lys); Class V (Ile, Leu, Val, Met); and Class VI (Phe, Tyr, Trp). For example, substitution of Asp with another Class III residue, such as Asn, Gln, or Glu, is considered a conservative substitution. Thus, a predicted uncritical amino acid residue in an anti-kinin or des-Arg10-kinin antibody is preferably substituted with its cognate amino acid. Methods for identifying conservative amino acid substitutions that do not abolish antigen binding ability are well known in the art (see, e.g., Brummell et al., Biochem. 32: 1180-1187 (1993); Kobayashi et al. Protein Eng. 12(10): 879-884 (1999); and Burks et al. Proc. Natl. Acad. Sci. USA 94: 412-417 (1997)).

[0412] In another embodiment, the present invention provides an anti-kinin or des-Arg10-kinin antibody or antigen-binding fragment thereof comprising a VH and / or VL amino acid sequence, wherein the VH has about 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the VH region amino acid sequence of SEQ ID NO: 19, 20, 21, 22, 24, 25, 38, 45, 53, or 61, and the VL has about 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the VL region amino acid sequence of SEQ ID NO: 26, 27, 28, 29, 29, 30, 31, 39, 46, 54, or 62, respectively.

[0413] In another embodiment, the present invention provides anti-kallikrein or des-Arg10-kallikrein antibodies that can bind to the same epitope and / or compete with another antibody or antigen-binding fragment thereof comprising the amino acid sequences of the VH and VL regions of SEQ ID NOs: 19 and 25, SEQ ID NOs: 38 and 39, SEQ ID NOs: 45 and 46, SEQ ID NOs: 53 and 54, or SEQ ID NOs: 61 and 62, respectively. Such antibodies can be identified by conventional competition binding assays, including, for example, surface plasmon resonance (SPR)-based competition assays.

[0414] In some embodiments, the antibodies of the invention bind to a conformational epitope of kallikrein (KD) or des-Arg10-kallikrein (DAKD) that adopts the "Pro4 kink" conformation. Figure 17 As shown, a hallmark of the "Pro 4 knot" conformation is a type II tight turn at the Pro 4 position of the KD or DAKD main peptide backbone. As is well known to those skilled in the art, the type II tight turn conformation comprises three residues (X1-X2-X3), the carbonyl group of the X1 residue forming a hydrogen bond with the amide nitrogen of the X3 residue, where X3 is typically a glycine (see Richardson JS. "The anatomy and taxonomy of protein structure." Adv Protein Chem. 1981; 34: 167-339, which is incorporated herein by reference). Accordingly, in some embodiments, the type II tight turn is composed of the Pro3-Pro4-Gly5 motif of KD or DAKD. In more specific embodiments, the "Pro4 knot" conformation is further defined by all or most of the remaining residues of KD (1-2 and 6-9) or DAKD, which use an S-shaped repeat to arrange the hydrophobic side chains into a spatial packing pattern.

[0415] III. Modification of Anti-Kallidin or Des-Arg10-Kallidin Antibodies

[0416] In some embodiments, the anti-kallikrein or des-Arg10-kallikrein antibodies or antigen-binding fragments thereof of the present invention may comprise one or more modifications. Modifications of the anti-kallikrein or des-Arg10-kallikrein antibodies of the present invention can be achieved by any technique known in the art.

[0417] i) Reduce immunogenicity

[0418] In some embodiments, the anti-kallikrein or des-Arg10-kallikrein antibodies or antigen-binding fragments thereof described herein are modified to reduce their immunogenicity using techniques recognized in the art. For example, the antibodies or antigen-binding fragments can be chimerized, humanized, and / or deimmunized.

[0419] In one embodiment, the antibodies or antigen-binding fragments thereof described herein may be chimeric. A chimeric antibody is an antibody in which different portions are derived from different animal species, for example, an antibody containing a variable region derived from a murine monoclonal antibody and a human immunoglobulin constant region. Methods for preparing chimeric antibodies or fragments thereof are well known in the art. See, for example, Morrison, Science 229:1202 (1985); Oi et al., BioTechniques 4:214 (1986); Gillies et al., J. Immunol. Methods 125:191-202 (1989); US Pat. Nos. 5,807,715; 4,816,567; and 4,816,397, which are incorporated herein by reference in their entireties. Techniques developed for the preparation of chimeric antibodies (Morrison et al., Proc. Natl. Acad. Sci. 81:851-855 (1984); Neuberger et al., Nature 312:604-608 (1984); Takeda et al., Nature 314:452-454 (1985)) can be used to synthesize such molecules. For example, a gene sequence encoding a mouse anti-kinin or des-Arg10-kinin antibody molecule can be fused to a sequence from a human antibody molecule having appropriate biological activity. As used herein, chimeric antibodies refer to molecules in which different portions are derived from different animal species, such as those containing variable regions derived from a mouse monoclonal antibody and human immunoglobulin constant regions, such as humanized antibodies.

[0420] In another embodiment, the antibody or antigen-binding fragment thereof of the present invention is humanized. Humanized antibodies have binding specificity and comprise one or more complementary determining regions (CDRs) from non-human antibodies and framework regions from human antibody molecules. Typically, the framework residues in the human framework region will be replaced by the corresponding residues of the CDR donor antibody to change, preferably to improve binding to the antigen. These framework replacements can be identified by methods well known in the art, such as by simulating the interaction of CDRs with framework residues to identify framework region residues that play an important role in antigen binding, and sequence comparison to identify unusual framework residues at specific positions (see, for example, Queen et al., U.S. Patent No. 5,585,089; Riechmann et al., Nature 332:323 (1988), which are incorporated herein by reference in their entirety). Antibodies can be humanized using a variety of techniques known in the art, including, for example, CDR grafting (EP 239,400; PCT publication WO 91 / 09967; US Pat. Nos. 5,225,539; 5,530,101; and 5,585,089), modification or resurfacing (EP 592,106; EP 519,596; Padlan, Molecular Immunology 28(4 / 5):489-498 (1991); Studnicka et al., Protein Engineering 7(6):805-814 (1994); Roguska et al., PNAS 91:969-973 (1994)), and chain shuffling (U.S. Pat. No. 5,565,332).

[0421] In a specific embodiment, humanization is performed using a method based on the effect of molecular flexibility of antibodies in immune recognition (see WO2009 / 032661, which is incorporated herein by reference in its entirety). Protein flexibility is related to the molecular motion of protein molecules. Protein flexibility is the ability of the entire protein or a part thereof or one of its amino acid residues to form an overall conformation that differs significantly between individual protein molecules. Information about the flexibility of a protein can be obtained by performing protein X-ray crystallography experiments (see, for example, Kundu et al., 2002, Biophys J 83:723-732.), nuclear magnetic resonance experiments (see, for example, Freedberg et al., J Am Chem Soc 1998, 120(31):7916-7923) or running molecular dynamics (MD) simulations. MD simulations of protein molecules are performed on a computer to determine the motion of all atoms in the protein molecule over a period of time by calculating the physical interactions between atoms. The output of the MD simulation is the trajectory of the protein under study over the simulation time period. A trajectory is a collection of all protein conformations, also called a snapshot set, which is collected by periodic sampling during the simulation time period, for example, every 1 picosecond (ps). By analyzing this collection of snapshots, the flexibility of the protein's amino acid residues can be quantified. In other words, a flexible residue is one that adopts a set of different conformations in the context of its polypeptide chain. MD methods are well known in the art, see, for example, Brooks et al., "Proteins: A Theoretical Perspective of Dynamics, Structure and Thermodynamics" (Wiley, New York, 1988). Some software can perform MD simulations, such as Amber (see Case et al. (2005) J Comp Chem 26:1668-1688), Charmm (see Brooks et al. (1983) J Comp Chem 4:187-217; and MacKerell et al. (1998) in "The Encyclopedia of Computational Chemistry" vol. 1:271-177, Schleyer et al., eds. Chichester: John Wiley & Sons) or Impact (see Rizzo et al. J Am Chem Soc; 2000; 122(51):12898-12900).

[0422] Most protein complexes have a relatively large and deeply buried surface, and it has been shown that the flexibility of the binding partners provides the origin of protein plasticity, allowing them to adapt to each other in conformation (Structure (2000) 8, R137-R142). Similarly, "induced fit" plays a significant role in protein interactions. In addition, steadily increasing data show that proteins can actually bind ligands of various shapes, sizes and compositions (Protein Science (2002) 11: 184-187), and conformational diversity appears to be an important component of the ability to recognize different ligands (Science (2003) 299, 1362-1367). Flexible residues are involved in protein-protein interactions (Structure (2006) 14, 683-693).

[0423] Flexible residues can adopt multiple conformations to provide a range of interaction regions that may be recognized by memory B cells and trigger an immune response. Thus, antibodies can be humanized by modifying some framework residues so that the overall conformation and recognition region of the modified antibody are as similar as possible to human antibodies. This can be achieved by modifying a limited number of residues using the following methods: (1) constructing a homology model of the parent mAb and performing MD simulations; (2) analyzing the flexible residues and identifying the most flexible residues in the non-human antibody molecule and residues and motifs that may cause heterogeneity and degradation; (3) identifying human antibodies that exhibit the most similar recognition regions to the parent antibody; (4) identifying flexible residues to be mutated and residues and motifs that may cause heterogeneity and degradation to be mutated; and (5) examining the presence of known T-cell or B-cell epitopes. Flexible residues can be discovered using MD calculations as described herein, which use implicit solution models that represent the interactions between aqueous solution and protein atoms during the simulation time period.

[0424] Once the flexible residue groups in the variable light and heavy chains are identified, a set of human heavy and light chain variable region frameworks that are very similar to the aforementioned antibody of interest can be identified. This can be achieved by searching the aforementioned residue groups against a database of human germline antibody sequences, such as using BLAST. Alternatively, this can be achieved by dynamic comparison of the parent mAb with a library of representative human germline structures. CDRs and adjacent residues are eliminated from the search to ensure that high affinity for the antigen is retained. The flexible residues are then replaced.

[0425] While some human residues exhibit similar homology, the selection depends on the nature of the residues that may affect the solution behavior of the humanized antibody. For example, polar residues are preferred over hydrophobic residues in exposed loops. Residues that potentially induce instability and heterogeneity should also be mutated, even if they are found in CDRs. This includes: exposed methionine, which can form sulfoxides in the presence of oxygen free radicals; proteolytic sites for acid-labile bonds, such as those of the Asp-Pro dipeptide (Drμg Dev Res (2004) 61:137-154); deamidation sites found where exposed arginine residues are followed by a small amino acid, such as Gly, Ser, Ala, His, Asn, or Cys (J Chromatog (2006) 837:35-43); and N-glycosylation sites, such as Asn-X-Ser / Thr. Typically, an exposed methionine will be replaced by a leucine, an exposed asparagine will be replaced by a glutamine or aspartic acid, or subsequent residues will be changed. For glycosylation sites (Asn-X-Ser / Thr), either the asparagine or serine / threonine residues will be changed.

[0426] The resulting composite antibody is examined for the presence of known B-cell or linear T-cell epitopes. This can be done, for example, by searching the publicly available Immune Epitope Database (IEDB) (PLos Biol (2005) 3(3)e91). If a known epitope is found in the composite sequence, another set of human sequences is obtained and replaced. Thus, unlike the surface modification method described in U.S. Patent No. 5,639,641, this method can address both B-cell-mediated and T-cell-mediated immune responses. This method also avoids the loss of activity sometimes observed after CDR grafting (U.S. Patent No. 5,530,101). In addition, stability and solubility are also considered during the engineering and selection process, resulting in antibodies optimized for low immunogenicity, high affinity, and improved biological properties.

[0427] In some embodiments, deimmunization can be used to reduce the immunogenicity of an antibody or antigen-binding fragment thereof. As used herein, the term "deimmunization" includes changes in an antibody or antigen-binding fragment thereof to modify T cell epitopes (see, for example, WO9852976A1, WO0034317A2). For example, the VH and VL sequences from the original antibody are analyzed, and a T cell epitope "map" is generated from each V region, showing the epitope positions associated with the complementarity determining regions (CDRs) and other key residues. Individual T cell epitopes in the T cell epitope map will be analyzed to identify alternative amino acid substitutions that have a lower risk of altering the activity of the final antibody. A series of alternative VH and VL sequences containing combinations of amino acid substitutions are designed, and these sequences then become part of a series of kallikrein or des-Arg10-kallikrein-specific antibodies or fragments thereof for use in the diagnostic and therapeutic measures disclosed herein, and are subsequently functionally tested. Typically, 12 to 24 variant antibodies are generated and tested. The complete heavy and light chain genes containing the modified V regions and human C regions are cloned into expression vectors, and the resulting plasmids are introduced into cell lines for full antibody production. Appropriate biochemical and biological analyses are used to compare antibodies and identify the optimal variant.

[0428] ii) Effector function and Fc modification

[0429] The anti-kallikrein or des-Arg10-kallikrein antibodies of the present invention may comprise an antibody constant region (e.g., an IgG constant region, e.g., a human IgG constant region, e.g., a human IgG1 or IgG4 constant region) that mediates one or more effector functions. For example, the C1 component of complement binding to the antibody constant region may activate the complement system. Complement activation plays an important role in opsonizing and lysing cellular pathogens. Complement activation may also stimulate inflammatory responses and participate in auto-hypersensitivity reactions. In addition, antibodies bind to a variety of cells through the Fc region, i.e., an FcR binding site of the antibody binds to an FcR on the cell. There are many Fc receptors that are specific for different classes of antibodies, including IgG (γ receptor), IgE (ε receptor), IgA (α receptor) and IgM (μ receptor). Antibody binding to Fc receptors on the cell surface triggers a series of important and diverse biological responses, including phagocytosis and destruction of antibody-coated particles, clearance of immune complexes, lysis of antibody-coated target cells by killer cells (called antibody-dependent cell-mediated cytotoxicity, or ADCC), release of inflammatory mediators, crossing the placenta, and controlling immunoglobulin production. In a preferred embodiment, the antibody, or antigen-binding fragment thereof, binds to an Fcγ receptor. In alternative embodiments, the anti-kallikrein or des-Arg10-kallikrein antibodies of the present invention may contain a constant region that lacks effector function (e.g., ADCC activity) and / or is incapable of binding to Fcγ receptors.

[0430] Some embodiments of the present invention include anti-kallikrein or des-Arg10-kallikrein antibodies having at least one amino acid deletion or other alteration in one or more constant regions to provide desired biochemical properties, such as reduced or enhanced effector function, the ability to form non-covalent dimers, enhanced localization to tumor sites, and reduced or increased serum half-life, compared to an unaltered full antibody with substantially the same immunogenicity. For example, some antibodies or antigen-binding fragments thereof used in the diagnostic or therapeutic methods described herein are domain-deleted antibodies comprising a polypeptide chain similar to an immunoglobulin heavy chain, but lacking at least a portion of one or more heavy chain domains. For example, in some embodiments, an entire domain of the heavy chain constant region of the modified antibody is eliminated, for example, all or a portion of the CH2 domain is eliminated.

[0431] In some embodiments, the anti-kinin or des-Arg10-kinin antibody comprises constant regions derived from different antibody isotypes (e.g., constant regions derived from two or more human IgG1, IgG2, IgG3, or IgG4). In other embodiments, the anti-kinin or des-Arg10-kinin antibody comprises a chimeric hinge (i.e., hinge regions in which each portion is derived from a hinge domain of a different antibody isotype, e.g., an upper hinge domain derived from an IgG4 molecule and a middle hinge domain derived from an IgG1 molecule). In one embodiment, the anti-kinin or des-Arg10-kinin antibody contains an Fc region or portion derived from an IgG4 molecule and has a Ser 228Pro (EU numbering) mutation in the core hinge region.

[0432] In some anti-kallikrein or des-Arg10-kallikrein antibodies, the Fc portion is mutated using techniques known in the art to enhance or reduce effector function. For example, the deletion or inactivation of a constant region domain (by point mutation or other methods) may reduce the binding of Fc receptors to modified antibodies in the circulation, thereby enhancing tumor localization. In other examples, constant region modifications are consistent with the present invention to reduce complement binding, thereby reducing serum half-life and non-specific association with coupled cytotoxins. Due to the enhanced localization brought about by enhanced antigen specificity or flexibility, other modifications of the constant region may be used to modify disulfide bonds or oligosaccharide portions. The physiological properties, bioaccessibility and other biochemical effects caused by the modification, such as tumor localization, distribution and serum half-life, can be measured and quantified using known immunological techniques without the need for excessive experiments.

[0433] In some embodiments, the Fc domain used in the antibodies described herein is an Fc variant. As used herein, the term "Fc variant" refers to an Fc domain that has at least one amino acid substitution compared to the wild-type Fc domain from which it is derived. For example, where the Fc domain is derived from a human IgG1 antibody, the Fc variant of the human IgG1 Fc domain contains at least one amino acid substitution relative to the human Fc domain.

[0434] The amino acid substitutions of the Fc variants may be at any position in the Fc domain (i.e., any EU convention amino acid position). In one embodiment, the Fc variant comprises an amino acid substitution located in the hinge domain or a portion thereof. In another embodiment, the Fc variant comprises an amino acid substitution located in the CH2 domain or a portion thereof. In another embodiment, the Fc variant comprises an amino acid substitution located in the CH3 domain or a portion thereof. In another embodiment, the Fc variant comprises an amino acid substitution located in the CH4 domain or a portion thereof.

[0435] The antibodies of the present invention may use any Fc variant known in the art to confer improved (e.g., reduced or enhanced) effector function and / or Fc receptor binding. The Fc variants may include, for example, International PCT Publications WO88 / 07089A1, WO96 / 14339A1, WO98 / 05787A1, WO98 / 23289A1, WO99 / 51642A1, WO99 / 58572A1, WO00 / 09560A2, WO00 / 32767A1, WO00 / 42072A2, WO 02 / 44215A2, WO02 / 060919A2, WO03 / 074569A2, WO04 / 016750A2, WO04 / 029207A2, WO0 4 / 035752A2, WO04 / 063351A2, WO04 / 074455A2, WO04 / 099249A2, WO05 / 040217A2, WO0 5 / 070963A1, WO05 / 077981A2, WO05 / 092925A2, WO05 / 123780A2, WO06 / 019447A1, WO06 / 047350A2 and WO06 / 085967A2 or U.S. Patent Nos. 5,648,260; 5,739,277; 5,834,250; 5,869,046; 6,096,871; 6,121,022; 6,194,551; 6,242,195; 6,277,375; 6,528,624; 6,538,124; 6,737,056; 6,821,505; 6,998,253; and 7,083,784, each of which is incorporated herein by reference. In one exemplary embodiment, the antibody of the invention may comprise an amino acid substitution at EU position 268 (e.g., H268D or H268E). In another exemplary embodiment, the antibody of the invention may comprise an amino acid substitution at EU position 239 (e.g., S239D or S239E) and / or EU position 332 (e.g., I332D or I332Q).

[0436] In some embodiments, the antibodies of the present invention may comprise an Fc variant containing an amino acid substitution that alters the antibody's antigen-independent effector function, particularly its circulating half-life. These antibodies exhibit enhanced or decreased FcRn binding, and thus, respectively, increased or decreased serum half-life, compared to antibodies lacking such substitutions. Fc variants with enhanced affinity for FcRn are expected to have an increased serum half-life and are useful in mammalian therapeutic applications where an antibody with a prolonged serum half-life is desired, e.g., for the treatment of chronic diseases or disorders. Conversely, Fc variants with decreased affinity for FcRn are expected to have a decreased serum half-life and are also useful, e.g., for administration to mammals where a shorter circulation time is advantageous, e.g., for in vivo diagnostic imaging, or where prolonged circulation of the original antibody may have toxic side effects. Fc variants with decreased affinity for FcRn are less likely to cross the placenta and, therefore, are useful in the treatment of diseases or disorders in pregnant women. Additionally, other applications requiring reduced FcRn affinity include those requiring localization in the brain, kidney, and / or liver. In one exemplary embodiment, the altered antibodies of the present invention exhibit reduced transport from blood vessels across the glomerular epithelium. In another embodiment, the altered antibodies of the present invention exhibit reduced transport from the brain across the blood-brain barrier into blood vessels. In one embodiment, an antibody with altered FcRn binding comprises an Fc domain having one or more amino acid substitutions in its "Fc binding loop." The Fc binding loop consists of amino acid residues 280-299 (according to EU numbering). Exemplary amino acid substitutions that alter FcRn binding activity are disclosed in International PCT Publication No. WO 05 / 047327, which is incorporated herein by reference. In some exemplary embodiments, the antibodies or antigen-binding fragments thereof of the present invention comprise an Fc domain having one or more of the following substitutions: V284E, H285E, N286D, K290E, and S304D (EU numbering).

[0437] In other embodiments, the antibodies used in the diagnostic or therapeutic measures described herein comprise a constant region, e.g., an IgG1 or IgG4 heavy chain constant region, that is altered to reduce or eliminate glycosylation. For example, the antibodies described herein may also comprise Fc variants comprising amino acid substitutions that alter the glycosylation of the antibody. For example, the Fc variants may have reduced glycosylation (e.g., N- or O-linked glycosylation). In exemplary embodiments, the Fc variant comprises reduced glycosylation of the N-linked glycan normally found at amino acid position 297 (EU numbering). In another embodiment, the antibody comprises an amino acid substitution adjacent to or within a glycosylation motif, e.g., an N-linked glycosylation motif comprising the amino acid sequence NXT or NXS. In a specific embodiment, the antibody comprises an Fc variant with an amino acid substitution at amino acid position 228 or 299 (EU numbering). In more specific embodiments, the antibody comprises an IgG1 or IgG4 constant region comprising the S228P and T299A mutations (EU numbering).

[0438] Typical amino acid substitutions that can confer altered or reduced glycosylation are disclosed in International PCT Publication No. WO 05 / 018572, which is incorporated herein by reference. In preferred embodiments, the antibodies or antigen-binding fragments thereof described herein are modified to eliminate glycosylation. Such antibodies or antigen-binding fragments thereof may be referred to as "aglycosylated" antibodies or antigen-binding fragments thereof. Although not bound by theory, it is believed that "aglycosylated" antibodies or antigen-binding fragments thereof may have better safety and stability in vivo. Typical aglycosylated antibodies or antigen-binding fragments thereof comprise an aglycosylated Fc region of an IgG4 antibody, which lacks Fc effector function, thereby eliminating potential Fc-mediated toxicity to normal vital organs expressing kallikrein or des-Arg10-kallikrein. In other embodiments, the antibodies or antigen-binding fragments thereof of the present invention comprise an altered polysaccharide. For example, the antibody may have a reduced number of N-glycan fucose residues on Asn297 of the Fc region, i.e., defucosylation. In another embodiment, the antibody may have a modified number of N-glycan sialic acid residues on the Fc region.

[0439] iii) Covalent bonding

[0440] The anti-kallikrein or des-Arg10-kallikrein antibodies of the present invention may be modified, for example, by covalently linking to the antibody a molecule that does not prevent the antibody from specifically binding to its cognate antigenic epitope. For example, but not limitation, the antibodies or fragments thereof of the present invention may be modified by glycosylation, acetylation, pegylation, phosphorylation, amidation, derivatization with known protecting / blocking groups, proteolytic cleavage, attachment to cellular ligands or other proteins, and the like. Any of a number of chemical modifications may be performed by known techniques, including, but not limited to, specific chemical cleavage, acetylation, formylation, and the like. In addition, the derivatives may contain one or more non-classical amino acids.

[0441] The antibodies or antigen-binding fragments thereof described herein can be further recombinantly fused to the N- or C-terminus of heterologous polypeptides or chemically coupled (including covalent and non-covalent conjugation) to polypeptides or other compositions. For example, anti-kallikrein or des-Arg10-kallikrein antibodies can be recombinantly fused or coupled to label molecules useful in detection assays and effector molecules such as heterologous polypeptides, drugs, radionuclides, or toxins. See, for example, PCT Publications WO 92 / 08495; WO 91 / 14438; WO 89 / 12624; U.S. Patent No. 5,314,995; and EP 396,387.

[0442] Anti-kallikrein or des-Arg10-kallikrein antibodies can be fused to heterologous polypeptides using methods known in the art to increase their in vivo half-life or for use in immunoassays. For example, in one embodiment, PEG is conjugated to the anti-kallikrein or des-Arg10-kallikrein antibodies of the present invention to increase their in vivo half-life. Leong, SR et al., Cytokine 16:106 (2001); Adv. in Drμg Deliv. Rev. 54:531 (2002); or Weir et al., Biochem. Soc. Transactions 30:512 (2002).

[0443] In addition, the anti-kallikrein or des-Arg10-kallikrein antibodies of the present invention can be fused to a tag sequence, such as a polypeptide, to facilitate their purification or detection. In a preferred embodiment, the tag amino acid sequence is a hexa-histidine polypeptide, such as the tag provided by the pQE vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, Calif., 91311), many of which are commercially available. For example, hexa-histidine polypeptides facilitate purification of fusion proteins, as described in Gentz et al., Proc. Natl. Acad. Sci. USA 86:821-824 (1989). Other tags useful for purification include, but are not limited to, the "HA" tag, which corresponds to an epitope of the influenza virus hemagglutinin protein (Wilson et al., Cell 37:767 (1984)), and the "flag" tag.

[0444] The anti-kinin or des-Arg10-kinin antibodies of the present invention can be used in an unconjugated form or can be conjugated to at least one of a number of molecules, for example, to enhance the therapeutic properties of the molecule, facilitate target detection, or for imaging or treatment of patients. The anti-kinin or des-Arg10-kinin antibodies of the present invention can be labeled or conjugated before or after purification, when purification is required. In particular, the anti-kinin or des-Arg10-kinin antibodies of the present invention can be conjugated to a therapeutic agent, a prodrug, a peptide, a protein, an enzyme, a virus, a lipid, a biological response modifier, a pharmaceutical agent, or PEG.

[0445] The present invention further comprises the anti-kallikrein or des-Arg10-kallikrein antibody, which is coupled to a diagnostic or therapeutic agent. The anti-kallikrein or des-Arg10-kallikrein antibody can be used for diagnosis, for example, as part of a clinical testing program, to monitor the development or progression of immune cell disorders (e.g., CLL), and then, for example, to determine the efficacy of a given treatment and / or prevention regimen. Detection can be facilitated by coupling the kallikrein or des-Arg10-kallikrein antibody to a detectable substance. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, radioactive materials, positron-emitting metals using various positron emission scans, and non-radioactive paramagnetic metal ions. According to the present invention, metal ions that can be used as diagnostic agents coupled to antibodies are described, for example, in U.S. Patent No. 4,741,900. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, β-galactosidase or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin / biotin and avidin / biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorofluorescein, dansyl chloride or phycoerythrin; an example of a luminescent material includes luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin; and examples of suitable radioactive substances include 125I, 131I, 111In or 99Tc.

[0446] Anti-kallikrein or des-Arg10-kallikrein antibodies for use in the diagnostic and therapeutic approaches disclosed herein can be conjugated to cytotoxins (such as radioisotopes, cytotoxic drugs or toxins), therapeutic agents, cytostatic agents, biotoxins, prodrugs, peptides, proteins, enzymes, viruses, lipids, biological response modifiers, pharmaceutical agents, immunologically active ligands (e.g., lymphokines or other antibodies, wherein the resulting molecules bind to tumor cells and effector cells, such as T cells), or PEG.

[0447] In another embodiment, the anti-kallikrein or des-Arg10-kallikrein antibodies used in the diagnostic and therapeutic measures disclosed herein can be conjugated to molecules that reduce tumor cell growth. In other embodiments, the disclosed compositions may comprise antibodies, conjugated drugs, or prodrugs. Other embodiments of the present invention include the use of antibodies or fragments thereof conjugated to specific biotoxins or cytotoxic fragments thereof, such as ricin, gelonin, Pseudomonas exotoxin, or diphtheria toxin. The choice of using conjugated or unconjugated antibodies will depend on the type and stage of the cancer, the adjuvant therapy used (e.g., chemotherapy or external radiation therapy), and the patient's condition. It should be understood that those skilled in the art can easily make such choices based on the guidance herein.

[0448] It should be understood that in previous studies, isotope-labeled anti-tumor antibodies have been successfully used to destroy tumor cells in animal models and, in some cases, human tumor cells. Typical radioisotopes include: 90Y, 125I, 131I, 123I, 111In, 105Rh, 153Sm, 67Cu, 67Ga, 166Ho, 177Lu, 186Re, and 188Re. Radionuclides act by producing ionizing radiation that causes multiple strand breaks in nuclear DNA, leading to cell death. Isotopes used to produce therapeutic conjugates typically produce high-energy α- or β-particles with short path lengths. Such radionuclides kill cells to which they are in close proximity, such as tumor cells to which the conjugate has attached or entered. They have little or no effect on non-localized cells. Radionuclides are essentially non-immunogenic.

[0449] IV. Expression of Anti-Kallidin or Des-Arg10-Kallidin Antibodies, or Antigen-Binding Fragments Thereof

[0450] Subsequent manipulations for the isolation of genetic material for the production of anti-kallikrein or des-Arg10-kallikrein antibodies described herein are as described above, and the genes are inserted into expression vectors for introduction into host cells that can be used to produce the desired amount of the desired antibody or fragment thereof.

[0451] As used herein and for the purposes of the claims, the term "vector" or "expression vector" refers to a vector used in accordance with the present invention as a means for introducing and expressing a gene of interest into a cell. As is well known to those skilled in the art, such vectors can be readily selected from the group consisting of plasmids, bacteriophages, viruses, and retroviruses. Generally, vectors compatible with the present invention contain a selectable marker, appropriate restriction sites to facilitate cloning of the gene of interest, and the ability to enter and / or replicate in eukaryotic or prokaryotic cells.

[0452] Many expression vector systems can be used for the purposes of the present invention. For example, one type of vector utilizes DNA elements derived from animal viruses, such as bovine papilloma virus, polyoma virus, adenovirus, vaccinia virus, baculovirus, retrovirus (RSV, MMTV or MOMLV) or SV40 virus. Other vectors involve the use of polycistronic systems with internal ribosome binding sites. In addition, cells with DNA integrated into the genome can be selected by introducing one or more markers that can select transfected host cells. The marker can provide prototrophy, biocide resistance (e.g., antibiotics) or heavy metal resistance such as copper for auxotrophic hosts. The selectable marker gene can be directly connected to the DNA sequence to be expressed, or introduced into the same cell by co-transformation. Additional elements may also be required to achieve optimal synthesis of mRNA. These elements may include signal sequences, splicing signals, and transcription promoters, enhancers and termination signals. In a particularly preferred embodiment, the cloned variable region genes are inserted into the expression vector together with the above-mentioned heavy chain and light chain constant region gene (preferably human) synthesis products.

[0453] In other preferred embodiments, anti-kallikrein or des-Arg10-kallikrein antibodies or fragments thereof can be expressed using a polycistronic construct. In such an expression system, multiple target gene products, such as the heavy and light chains of an antibody, can be produced by a single polycistronic construct. These systems advantageously use an internal ribosome entry site (IRES) to produce relatively high levels of the polypeptides of the present invention in eukaryotic host cells. Compatible IRES sequences are disclosed in U.S. Patent No. 6,193,980, which is incorporated herein by reference. Those skilled in the art will appreciate that such expression systems can be used to effectively produce all polypeptides disclosed in this application.

[0454] More generally, once a vector or DNA sequence encoding an antibody or fragment thereof has been prepared, the expression vector can be introduced into an appropriate host cell. In other words, the host cell can be transformed. Plasmid introduction into host cells can be accomplished by various techniques well known to those skilled in the art. These techniques include, but are not limited to, transfection (including electrophoresis and electroporation), protoplast fusion, calcium phosphate precipitation, cell-encapsulated DNA fusion, microinjection, and complete viral infection. See Ridgway, AAG "Mammalian Expression Vectors" Chapter 24.2, pp. 470-472 Vectors, edited by Rodriguez and Denhardt (Butterworths, Boston, Mass. 1988). Most preferably, the plasmid is introduced into the host by electroporation. The transformed cells are grown under conditions suitable for the production of light and heavy chains, and the synthesis of heavy and / or light chain proteins is measured. Exemplary assay techniques include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), or fluorescence-activated cell sorting analysis (FACS), immunohistochemistry, etc.

[0455] As used herein, the term "transformation" is used in a broad sense to refer to the introduction of DNA into a recipient host cell that changes the genotype of the cell and correspondingly results in some change in the recipient cell.

[0456] As previously mentioned, "host cells" refer to cells transformed with a vector constructed using recombinant DNA technology that encodes at least one heterologous gene. When describing the isolation of polypeptides from recombinant hosts, the terms "cells" and "cell culture" are used interchangeably to refer to the source of the antibody, unless otherwise specified. In other words, recovery of a polypeptide from "cells" can refer to recovery from intact cell pellets or from cell cultures containing culture medium and suspended cells.

[0457] In one embodiment, the host cell line used for antibody expression is of mammalian origin; those skilled in the art will be able to determine the specific host cell line most suitable for expression of the gene product of interest therein. Exemplary host cell lines include, but are not limited to, DG44 and DUXB11 (Chinese hamster ovary cell lines, DHFR-), HELA (human cervical carcinoma), CVI (monkey kidney cell line), COS (CVI derivative with SV40T antigen), R1610 (Chinese hamster fibroblasts) BALBC / 3T3 (mouse fibroblasts), HAK (hamster kidney cell line), SP2 / O (mouse myeloma), BFA-1c1BPT (bovine endothelial cells), RAJI (human lymphocytes), 293 (human kidney). In one embodiment, the cell line (e.g., PER.C6.RTM. (Crucell) or FUT8 knockout CHO cell line (Potelligent.RTM.Cells) (Biowa, Princeton, NJ)) provides for altered glycosylation of the antibody expressed therein, such as defucosylation. In one embodiment, NS0 cells can be used. CHO cells are particularly preferred. Host cell lines are generally available from commercial services, the American Tissue Culture Collection, or from publicly available sources.

[0458] In vitro production allows for scale-up to obtain large quantities of the desired polypeptide. Mammalian cell culture techniques under tissue culture conditions are well known in the art and include homogeneous suspension culture, for example in airlift reactors or continuous stirred reactors, or immobilized or embedded cell culture, for example in hollow fibers, microcapsules, on agarose microbeads or ceramic cartridges. If necessary and / or desired, the polypeptide solution can be purified by conventional chromatographic methods, for example, gel filtration, ion exchange chromatography, DEAE-cellulose chromatography and / or (immuno) affinity chromatography.

[0459] The genes encoding the anti-kallikrein or des-Arg10-kallikrein antibodies or fragments thereof of the present invention may also be expressed in non-mammalian cells, such as bacteria or yeast or plant cells. In this regard, it will be appreciated that various unicellular non-mammalian microorganisms, such as bacteria, may also be transformed; that is, those that are capable of growth or fermentation in culture. Bacteria, which are readily transformed, include members of the Enterobacteriaceae family, such as Escherichia coli or Salmonella strains; Bacillus, such as Bacillus subtilis; Pneumococci; Streptococci and Haemophilus influenzae. It is further appreciated that, when expressed in bacteria, the polypeptide may become part of inclusion bodies. The polypeptide must be isolated, purified, and then assembled into a functional molecule.

[0460] In addition to prokaryotes, eukaryotic microorganisms can also be used. Saccharomyces cerevisiae, or common baker's yeast, is the most commonly used eukaryotic microorganism, although many other strains are also commonly available. For expression in yeast, the plasmid YRp7 is commonly used, for example (Stinchcomb et al., Nature, 282:39 (1979); Kingsman et al., Gene, 7:141 (1979); Tschemper et al., Gene, 10:157 (1980)). This plasmid itself contains the TRP1 gene, which provides a selection marker for yeast mutants lacking the ability to grow in tryptophan, such as ATCC No. 44076 or PEP4-1 (Jones, Genetics, 85:12 (1977)). The presence of the Trp1 barrier, a characteristic of the yeast host cell genome, provides an effective environment for detecting transformation by growth in an environment lacking tryptophan.

[0461] V. Anti-kallikrein or des-Arg10-kallikrein Antibody Pharmaceutical Preparations and Administration

[0462] In another aspect, the present invention provides a pharmaceutical composition comprising: an anti-kallikrein or des-Arg10-kallikrein antibody, or an antigen-binding fragment thereof.

[0463] Methods for preparing and administering the antibodies or fragments thereof of the present invention to a subject are well known to those skilled in the art or can be readily determined by those skilled in the art. The routes of administration of the antibodies or fragments thereof of the present invention may be oral, parenteral, by inhalation or topical administration. The term parenteral as used herein includes intravenous, intraarterial, intraperitoneal, intramuscular, subcutaneous, rectal or vaginal administration. Intravenous, intraarterial, subcutaneous and intramuscular routes of parenteral administration are generally preferred. Although all of these routes of administration are clearly encompassed within the scope of the present invention, one form of administration would be a solution for injection, particularly intravenous or arterial injection or drip. Typically, suitable pharmaceutical compositions for injection may include a buffer (e.g., acetate, phosphate or citrate buffer), a surfactant (e.g., polysorbate), an optional stabilizer (e.g., human albumin), and the like. However, in other methods compatible with the teachings herein, the polypeptide may be released directly into a harmful cell population to increase exposure of the diseased tissue to the therapeutic agent.

[0464] Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcohol / aqueous solutions, emulsions or suspensions, including saline and buffered media. In the present invention, pharmaceutically acceptable carriers include, but are not limited to, 0.01-0.1 M, preferably 0.05 M, phosphate buffer or 0.8% saline. Other common parenteral carriers include sodium phosphate solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils. Intravenous carriers include fluid and nutrient supplements, electrolyte supplements, such as those based on Ringer's dextrose, and the like. Preservatives and other additives may also be present, such as antimicrobial agents, antioxidants, chelating agents, and inert gases. More specifically, pharmaceutical compositions suitable for injection include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In such cases, the composition must be sterile and should be a fluid within the range of easy injection. It should be stable under manufacturing and storage conditions and be conducive to preventing microbial contamination, such as bacteria and fungi during preservation. The carrier can be a solvent or dispersion medium, such as water, ethanol, polyols (such as glycerol, propylene glycol, and liquid polyethylene glycol, etc.), and appropriate mixtures thereof. Suitable fluidity can be achieved by, for example, using a coating such as lecithin, maintaining the required particle size in the dispersant, and using a surfactant to maintain. Preventing the effect of microorganisms can be achieved by various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, etc. In many cases, it is preferred that an isotonic agent is included in the composition, such as sugar, polyols, such as mannitol, sorbitol, or sodium chloride. The prolonged absorption of the injectable composition can be achieved by adding a reagent that prolongs absorption in the composition, such as aluminum monostearate and gelatin.

[0465] In any case, sterile injectable solutions can be prepared by mixing the desired amount of the active compound (e.g., the antibody itself or in combination with other active agents) in an appropriate solvent with one or more of the component compositions listed herein, followed by sterilization by filtration, as desired. Typically, dispersions are prepared by adding the active compound to a sterile carrier containing a basic dispersion medium and the other desired ingredients listed above. When sterile injectable solutions are prepared from sterile powders, preferred methods of preparation are vacuum drying and freeze drying to produce a powder of the active ingredient, plus any other desired ingredients from a previously sterile filtrate. After processing, the injectable formulation is dispensed into containers such as ampoules, bags, bottles, syringes, or vials and sealed under aseptic conditions according to methods known in the art. Alternatively, the formulation can be packaged and sold in the form of a kit, such as the kits described in co-patented U.S. Serial Nos. 09 / 259,337 and 09 / 259,338, each of which is incorporated herein by reference. These articles preferably have a label or package insert indicating that the composition is effective for treating a patient suffering from or susceptible to an autoimmune or neoplastic disorder.

[0466] The effective dosage of the stabilized antibodies or fragments thereof described herein for treating the aforementioned disorders will vary depending on many factors, including the means of administration, the target site, the physiological state of the patient, whether the patient is human or animal, other drugs being administered, and whether the treatment is prophylactic or therapeutic. Typically, the patient is human, but non-human mammals, including transgenic mammals, can also be treated. The therapeutic dose can be titrated using conventional methods known to those skilled in the art to optimize safety and efficacy.

[0467] When the antibodies of the present invention are used for passive immunization, the dosage range can be, for example, 0.0001 to 100 mg / kg, and more commonly 0.01 to 5 mg / kg (e.g., 0.02 mg / kg, 0.25 mg / kg, 0.5 mg / kg, 0.75 mg / kg, 1 mg / kg, 2 mg / kg, etc.), depending on the body weight of the subject. For example, the dosage can be 1 mg / kg body weight or 10 mg / kg body weight or between 1-10 mg / kg, preferably at least 1 mg / kg. Doses within the above ranges are also intended to be within the scope of the present invention.

[0468] The subject can take this dosage every day, every other day, once a week, or any other medication schedule determined by empirical analysis. An exemplary treatment limits the administration of multiple doses over a longer period of time, for example, at least six months. Other exemplary treatment regimens limit administration once every two weeks or once a month or once every 3 to 6 months. Exemplary dosage regimens include 1-10 mg / kg or 15 mg / kg per day for several consecutive days, or 30 mg / kg every other day, or 60 mg / kg once a week. In some methods, two or more monoclonal antibodies with different binding specificities are administered simultaneously, in which case the dosage of each antibody administered can fall within its specified range.

[0469] The antibodies or fragments thereof of the present invention may have a variety of administration intervals. The single dose interval may be, for example, once a day, once a week, once a month or once a year. The intervals may also be irregular, with administration guided by measuring the patient's blood levels of the polypeptide or target molecule. In some methods, the dose can be adjusted to achieve a certain antibody or toxin plasma concentration, for example, 1-1000 μg / ml, or 25-300 μg / ml. Alternatively, the antibody or fragment thereof may be administered as a sustained release agent, in which case less frequent administration is required. The dosage and frequency of administration depend on the half-life of the antibody in the patient. Generally, humanized antibodies show the longest half-life, followed by chimeric antibodies and non-human antibodies. In one embodiment, the antibody or fragment thereof of the present invention may be administered in an unconjugated form. In another embodiment, the antibody of the present invention may be administered multiple times in a conjugated form. In another embodiment, the antibody or fragment thereof of the present invention may be administered first in an unconjugated form and then in a conjugated form, or vice versa.

[0470] The dosage and frequency of administration can vary depending on whether the treatment is preventive or therapeutic. In preventive applications, a composition containing the antibodies of the present invention or a mixture thereof is administered to a patient who has not yet reached a disease state to enhance the patient's resistance. Such an amount is defined as a "prophylactically effective dose." In such applications, the precise dosage also depends on the patient's health and general immune status, but is typically 0.1 to 25 mg per dose, particularly 0.5 to 2.5 mg per dose. Over longer time periods, relatively low doses are administered at relatively long intervals. Some patients continue to receive treatment in their later years.

[0471] In therapeutic applications, it is sometimes necessary to administer the antibody at relatively high doses (e.g., from about 1 to 400 mg / kg per dose, of which 5 to 25 mg / kg is commonly used in radioimmunoconjugates and higher doses are commonly used in cytotoxin-drug conjugates) at relatively short intervals until the progression of the disease is alleviated or terminated, preferably until the patient shows partial or complete improvement in the symptoms of the disease. Thereafter, the patent may administer a prophylactic regimen.

[0472] In one embodiment, a subject can be treated with a nucleic acid molecule encoding a polypeptide of the invention (e.g., in a vector). The dosage of nucleic acid encoding a polypeptide ranges from about 10 ng to 1 g, 100 ng to 100 mg, 1 μg to 10 mg, or 30-300 μg of DNA per patient. The dosage of infectious viral vectors ranges from 10 to 100, or more, viruses per dose.

[0473] The therapeutic agent can be administered parenterally, topically, intravenously, orally, subcutaneously, intraarterially, intracranially, intraperitoneally, intranasally, or intramuscularly for prophylactic and / or therapeutic treatment. The antibodies of the invention are preferably administered by intramuscular injection or intravenous infusion. In some methods, the therapeutic antibody, or fragment thereof, is injected directly into the brain. In some methods, the antibody, or fragment thereof, is administered as a sustained-release composition or sustained-release device, such as a Medipad®. TM equipment.

[0474] The formulations of the present invention may be optionally administered in combination with other agents effective for the treatment of the disorder or condition in need of treatment (eg, prophylactically or therapeutically). Preferred additional agents are those that are recognized in the art and are standardly administered for the particular disorder.

[0475] The effective single therapeutic dose (i.e., therapeutically effective amount) of the 90Y-labeled antibody of the present invention ranges from about 5 to about 75 mCi, more preferably from about 10 to about 40 mCi. The effective single therapeutic non-bone marrow ablation dose of the 131I-labeled antibody ranges from about 5 to about 70 mCi, more preferably from about 5 to about 40 mCi. The effective single therapeutic ablation dose (i.e., autologous bone marrow transplantation may be required) of the 131I-labeled antibody ranges from about 30 to about 600 mCi, more preferably between about 50 and less than about 500 mCi. When coupled to a chimeric modified antibody, since the chimeric modified antibody has a longer circulation half-life than murine antibodies, the effective single therapeutic non-bone marrow ablation dose of the 131I-labeled chimeric modified antibody ranges from about 5 to about 40 mCi, more preferably less than about 30 mCi. The imaging dose standard, for example, when labeled with 111In, is typically less than about 5 mCi.

[0476] Although a large amount of clinical experience with I and Y has been obtained, other radioactive labels are also well known in the art and have been used for similar purposes. Other radioactive isotopes are also used for imaging. For example, other radioactive isotopes compatible with the scope of the present invention include, but are not limited to, I, I, P, Co, Cu, Cu, Br, Rb, Kr, Sr, In, Cs, Cs, I, Hg, Pb, Bi, Lu, Re, Pb, Bi, Sc, Rh, Pd, Samarium, Re labels, Au, Ac, A, Bi. In this respect, α, γ and β emitters are all compatible with the present invention. In addition, the present disclosure defaults to those skilled in the art without excessive experimentation and can easily determine which radionuclides are compatible with the selected course of treatment. For this reason, other radionuclides already used in clinical diagnosis include 125I, 123I, 99Tc, 43K, 52Fe, 67Ga, 68Ga, and 111In. Antibodies have also been labeled with a variety of radionuclides for potential use in targeted immunotherapy (Peirersz et al. Immunol. Cell Biol. 65: 111-125 (1987)). These radionuclides also include 188Re and 186Re as well as 199Au and 67Cu, but are used less. U.S. Patent No. 5,460,785 provides other data in terms of this type of radioisotope, which is incorporated herein by reference.

[0477] As previously discussed, the antibodies or fragments thereof described herein can be administered in a pharmaceutically effective amount for the in vivo treatment of a disorder in a mammal. In this regard, it should be understood that the disclosed antibodies or fragments thereof will be formulated to facilitate administration and promote stability of the active agent. Preferably, the pharmaceutical compositions based on the present invention comprise a pharmaceutically acceptable, non-toxic, sterile carrier, such as physiological saline, a non-toxic buffer, a preservative, and the like. A pharmaceutically effective amount of the antibodies described herein, whether conjugated or not to a therapeutic agent, as used herein, means a dose sufficient to achieve effective binding to the target and achieve a benefit, such as ameliorating symptoms of a disease or disorder, or detecting a substance or cell. In the case of tumor cells, the polypeptide preferably interacts with a selected immunoreactive antigen on a tumor cell or immunoreactive cell and increases cell death. Of course, the pharmaceutical compositions described herein can be administered in a single dose or multiple doses to provide a pharmaceutically effective amount of the polypeptide.

[0478] Consistent with the present disclosure, the antibodies of the present invention can be administered to humans or other animals in a dosage sufficient to produce a therapeutic or prophylactic effect according to the above-mentioned treatment methods. The polypeptides of the present invention can be prepared into conventional dosage forms by combining the antibodies of the present invention with a pharmaceutically acceptable carrier or diluting according to known techniques and administered to humans and other animals. It is recognized by those skilled in the art that the form and characteristics of the pharmaceutically acceptable carrier or diluent are determined by the amount of active ingredient combined therewith, the route of administration and other well-known variables. It will be further understood by those skilled in the art that mixtures comprising one or more polypeptides of the present invention may prove to be particularly effective.

[0479] VI. Methods of treating diseases or disorders associated with kallikrein or des-Arg10-kallikrein

[0480] The anti-kallikrein or des-Arg10-kallikrein antibodies or fragments thereof described herein can effectively antagonize the activity of kallikrein or des-Arg10-kallikrein. Accordingly, in another aspect, the present invention provides a method for treating kallikrein or des-Arg10-kallikrein-related diseases or disorders by administering a pharmaceutical composition containing one or more anti-kallikrein or des-Arg10-kallikrein antibodies or antigen-binding fragments thereof to a subject in need thereof.

[0481] Diseases or disorders associated with kallikrein or des-Arg10-kallikrein that require treatment include, but are not limited to, pathophysiological conditions such as inflammation, trauma, burns, shock, allergies, acute or chronic pain, and fibrosis, such as renal fibrosis. In certain exemplary embodiments, the antibodies described herein are used to treat renal fibrosis and related acute kidney injury and chronic kidney disease, which are the leading causes of end-stage renal failure.

[0482] Those skilled in the art will be able to determine by routine experimentation the effective non-toxic dose of an antibody (or other therapeutic agent) for treating a kallikrein or des-Arg10-kallikrein-related disease or disorder. For example, the therapeutically active amount of a polypeptide may vary according to a variety of factors, such as the stage of the disease (e.g., stage I versus stage IV), age, sex, medical complications (e.g., immunosuppressive state or disease) and the subject's weight, and the ability of the antibody to elicit the subject's expected response. The dosage regimen can be adjusted to provide the optimal therapeutic response. For example, several divided doses may be administered daily, or the dosage may be reduced accordingly depending on the urgency of the treatment situation. However, in general, the effective dose is expected to be in the range of about 0.05 to 100 mg per kilogram of body weight per day, more preferably about 0.5 to 10 mg per kilogram of body weight per day.

[0483] VII. Examples

[0484] The following examples are provided to further illustrate the present invention, but are not intended to limit it. The contents of the sequence listing, figures and all references, patents and published patent applications cited in this application are expressly incorporated herein by reference.

[0485] In addition, the present invention may utilize conventional molecular biology, microbiology, and recombinant DNA techniques in the art, which are explained in detail in the literature. See, e.g., Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual, Second Edition (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (herein "Sambrook et al., 1989"); DNA Cloning: APractical Approach, Volumes I and II (edited by DN Glover 1985); Oligonucleotide Synthesis (edited by MJ Gait 1984); Nucleic Acid Hybridization [edited by BD Hames & S.J. Higgins (1985)]; Transcription AndTranslation [edited by BD Hames & S.J. Higgins (1984)]; Animal Cell Culture [edited by RI Freshney (1986)]; Immobilized Cells And Enzymes [IRL Press, (1986)]; B.Perbal, A Practical Guide To Molecular Cloning (1984); FMAusubel et al. (eds.), Current Protocols in Molecular Biology, John Wiley & Sons, Inc. (1994).

[0486] Example 1: Hybridoma production: Immunization of mice with kallikrein polypeptides conjugated to KLH and production of antibodies against BKR1 ligand

[0487] The goal is to develop cross-reactive antibodies against kallikrein (KD; SEQ ID NO: 1) and des-Arg10-kallikrein (DAKD; SEQ ID NO: 2) that inhibit ligand binding to human BKR1. Typically, mice are immunized with KD conjugated to KLH via an additional cysteine at the C-terminus or N-terminus, and their spleen cells are harvested and fused with mouse myeloma cells as fusion partners to generate hybridoma cells.

[0488] Briefly, the immunization protocol was as follows: On day 0, BALB / c mice (8-20 weeks old, female) were intraperitoneally immunized with an equal volume of KLH-KD and KD-KLH mixture (100 μg per mouse, total antigen) in phosphate-buffered saline (PBS), mixed with Sigma adjuvant system (Sigma cat#6322) at a 1:1 ratio, in a total volume of 200 μl per mouse. On day 21, mice were boosted with an equal volume of KLH-KD and KD-KLH mixture (50 μg per mouse, total antigen), mixed with Sigma adjuvant system (Sigma cat#6322) at a 1:1 ratio, in a total volume of 200 μl per mouse. On day 30, blood samples were collected for KD-specific antibody titration analysis. On day 51, mice were boosted with an equal volume of KLH-KD and KD-KLH mixture in PBS (50 μg per mouse as the total antigen amount), mixed with Sigma Adjuvant System (Sigma cat#6322) at a 1:1 ratio to a total volume of 200 μl per mouse for fusion. On day 55, mice were sacrificed in a CO2 chamber, blood was collected by cardiac puncture, and spleens were harvested for hybridoma preparation.

[0489] Hybridomas are generated by fusing a mouse myeloma deficient in adenine phosphoribosyltransferase (APRT) with spleen cells from mice immunized with a specific antigen. A selection system using HAT (hypoxanthine, azaserine, and thymidine) medium eliminates all other cells, leaving only APRT+ fused cells. Successful hybridomas should retain immunoglobulin (IgH) heavy chains, one IgH light chain locus, and secrete functional antibodies.

[0490] Hybridoma medium (IMDM) was prepared by mixing the following: 500 ml Iscove's Modified Dulbecco's Medium (HyClone SH30259.01), 50 ml fetal bovine serum (HyClone SH30070.03), 5 ml L-glutamine (Gibco Invitrogen cat#25030), 5 ml non-essential amino acids (Gibco Invitrogen cat#11140050), 5 ml sodium pyruvate (Gibco Invitrogen cat#11360070), and 5 ml 0.1% penicillin-streptomycin (Gibco Invitrogen cat#15140148). The medium was filtered before use. Expansion medium was prepared by mixing the following: 1000 ml serum-free medium (Gibco Hybridoma SFM #12045), 100 ml 10% HyClone Ultra Low IgG Specified FBS #SH30898.03, and 10 ml penicillin / streptomycin. Freezing medium was prepared by mixing 45 ml heat-inactivated FBS (HyClone SH30070.03) and 5 ml DMSO, sterilized by filtration. Other materials included the following: HAT (50x) obtained from Sigma-Aldrich (#HO262); Hybridoma Fusion and Cloning Supplement (50X) (Roche Diagnostics 11 363 735 001); 0.4% Trypan Blue Stain (Invitrogen cat#15250-061 or T10282); PEG1500 prepared as a 50% w / v solution in 75 mM Hepes (Roche cat#783641 (10783641001). All reagents except HAT and Hybridoma Fusion and cloning supplement were used at 37°C.

[0491] Table 2. Peptide reagents used for immunization and screening

[0492]

[0493]

[0494] Briefly, three or four days before fusion, mice were boosted intraperitoneally or intravenously with the target antigen. On the day of fusion, mice were sacrificed in a CO2-confined chamber, blood was collected by cardiac puncture, and spleens were removed and placed in a covered dish containing 10 ml of serum-free IMDM. Fusion partner myeloma cells: FO (ATCC ref CRL-1646) / X63 Ag8.653 (ATCC ref CRL1580) were growing in logarithmic phase and split the day before fusion (1:2 and 1:5), collected into a 20 ml centrifuge tube, centrifuged, and resuspended in 10 ml of IMDM. The pellet was washed twice with serum-free IMDM medium. All centrifugations were performed at 1570 rpm for 5 minutes. The pellet was finally resuspended in 10 ml of serum-free IMDM. Connective tissue was removed from the spleen. 1 ml of serum-free IMDM preheated to 37°C was injected into the spleen using a 1 ml syringe and a 25-gauge needle. Splenocytes were squeezed out of the fibroelastic capsule using forceps and washed twice with 10 ml serum-free IMDM (including initial centrifugation) and resuspended in 10 ml serum-free IMDM. Cells were counted on a Countess automated cell counter.

[0495] Fusion partner cells and splenocytes are mixed in a 50ml tube at a ratio of 1:2 to 1:10 (depending on the cell number) and centrifuged at 970 rpm for 10 minutes (low spin) to form a loose cell pellet. After the "low spin," the supernatant is removed, not to prevent it from affecting the cell pellet, but to reduce the amount of liquid surrounding the cells to avoid dilution of the PEG 1500. The remaining culture medium is saved and added back after the addition of the PEG (below). A total of 1ml of PEG 1500, preheated to 37°C, is added dropwise to the cell pellet over approximately 1 minute, and the cells are mixed. The cell pellet and PEG are incubated for an additional minute, followed by the addition of 10ml of serum-free IMDM medium over 1 minute, with the first 1ml added over 30 seconds. The cells are spun at 970 rpm for 10 minutes, and the supernatant is decanted into another container. In (2) 100ml wells, add the following reagents: 70ml IMDM with 10% FBS, 2ml HAT and 2ml Hybridoma and Fusion Cloning Supplement. Resuspend the cells in 10ml IMDM with 10% FBS and add them to (2) 50ml test tubes (5ml cells / tube). Then add 25ml IMDM with 10% FBS to the first 50ml test tube. The resulting 30ml is transferred to a well containing 70ml HBSS / HAT / cloning supplement and pipetted into (10) 96-well plates, 200ul cells / well. After about 10 to 14 days or when the culture medium in the well turns yellow, the fusion is ready and can be screened by ELISA (50ul). After the initial screening, positive clones are selected, counted and transferred to a 24-well plate using IMDM with 10% FBSHI, 500ul per well. Hybridoma supernatants were screened by ELISA on streptavidin plates coated with N- and C-terminally biotinylated peptides (see below).

[0496] Example 2: Characterization and screening of hybridoma cells expressing antibodies against human BKR1 ligand

[0497] Hybridoma supernatants were screened by ELISA on streptavidin plates coated with N- and C-terminally biotinylated peptides (see, e.g., Table 2) and antibody binding kinetics were measured to confirm positive hybridoma clones.

[0498] The ability of antibodies in hybridoma supernatants to bind to BKR1 ligand polypeptides was evaluated using an ELISA assay. 5 μg / ml of DAKD-biotin or KD-biotin polypeptide in phosphate-buffered saline (PBS) was coated onto a 96-well SA plate at room temperature for 1 hour. Nonspecific binding sites were blocked with 1% bovine serum albumin (BSA) in PBS. This plate was used for primary and secondary screening of crude hybridoma supernatants. Hybridoma supernatants were added to the plate to allow binding to the coated KD or DAKD polypeptide. After a 1-hour incubation, the plates were washed and bound antibodies were detected using a horseradish peroxidase (HRP)-conjugated secondary antibody (HRP goat anti-mouse IgG (H+L): Jackson ImmunoResearch Labs #115-035-166) and further 2,2'-azino-bis(3-ethylbenzothiazole-6-sulfonic acid) (ABTS) (Roche diagnostics #11 204 521001) as a substrate. Data were analyzed using Excel. Antibodies that showed a positive signal (more than 2-fold the signal from a 1:10,000 diluted serum ELISA) were selected and screened again for confirmation. Confirmed positive hybridoma clones were selected and fractionated by Biacore for binding and dissociation rate analysis.

[0499] Antibody binding kinetics were measured using a BIACORE 2000 or BIACORE 3000 (GE Healthcare), designed for real-time biomolecular interaction analysis (BIA). The sensor chip used was an SA chip (GE Healthcare) with streptavidin covalently immobilized on a parent carboxymethyl polysaccharide. Each chip contained four parallel flow cells (Fc). Each biotinylated BKR1 or BKR2 ligand peptide was immobilized on one of flow cells 2 to 4 (Fc2 to Fc4) of the SA chip for binding and off-rate screening and selectivity screening. Flow cell 1 (Fc1) was reserved and used to immobilize a random peptide (biotinylated at one end) as a negative control. This peptide had an equal or similar peptide length to the ligand peptide being tested. In the screening assay, cell culture supernatant from hybridoma clones transiently expressing humanized variants in the initial screening was injected onto the immobilized peptide. Hybridoma cell culture medium was also injected onto the chip surface as a blank to establish a baseline. After subtracting Fc1 and blank buffer run signals, the off-rates of antibodies from the supernatant to each peptide were analyzed and ranked using BIAevaluation software. Only those that showed superior (kd < 10 -4Antibody clones with high binding / dissociation rates (1 / s) were selected for subcloning and further characterization. For kinetic analysis, the corresponding biotin-peptides recognized by the test antibodies in the screening were immobilized on flow cells 2 to 4 (Fc2 to Fc4), while a random peptide was immobilized on flow cell 1 (Fc1) as a reference cell. Each purified antibody selected in the screening was prepared in serial two-fold dilutions ranging from 0.1 to 10 nM in flow buffer (1x HBS-EP buffer, GE Healthcare). Binding on-rates, off-rates, and total affinity were calculated using BIAevaluation. Antibody binding kinetics for each antibody were confirmed in triplicate using Biacore.

[0500] A total of eight mice were immunized with KLH-KD / KD-KLH and KLH-DAKD / DAKD-KLH mixtures, and their spleen cells were fused using the above method. After initial screening of 7,680 hybridoma clones using DAKD-biotin and KD-biotin ELISAs, only 76 clones were confirmed positive and selected for grading of binding-dissociation rates against DAKD-biotin or KD-biotin immobilized on a streptavidin (SA) chip on a Biacore 3000 / 2000. Of these, eight clones had binding-dissociation rates <= 10 -4 The hybridoma clones were subcloned, sequenced, purified and further characterized (see Table 3).

[0501] Table 3. KLH-KD / KD-KLH and KLH-DAKD / DAKD-KLH Immunization Results

[0502]

[0503]

[0504] Based on the results shown in Table 3, five clones with unique sequences were selected for kinetic studies. These antibodies highly selectively bind to DAKD-biotin, KD-biotin, DAKLP-biotin, and KLP-biotin (see Table 4). They do not bind to other kinin peptides or N-terminally biotinylated peptides.

[0505] Table 4. Summary of Antibody Kinetics of Selected Anti-DAKD / KD Candidates

[0506]

[0507]

[0508] Additional immunizations were performed with a range of immunogens (see Table 2 for peptide listings) to generate antibodies that blocked the rodent BKR1 ligand, DABK, and DAK, as well as antibodies with additional binding specificities to different peptide members of the kinin family. Table 5 lists the heavy and light chain sequences of the generated antibodies.

[0509] Table 5. Antibody heavy and light chain sequences

[0510]

[0511]

[0512]

[0513] Example 3: Generation of surrogate antibodies in murine studies

[0514] Surrogate antibodies for use in murine studies must be able to bind to and neutralize the rodent BKR1 ligands, DABK and DAKLP (the mouse counterpart of DAKD). To generate the desired surrogate antibodies, mice were first immunized with DABK and / or DAKD directly linked to KLH at the N-terminus. Hybridoma clones positive for biotin-DABK / biotin-DAKD (biotin directly linked to the N-terminus) screened by ELISA were selected for expansion and purification. Family 7 antibodies (see Table 12), which exhibit high binding affinity to biotin-DABK, biotin-DAKLP, and biotin-DAKD, were selected based on direct binding analysis using Biacore (see Table 10). However, these Family 7 antibodies did not bind to native, unmodified DABK and DAKD polypeptides in competitive ELISA and lacked neutralizing activity when analyzed for calcium influx using the Functional Drug Screening System (FDSS) (Hamamatsu Photonics KK, Japan). In addition, biotin-DABK and biotin-DAKD completely lost their biological activity compared to native unmodified DABK and DAKD when subjected to FDSS analysis (data not shown).

[0515] It was hypothesized that direct attachment of KLH and biotin to the N-termini of DABK and DAKD prevented the formation of their native conformations. To restore the native conformations of the KLH- and biotin-conjugated peptides, linkers were designed and added to the N-termini of DABK and / or DAKD to "buffer" the effects of KLH and biotin conjugation on peptide conformation. Polyglycine linkers were initially considered and tested due to their simplicity, nonpolarity, and neutrality based on simulation results. FDSS analysis revealed that the gly-gly-gly (3G) linker was optimal based on its ability to restore the biological activity of the KLH- and biotin-conjugated DABK and DAKD peptides (data not shown). Therefore, KLH-3G-DABK was selected for immunization of mice. Biotin-3G-DABK and biotin-3G-KD were also used in binding-based screening assays (ELISA and Biacore). In this new round of hybridoma selection for replacement antibodies, several DABK / DAKD-specific antibodies (family 3, see Table 13) were identified. EE1 was selected as the primary replacement antibody based on its superior binding affinity and neutralizing activity against native DABK / DAKD, as well as its lack of cross-reactivity with other peptides.

[0516] Immunization with the different immunogens listed in Table 13 produced antibodies with varying specificities. Family 4 antibodies are specific for the BKR2 receptor ligands, BK and KD. Family 5 antibodies specifically bind to the C-termini of BK and DABK. Family 6 antibodies bind to BK, DABK, and DAKD, but not KD.

[0517] Other linkers were also evaluated for their ability to fit into the DABK / DAKD binding pocket, determining their binding to alternative EE1 antibodies. These included longer polyglycine linkers, polyalanine linkers, and existing linkers such as polyethylene glycol (PEG2) linkers and aminocaproic acid (Ahx) linkers (a 6-carbon inert linker). All linker peptides were custom synthesized by Abgent (Can Diego, CA). All biotinylated peptides tested with linkers (biotin-linker-DABK / DAKD) bound well to EE1, indicating that any inert N-terminal linker can help DABK and DAKD peptides conjugated with biotin or other molecules to restore their original active conformation. In contrast, EE1 was observed to have no or weak binding to biotin-DABK and biotin-DAKD peptides that have biotin directly conjugated to the N-terminus (see Figure 1 ).

[0518] The binding kinetics of the generated antibodies are summarized in Tables 5 to 11. Subsequently, all generated antibodies were classified into families and their binding specificities are summarized below in Table 12. Table 13 provides the heavy and light chain sequences of antibodies assigned to families 1 and 2 based on their binding specificity (see Table 12).

[0519] Table 6. Summary of Antibody Kinetics Against b-3G-DABK and b-3G-DAKD Peptides

[0520]

[0521] Table 7. Summary of Antibody Kinetics Against b-3G-DAKLP and b-3G-BK

[0522]

[0523]

[0524] Table 8. Summary of Antibody Kinetics Against b-3G-KLP and b-3G-KD Peptides

[0525]

[0526] Table 9. Summary of Antibody Kinetics Against DABK-b and DAKLP-b Peptides

[0527]

[0528]

[0529] Table 10. Summary of Antibody Kinetics Against BK-b and b-BK Peptides

[0530]

[0531] Table 11. Summary of Antibody Kinetics Against b-DABK and b-DAKD Peptides

[0532]

[0533]

[0534] Table 12. Summary of Antibody Kinetics Against b-DAKLP and b-KD Peptides

[0535]

[0536] Table 13. Summary of Anti-kinin Peptide Antibody Generation

[0537]

[0538]

[0539] Example 4: Characterization of des-arginine-kinin ligand consumption using calcium flux

[0540] Functional assays were used to further characterize the seven antibody families generated. Bradykinin B1 receptor signaling is coupled to Gq, so receptor activation can be monitored through Gq activation of IP3 and downstream calcium mobilization. HEK mBKR1 (recombinant mouse bradykinin B1 receptor) cells or MRC5 (endogenously expressed B2 receptor (ATCC CCL-171)) were used to measure calcium mobilization.

[0541] Briefly, primers 804_cGWY_F:

[0542] 5'-AAAAGCAGGCTTAGGAGCGGCCGCCATGGCGTCCCAGGCCTCGCTG-3' (SEQ ID NO: 107) and 804_cGWY_R:

[0543] The mouse Bdkrb1 gene (sequence shown below) was amplified from mouse lung cDNA (Biochain, Cat# C1334152) using 5'-CAAGAAAGCTGGGTCGGATCCTTATAAAGTTCCCAGAACCCTGGTC-3' (SEQ ID NO: 108) and Pfu Polymerase (Agilent Technologies, Cat# 600264) and cloned into pDONR201 using BP clonase enzyme mix (Invitrogen, Cat# 11789-020). AThe pEAK8 expression vector (EDGE Biosystems) was modified by inserting the pEAK8 tail (GCATACCCATACGACGTCCCAGACTACGCT, GenBank SEQ ID NO: 109CY100443) into the pEAK8 expression vector (EDGE Biosystems) linearized with EcoRI and HindIII (forming the vector pEAK8-nHA) and then inserted into the pEAK8-nHA digested with EcoRI and NotI and blunt-ended with Klenow polymerase (NEB, cat#M0210S) to form the vector pEAK8_nHA_DEST. Next, the mouse Bdkrb1 gene was subcloned into the pEAK8_nHA_DEST using LRClonase (Invitrogen, cat#11791-100). The pEAK8-Bdkrb1 plasmid was then transfected into 293-PSC cells using Fμgene 6 transfection reagent. 24 hours after transfection, the cells were placed in an antibiotic (puromycin) selection environment and maintained to generate a stable cell line. The presence of the Bdkrb1 gene in the generated stable cell line was confirmed by real-time RT-PCR and agarose gel electrophoresis. The expression of bradykinin B1 receptor on the cell surface was detected on a FACS device using an anti-N-terminal HA tail (Covance, Cat#MMS-101P) antibody on the bradykinin B1 receptor. The functional activity of the bradykinin B1 receptor was demonstrated by selective agonist calcium flow analysis.

[0544] Bdkrb1 gene subcloned into cells:

[0545]

[0546]

[0547] HEK mBKR1 or MRC5 cells were plated in growth medium in 384-well clear-bottom plates and allowed to attach overnight. The growth medium was then removed, and the cells were washed with assay buffer (HBSS, 20 mM HEPES, 2.5 mM probenecid) and loaded with 0.5 μM of the cell-permeable calcium-sensitive dye Fluo-4 AM with 0.04% pluronic acid for 1 hour at 37°C. The AM ester was cleaved, and the calcium dye remained in the cytoplasm. After 1 hour, the cells were washed to remove excess dye and the 20 μl of residual buffer remaining on the cells. 2x solution (FDSS) was added to the Hamamatsu Functional Drug Screening System (FDSS) for treatment, and calcium mobilization was monitored kinetically for at least 4 minutes. B1R and B2R receptor activation leads to Galpha q-mediated phospholipase C activation and IP3-mediated calcium mobilization. Fluo-4 dye chelates and releases calcium, resulting in a strong fluorescence change. Results are output as maximum-minimum relative fluorescence units, normalizing for differences in cell density or plate dye loading.

[0548] Ligand potency was measured by running ligand concentration-response curves daily, and an approximate EC70-80 concentration of the ligand was selected for incubation with the antibody. The EC80 concentration was chosen because it was within the linear range of the assay curve and provided a sufficient window for either agonist or ligand-consuming antibody to decline. This allowed the generation of an antibody dose-response curve by relating the ligand EC80 concentration to ligand consumption as monitored by fluorescence changes. Results were normalized using buffer and ligand EC80 responses, and the EC50 value for ligand consumption was calculated. Results were then expressed as the molar ratio of the antibody concentration that reduced the ligand consumption response by 50% (i.e., the antibody EC50) divided by the ligand concentration used. While the theoretical maximum should be 0.5, as one unit of antibody can theoretically consume two units of ligand, the values observed in practice were lower, likely reflecting insensitivity of the assay at low ligand concentrations rather than constraints of antibody stoichiometry. The results of these experiments are shown in Tables 14-16.

[0549] Antibody families 1 and 2 (see Table 13) demonstrated excellent binding kinetics in Biacore (Table 3) and excellent neutralizing activity against DAKD and KD polypeptides using calcium flux assays (Tables 14 and 15). These antibodies were further analyzed for thermal stability and sequence suitability for humanization. F151 was an excellent candidate for humanization because it is thermally stable, has no problematic residues in the CDR regions, and cross-reacts with the mouse ligands KLP and DAKLP.

[0550] Table 14. Characterization of des-Arg-kallikrein ligand depletion in HEK mBKR1 cells using calcium flux

[0551]

[0552]

[0553] Table 15. Characterization of des-Arg-kallikrein ligand depletion in MRC5 fetal lung fibroblasts using calcium flux

[0554]

[0555] Example 5: F151 engineering: humanization, stabilization and mutation do not require sequence motifs

[0556] 1. Humanization

[0557] The humanization strategy used herein has been described in PCT / US08 / 74381 (US20110027266), which is incorporated herein by reference in its entirety. Homology models of the anti-DAKD / KDF151 LC and HC were constructed in Molecular Operating Environment (MOE; v.2009.10; Chemical Computing Group) using the light chain variable region (VL) and heavy chain variable region (VH) sequences of mouse F151. The following templates were used: light chain framework – 1SBS (93% identity across the framework), heavy chain framework – 2VXT (84% identity across the framework), L1–1LVE (93% identity), L2–1EEU (100% identity), L3–2R56 (93% identity), H1–1NJ9 (95% identity), H2–2VXU (76% identity), and H3–1HIL (49% identity). Templates are available at www.rcsb.orgThe protein data were found in the RCSB Protein Data Bank (RCSB Protein Data Bank), a website managed by Rutgers and the University of California, San Diego (Berman, HM; Westbrook J.; Feng. Z.; Gilliland, G.; Bhat, TN; Weissig, H.; Shindyalov, IN; Bourne, PE. The Protein Data Bank, Nucleic Acids Research, 2000, 28, 235-242). A protein homology model was constructed and minimized using standard procedures using the MOE method. Molecular dynamics (MD) simulations were then performed on the minimized 3D homology model of the mouse F151 protein, with the protein backbone constrained in a conventional Born implicit solvent at a temperature of 500 K and a duration of 1.1 ns. In the initial MD run, 10 different conformations were extracted every 100 ps (one extracted) within the last 1 ns. MD simulations were then performed on each of these different conformations, without constraints on the protein backbone, at a temperature of 300 K and a duration of 2.3 ns. The results of each of the above 10 MD runs were selected, and the last 2000 snapshots (1 per ps) in the MD trajectory were used to calculate the root mean square deviation of each amino acid of mouse F151 compared to a reference center point. By comparing the average root mean square deviation of a given amino acid in the above 10 independent MD runs with the total average root mean square deviation of all amino acids of mouse F151 (in the above 10 independent MD runs), it was determined whether this amino acid has sufficient flexibility to be considered in MD as potentially interacting with the T cell receptor and responsible for activating the immune response. 62 amino acids in the mouse F151 antibody were identified as flexible, excluding CDRs and their immediate neighbors. area.

[0558] The motion of the 28 most flexible amino acids in murine F151 within 20 nanoseconds (10 x 2 nanoseconds) was then compared using machine learning simulations with the motion of the corresponding most flexible amino acids in 49 human germline homology models within 10 x 2 nanoseconds. These 49 human germline models were constructed by systematically combining the seven most prevalent human germline light chains (vk1, vk2, vk3, vk4, vlambda1, vlambda2, vlambda3) and the seven most prevalent human germline heavy chains (vh1a, vh1b, vh2, vh3, vh4, vh5, vh6). The flexible amino acids in the human germline antibodies vk1-vh1b exhibited a 0.8 4D similarity to those in murine F151; therefore, the human germline antibodies vk1-vh1b were used to humanize F151, focusing on these flexible amino acids. Sequence alignment was performed based on the 3D best overlap of the α carbons of the two corresponding homology models for pairwise amino acid correlations between murine F151 and vk1-vh1b amino acids (F151 LC with vk1, F151 HC and vh1b alignment, see Figure 15 ).

[0559] 2. Stabilization

[0560] Two approaches were used to improve the stability of this antibody.

[0561] a) Knowledge-based approach

[0562] Amino acids that occurred less frequently in the heavy and light chains compared to their corresponding canonical sequences, excluding CDRs, were suggested for mutation to the most frequently found amino acids (ΔΔGth > 0.5 kcal / mol; E. Monsellier, H. Bedouelle. J. Mol. Biol. 362, 2006, p. 580-593). This first batch of consensus mutations in the heavy and light chains was limited to amino acids found in the closest human germline (vk1-vh1b). Proposed changes were not considered if they were in the immediate vicinity of the CDRs (5 angstrom "vernier" region, J. Mol. Biol. 224, 1992, p. 487-499). This resulted in five stabilizing mutations in the LC (see Table 19) and four stabilizing mutations in the HC (see Table 20). Other criteria were considered to determine the potential of these mutations to stabilize the anti-DAKD / KD F151 antibody. These criteria were based on predicted stabilizing mutations that could bring about a favorable change in hydrophilic surface properties or molecular mechanics. In addition, other stabilizing mutations reported in the literature (E. Monsellier & H. Bedouelle, J. Mol. Biol., 362, 2006, pp. 580-593; BJ Steipe et al., J. Mol. Biol., 1994, 240, pp. 188-192) were also considered (see Tables 16-22). One such mutation was incorporated as a stabilizing mutation (D89E) in the subsequent HC2a, HC2b, and HC2c sequences. Another proposed mutation (Q62E) was introduced into variant HC2b.

[0563] b) 3D and MD-based approaches

[0564] The 3D and MD-based approaches have been previously reported (Seco J, Luque FJ, Barril X., J Med Chem. 2009 Apr 23; 52(8): 2363-71; Malin Jonsson et al., J Phys Chem. B 2003, 107, 5511-5518). By analyzing molecular dynamics simulations of the Fab in a binary solvent (20% isopropanol in water, 20 nanosecond simulations), the hydrophobic regions of the antibody were clearly identified. Lysine mutations were introduced in the immediate vicinity of these hydrophobic regions in an attempt to prevent aggregation. Additional analysis was performed using hydrophobic surface maps in Schrodinger's maestrosoftware (v.8.5.207). Combining these two methods, two lysine mutations were recommended, one in the heavy chain and one in the light chain.

[0565] 3. Humanization through transplantation

[0566] The technique of humanization using transplantation has been previously reported (Peter T. Jones, Paul H. Dear, Jefferson Foote, Michael S. Neuberger & Greg Winter Nature, 1986, 321, 522-525). This humanization approach begins with the identification of the closest human germline anti-DAKD / KD heavy and light chains. This can be accomplished by searching all human germlines using the BLAST search tool, which systematically lists all human germlines (for kappa and lambda chains, all possible combinations of V & J domains; for heavy chains, all possible combinations of V, D, and J domains).

[0567] The following closest human germline light and heavy chains were identified, which have 83% and 62% sequence identity to the anti-DAKD / KD F151 light chain (LC) and heavy chain (HC), respectively (see Figure 16 ). Using the international VBASE germline, the light chain was found to be close to the V IV-B3 (~83% identity) locus, and the heavy chain was found to be close to the 1-08 & 1-18 (~62% identity) loci, both of which are subfamilies of VH1. The CDR regions (as defined by MOE) and the Vernier region (as defined in Foote & Winter, J. Mol. Biol., 1992, 224, 487-499) are indicated in bold. The underlined humanized mutations were obtained by performing a pairwise comparison of the two linear sequences, excluding the CDR and Vernier region residues as defined above. In another humanized variant, only the CDRs were excluded from the comparison.

[0568] 4. Mutation without sequence motifs

[0569] The following sequence motifs were considered: Asp-Pro (acid-labile bond), Asn-X-Ser / Thr (glycosylation, X = any amino acid except Pro), Asp-Gly / Ser / Thr (succinimide / isoaspartate formation in flexible regions), Asn-Gly / His / Ser / Ala / Cys (exposed deamidation site), and Met (oxidation in exposed regions). Based on additional criteria, the VL and VH domains of murine F151 were selected from other murine antibodies because murine F151 lacks exposed unwanted sequence motifs, which were introduced in some humanized variants.

[0570] LC3A, LC3B, HC3a, and HC3b each have identified potentially problematic succinimide sites. These sites were not modified in the proposed sequences because the residues involved are likely involved in hydrogen-bonding networks (visual inspection of homology models). Similarly, these sites are found in many other antibody structures. Furthermore, in HC3a and HC3b, rigorous humanization by grafting would include replacing Ser115 with Met. The methionine at this position is exposed. Substituting this site with leucine is recommended as a humanizing mutation because leucine is a common residue in many near-human germline sequences.

[0571] The resulting humanized sequences were analyzed in the International Epitope Database (IEDB) (found at www.immuneepitope.com ; version June 2009; Vita R, Zarebski L, Greenbaum JA, Emami H, Hoof I, Salimi N, Damle R, Sette A, Peters B. The immune epitope edatabase 2.0. Nucleic Acids Res. 2010 Jan; 38 (Database issue): D854-62. Epub 2009 Nov 11) were searched for similar sequences to ensure that none of the humanized sequences contained any known human B- or T-cell epitopes (70% sequence identity was used as a cutoff for BLAST search results, and only results from human germline searches were considered).

[0572] 5. Original sequence of the murine F151 variable domain

[0573] The CDRs are highlighted in bold and the cursor region (as defined by Foote & Winter, J. Mol. Biol., 1992, 12, 24, 487-499) is underlined.

[0574] Light chain (SEQ ID NO: 26)

[0575]

[0576] Lineage index = 83% Z46615_1_V_X67858_1_J[V IV-B3]

[0577] Heavy chain (SEQ ID NO: 19)

[0578]

[0579] Germline index = 62% Z12316_1_VX97051_4_D_X97051_5_J [VH1 1-18]

[0580] 6. Engineering Sequences

[0581] a) Background

[0582] Five versions of the light chain (LC1, LC2a, LC2b, LC3A, and LC3B) and five versions of the heavy chain (HCl, HC2a, HC2b, HC3a, and HC3b) are recommended.

[0583] LC1 contains five humanizing mutations identified through the 4D humanization protocol. LC2a incorporates five additional stabilizing mutations. LC2b incorporates one additional lysine mutation to help prevent aggregation. LC3a contains 15 mutations derived from grafting to the closest human germline sequence and retaining mouse CDR and Vernier region residues. LC3b contains 16 mutations derived from CDR grafting and one additional humanizing mutation.

[0584] HC1 has six humanizing mutations identified through in-house protocols. HC2a incorporates five additional stabilizing mutations, while HC2b contains six additional stabilizing mutations compared to HC1. In addition to the stabilizing mutations in HC2a, HC2c also contains a lysine mutation to help prevent aggregation. HC3a contains 19 mutations derived from grafting to the closest human germline sequence while retaining mouse CDR and Vernier region residues. HC3b contains 25 mutations derived from CDR grafting.

[0585] A total of six combinations are recommended (summarized in Table 16):

[0586] LC1 X HC1 (mutation only resolves humanization)

[0587] LC2a X HC2a (mutation resolution, humanization, and stabilization)

[0588] LC2a X HC2b (mutation resolution, humanization and stabilization)

[0589] LC2b X HC2c (mutation solves humanization, stabilization and "anti-aggregation") LC3a X HC3a (mutation solves most humanization through transplantation + cursor)

[0590] LC3b X HC3b (mutation resolved by grafting and humanization)

[0591] Table 16. Summary of 6 recommended LCxHC combinations

[0592]

[0593] Table 17. Mutations of the five LC variants of the anti-DAKD / KD F151 antibody

[0594]

[0595]

[0596] Table 18. Mutations of the six HC variants of the anti-DAKD / KD F151 antibody

[0597]

[0598]

[0599] b) Engineered light chain sequence

[0600] No known potentially problematic T- or B-cell epitopes were found in any of the recommended variants.

[0601] LC1 (SEQ ID NO: 27), humanized mutations are underlined, CDRs and vernier region are in bold:

[0602]

[0603] LC2a (SEQ ID NO: 28), humanizing mutations are underlined, CDRs and vernier region are bold, stabilizing mutations are italicized (as shown below, T at position 5, S at position 12, I at position 21, S at position 69, T at position 91):

[0604]

[0605] LC2b (SEQ ID NO: 29), humanizing mutations are underlined, CDRs and vernier region are bold, stabilizing mutations are italicized (as shown below, T at position 5, S at position 12, I at position 21, S at position 69, T at position 91), and the anti-aggregation mutation is K at position 89:

[0606]

[0607] LC3a (SEQ ID NO: 30), with the grafted mutation underlined and the CDRs and vernier region in bold:

[0608]

[0609] LC3b (SEQ ID NO: 31), with the grafted mutation underlined and the CDRs and vernier region in bold:

[0610]

[0611] Note: L at position 52 is a Vernier region residue that was mutated for humanization.

[0612] C) Engineered heavy chain sequence

[0613] HC1 (SEQ ID NO: 20), humanizing mutations are underlined, CDRs and vernier region are in bold:

[0614]

[0615] HC2a (SEQ ID NO: 21), humanizing mutations are underlined, CDRs and vernier region are in bold, stabilizing mutations are in italics (as shown below, Q at position 1, A at position 9, G at position 44, Y at position 80, E at position 90):

[0616]

[0617] HC2b (SEQ ID NO: 22), humanizing mutations are underlined, CDRs and vernier region are in bold, stabilizing mutations are in italics (as shown below, Q at position 1, A at position 9, G at position 44, E at position 62, Y at position 80, E at position 90):

[0618]

[0619] No human epitopes in the IEDB database were identified in sequence HC2b.

[0620] HC2c (SEQ ID NO: 23), humanizing mutations are underlined, CDRs and vernier region are in bold, stabilizing mutations are in italics (as shown below, Q at position 1, A at position 9, G at position 44, Y at position 80, E at position 90), and the anti-aggregation mutation is K at position 86:

[0621]

[0622] HC3a (SEQ ID NO: 24), with the grafted mutation underlined and the CDRs and vernier region in bold:

[0623]

[0624] HC3b (SEQ ID NO: 25), with the grafted mutation underlined and the CDRs and vernier region in bold:

[0625]

[0626] Note: The following Vernier region residues were mutated for humanization: V at position 2, M at position 48, V at position 68, M at position 70, T at position 74.

[0627] No human epitopes were identified in the IEDB database in the sequence HC3b

[0628] HC3b germline index = 83% Z12316_1_V_J00235_1_D_U42590_1_J[1-18 / DP-14].

[0629] Table 19. Recommended stabilizing changes in the light chain

[0630] residue Recommended changes Calculated Gth Accept change Ser-5 Thr 2.32286 yes Ala-12 Ser 0.75228 yes Met-21 Ile 0.768959 yes Pro-52 Leu 1.70059 No – Cursor Area Thr-69 Ser 1.10843 yes Lys-86 Glu 2.00115 No – changed to Gln during humanization Ile-91 Thr 1.27255 yes

[0631] Table 20. Recommended stabilizing changes in the heavy chain

[0632]

[0633]

[0634] Table 21. Evaluated combinations of stabilizing mutations

[0635]

[0636] Table 22. Potential stabilizing mutations

[0637]

[0638] Example 6: Characterization of humanized variants

[0639] Based on the computer modeling of the light and heavy chains listed in Table 16, the humanized F151 light chain and heavy chain variable region DNAs were codon-optimized for easy expression in HEK293, and the genes were synthesized by GeneArt (a subsidiary of Life Technologies). The synthesized DNA fragments, the light chain variable region gene, were cloned into the vector pFF0362 (A. human KappaLC vector) encoding the light chain constant region (CL) at the ApaLI / BsiWI sites, and the heavy chain variable region gene was cloned into the vector pFF0363 (B. human IgG1 HC vector) encoding the heavy chain constant region (CH1, CH2 and CH3) at the ApaLI / ApaI sites. The resulting plasmid pFF0460 containing the full-length sequence of the humanized F151 variant light chain and the plasmid pFF0466 containing the full-length sequence of the heavy chain were co-transfected into the FreeStyle TM 293 expression system (Invitrogen / Life Technologies, catalog no. K9000-01) and transiently expressed therein.

[0640] The six humanized variants shown in Table 16 were characterized by various parameters routinely used in the art, such as binding kinetics (discussed above) and physicochemical properties, such as thermal stability.

[0641] The above variants were characterized at two levels. The first level includes the following: Figure 2 Differential Scanning Calorimetry (DSC) is shown. Briefly, in a DCS experiment, the antibody is dialyzed against phosphate-buffered saline. Antibody concentration is determined by ultraviolet (UV) absorption. The antibody is diluted to 1 mg / mL in PBS. Scans are performed using a Calorimetry Sciences Corporation N-DSC II instrument with a 0.3268 mL capillary tube containing PBS in the reference cell. The sample is scanned from 20°C to 100°C at a scan rate of 2°C / min.

[0642] All variants, except HC3b / LC3b, showed similar binding affinity to the parent antibody. Variant HC3a / LC3a was selected from the other antibodies based on other physicochemical properties such as SEC data, stability, and lack of aggregation (see Tables 23-25).

[0643] Table 23. Comparison of kinetics of humanized F151 variants

[0644]

[0645]

[0646] Table 24. First-tier comparison of humanized variants

[0647]

[0648] Table 25. Second Tier Comparison of Humanized Variants

[0649]

[0650]

[0651] Table 26. Comparison of parental F151 and humanized variant F151 (HC3a / LC3a)

[0652]

[0653]

[0654] The light and heavy chains of parent F151 and humanized variant F151 (HC3a / LC3a) are compared in Figure 3 .

[0655] Example 7: Crystal structure of humanized antibody F151 against BRK1 ligands kallikrein and des-Arg10-kallikrein

[0656] The crystal structure of humanized F151 (HC3a / LC3a) Fab bound to kallikrein or des-Arg10-kallikrein was determined and the intermolecular interactions were analyzed.

[0657] Kaplan-Meier (Kallin) powder was purchased from Phoenix Pharmaceuticals (Cat. No. 009-37). To generate the Fab protein, the heavy chain variable region DNA from the humanized F151 HC3a / LC3a was cloned into the 6Xhis-tagged CH1 vector pFF0366. The light chain plasmid used here was the same as that used for the original F151 LC3a in the F151 humanization (see Example 5). These two plasmids were co-transfected into free-type HEK293 cells for Fab protein expression. The Fab protein was then purified using cobalt resin, the buffer exchanged to 50 mM MES pH 6.0, 50 mM NaCl, and concentrated to 9 mg / mL. The purified F151 Fab protein was mixed with kallin at a 1:2 molar ratio and used for crystallization screening. This was performed under a wide range of conditions. Optimal crystals were observed under the B10, B12, and G10 conditions provided in the Hampton Research screening kit PEG / ION HT. The crystals were cryoprotected in well-buffered 20% glycerol and frozen for diffraction data collection. X-ray diffraction data for both complexes were collected using a Canadian Light Source, beamline CMCF-08ID. For the F151-KD complex, the Rmerge value was 8.9% and the I / s(I) was 20.2; while for the F151-DAKD complex, the Rmerge value was 7.7% and the I / s(I) was 18.5. The F151-KD structure was processed by molecular replacement in Phaser using the Fab counterpart from the Protein Data Bank (PDB) entry 3QOS, V L -V H and C L -C H 1 domains are treated as independent units. In autoBuste, at resolution Under the conditions of , the structure was corrected to the residual value (Rfactor) of 0.205 and the free residual value (Rfree) of 0.228 in space group P212121. The F151-DAKD structure was processed using the counterpart of F151-KD mentioned above. The resolution in Phaser is Under the conditions of , its structure was corrected to a residual value (Rfactor) of 0.232 and a free residual value (Rfree) of 0.238 in space group P212121.

[0658] Figure 4 and 5The electron density map shown shows the binding of KD and DAKD to F151 and clearly defines each amino acid position. For kallidin, the C-terminal residue Arg 10 The electron density map for DAKD is absent. This is consistent with observations on DAKD, which lacks a C-terminal arginine (shown in Table 27 below), which binds to F151 as well as KD. The IC50 values of F151 for neutralization of KD and DAKD in the FDSS cell assay were 0.12 nM and 0.09 nM, respectively. In both cases, the electron density decreases toward the C-terminus of the polypeptide. However, Phe 9 The electron density in KD is slightly better than that in DAKD, likely due to the presence of an additional arginine at the KD C-terminus stabilizing its C-terminus when bound to F151, although this arginine itself is not sufficiently stable to be observed by X-rays. Because the two structures are essentially identical (the root mean square (rms) between the C atoms of KD and DAKD is 0.139, and the rms between all atoms is 0.328), all following discussion will be based on the F151-KD structure.

[0659] Table 27. List of selected kinins

[0660]

[0661] KD is bound by burying its N-terminus in the interface between the Fv subunits of the heavy and light chains, e.g. Figure 6 As shown in Figure 2. The interface between the heavy and light chains is filled with aromatic amino acids, including Tyr-L42, Tyr-L93, Tyr-L100, Trp_L102, Phe-L104 and Tyr-H35, Trp-H47, Tyr-H50, Tyr-H99, Trp-H110, which stabilize each other through stacking and hydrophobic interactions. The residues in each CDR of the heavy and light chains contribute to the binding. Figure 7 and 8 As shown in the CDRs map, residues from both the light and heavy chains participate in interactions with the KD. Heavy chain CDR H3 is the longest loop and the most frequently used in interactions with the KD, forming a side flap of the KD. This loop is primarily stabilized by interactions with the other two CDRs (H1 and H2 of the heavy chain): a salt bridge between Asp-H101 and Arg-H52 (stabilizing H1 and H3), an aromatic-hydrogen interaction between Tyr-H102 and Tyr-H54 (stabilizing H2 and H3), a hydrogen bond between Asp-H108 and Tyr-H35, and a hydrogen bond between His-H105 and Tyr-L55 (stabilizing H3 and L2).

[0662] Comparing the residues interacting with the KD among the generated antibodies reveals similarities between them, with some antibodies being more closely related than others in terms of using specific amino acids to interact with the KD. For example, in the light chain, F151, C63, and I22 use more similar amino acids in their CDRs for KD binding, while B21 and I54 are more similar. In the heavy chain, F151 and C63 are surprisingly different from each other and from B21, I22, and I54. The latter three appear to be grouped together based on similarity. In the heavy chain, C63 is particularly interesting, with the lengths of its H2 and H3 loops being more different than those of the others. Looking at the Fab as a whole, B21 and I54 are the most closely related.

[0663] In the crystal structure, we found that the KD participates in systematic hydrogen bonding and hydrophobic interactions with the Fab. The N-terminus of the KD is buried within the Fab and contains more dense interactions, while the C-terminus is largely solvent-exposed. Aside from the first four residues (Lys-Arg-Pro-Pro), the remaining residues of the KD gradually protrude into the bulk of the solvent. The amidine group of the Lys1 side chain is anchored by Glu-L61 (L: light chain) via a salt bridge, while the amino group of Lys1 at the N-terminus forms a salt bridge with Asp-H108 (H: heavy chain). Simultaneously, the amidine group of the Lys1 side chain is entangled with the aromatic ring of Tyr-L55, participating in cationic interactions. These dense interactions involving Lys1 firmly anchor the KD N-terminus to the Fab. This explains the importance of Lys1 in KD binding to F151. Without it (i.e., bradykinin), no detectable binding to hF151 or F151 was measured. Similar to Lys1, Arg2 interacts with Fab via a salt bridge. The guanidine group of Arg2 interacts with the side chain of Asp-H104. The side chain of Arg2 also forms a hydrogen bond with the main chain carbonyl oxygen of Arg-H101. In addition, the main chain oxygen of Pro8 forms a hydrogen bond with the side chain of Arg-H101. TYR-H102 is inserted between Phe8 and Pro9 and participates in hydrophobic interactions with KD. In addition to direct interactions, numerous water-mediated hydrogen bonds can also be seen between KD and Fab. It is also interesting that tyrosine residues are the most frequently used in the interaction compared to other amino acids; Figure 7 and 8 Of the 16 amino acid residues marked with an asterisk, 9 are tyrosines. All residues surrounding the KD in F151 appear to play a role in ligand binding, with the exception of Asn-H33, which is close to the Phe6 side chain but polarity is incompatible and lacks other important interactions. If affinity maturation is considered, substitution with aromatic / hydrophobic residues, such as Trp or Tyr to interact with Phe8, seems to be a quick choice. In fact, these two aromatic amino acids can be found in other antibodies (Trp at C63, Tyr at B21, I22, I54). Table 28 below provides Figure 7 and8 Detailed analysis of the amino acid residues that interact with KD is indicated, and functional substitutions that can be made in the CDR regions without affecting antigen binding are illustrated.

[0664] Table 28. List of amino acid residues around the KD binding pocket, their functions in KD binding, and possible functional substitutions (light chain residues are gray cells, heavy chain residues are unshaded cells)

[0665]

[0666]

[0667] Conformational epitope analysis of kallikrein (KD) or des-Arg10-kallikrein (DAKD) showed that it adopts a "Pro4 knob" conformation. Figure 17 As shown, a hallmark of the "Pro4 knob" conformation is a tight dimorphic turn of the KD or DAKD main peptide backbone at position Pro4 (see Richardson JS. "The anatomy and taxonomy of protein structure." Adv Protein Chem. 1981; 34: 167-339, which is incorporated herein by reference). The "Pro4 knob" conformation is further defined by all or most of the remaining residues of KD (1-2 and 6-9) or DAKD, which adopt an S-shaped repeat to arrange the hydrophobic side chains into a spatial packing pattern.

[0668] Example 8: In vivo pharmacology of anti-BKR1-ligand antibodies in pain models

[0669] These examples of the present invention illustrate the in vivo effects of anti-BKR1-ligand antibodies in different preclinical models of acute and chronic pain, which were performed according to modified procedures described in (a) Saddi GM and Abbott FV., Pain (2000), 89:53-63; (b) Chen et al., Molecular Pain (2010), 2:6-13 and (c) Bennett GJ and Xie YK., Pain (1988), 33:87-107.

[0670] animal

[0671] Adult male OF1 mice, weighing 20–30 g, were used for formalin studies, and adult male C57Bl / 6J mice, weighing 25–30 g, were used for CFA and CCI studies. Mice were housed in a temperature-controlled room with a 12-hour light-dark cycle. Food and water were provided ad libitum. For all experiments, mice were allowed to acclimate to the experimental environment for at least 2 hours before testing. The studies were not randomized. Experimenters performing behavioral experiments were kept confidential; however, they were unaware of the study hypotheses. All procedures were approved by the "Comité d'Expérimentation pour la Protection de l'Animal de Laboratoire" (Animal Care and Use Committee) of sanofi-aventis and performed in accordance with French legislation implementing European Directive 86 / 609 / EEC (Decree no. 87-848–19 October 1987 and decision–19 April 1988).

[0672] A. Formalin-induced acute inflammatory pain

[0673] The formalin test is used to measure both nociceptive and inflammatory pain. Indeed, intraplantar injection of formalin induces an initial acute behavioral pain response (0-12 minutes) followed by a second inflammatory-mediated response (15-45 minutes) attributed to the excitability of the spinal cord.

[0674] Formaldehyde (37%, Sigma) was diluted in saline to a 2.5% formaldehyde concentration (approximately 6.25% formalin concentration) on a volume / volume basis. Mice were gently immobilized and 20 μL of a 2.5% formaldehyde solution was injected subcutaneously into the dorsal aspect of one hind paw. Behavioral responses were scored immediately after formalin injection and then every 3 minutes for 45 minutes according to the following criteria: (0): normal weight bearing on the injected paw; (1): lightly resting the injected paw on the ground; (2): lifting the injected paw; (3): licking or biting the injected paw. Group size was 11-12 male OF1 mice.

[0675] Scores were plotted against time and the area under the curve was calculated as the mean score (± SEM) for the early (0-12 minutes) and late (15-45 minutes) periods. Reversal of pain-like behavior was expressed as the percentage change in the area under the curve.

[0676] EE1 antibody inhibits pain-like behaviors in male OF1 mice during the late phase of the formalin test. EE1 antibody, administered intravenously 48 hours before intraplantar injection of formalin, showed a dose-dependent reversal of pain-like behaviors only in the late phase, with a minimum effective dose (MED) of 2.5 mg / kg. Figure 9In fact, when administered at doses of 2.5, 10, and 30 mg / kg, EE1 reversed the late phase by 35±5%, 33±5%, and 45±7%, respectively, as shown in Table 29.

[0677] In contrast, F151 antibody, administered intravenously 48 hours before intraplantar injection of formalin, had a weaker inhibitory effect on pain-like behaviors during the late phase of the formalin test. In fact, when administered at doses of 2.5 and 10 mg / kg, EE1 reversed the late phase by 15 ± 7% and 21 ± 5%, respectively, as shown in Table 29.

[0678] Table 29. Effects of EE1 and F151 antibodies on formalin-induced pain-like behaviors in male OF1 mice

[0679]

[0680] B1. CFA (complete Freund's adjuvant)-induced chronic inflammatory pain

[0681] Chronic inflammatory pain was induced by intraplantar administration of 25 μL complete Freund's adjuvant (CFA) containing 1 μg / μL heat-killed Mycobacterium tuberculosis and mannide monooleate (Sigma) in mineral oil under brief anesthesia with 3% isoflurane. Group size was 8 male C57Bl / 6 mice.

[0682] EE1 antibody 2.5 and 30 mg / kg were administered intravenously 22 hours after intraplantar injection of CFA, and mechanical and thermal hypersensitivity were assessed on days 1, 4, and 7 after intraplantar injection of CFA.

[0683] B1. Mechanical hypersensitivity

[0684] Mechanical hypersensitivity was assessed by measuring the frequency of paw withdrawal responses (FR, expressed as %) following 10 stimulations of Von Frey fibrils (Bioseb, France) on the plantar surface of the injected paw.

[0685] To investigate the effect of EE1 antibody on pain-like behaviors, we calculated the reversal of mechanical hypersensitivity (as a percentage) by the following method:

[0686] Reversal percentage of each mouse = (mean FR of the isotype control group after treatment - mean FR of the Ipsi group after treatment) / (mean FR of the isotype control group after treatment - mean FR of the blank group)

[0687] On days 1, 4, and 7 after intraplantar injection of CFA, a significant increase in FR was observed in the isotype control 1B7.11-treated group compared to the vehicle group, indicating the development of mechanical hypersensitivity. Intravenous administration of EE1 antibody 22 hours after intraplantar injection of CFA significantly reduced the FR measured at different times of the study compared to the isotype control 1B7.11-treated group ( Figure 10 ).

[0688] When EE1 antibody was administered intravenously at doses of 2.5 and 10 mg / kg, the reversal of mechanical hypersensitivity on days 1, 4, and 7 was 41±8% and 22±8% (day 1), 36±9% and 32±9% (day 4), and 27±10% and 50±9% (day 7), respectively (Table 30).

[0689] Table 30. Effect of EE1 antibody on CFA-induced mechanical hypersensitivity in male C57B1 / 6 mice

[0690]

[0691]

[0692] B2. Thermal hypersensitivity reaction

[0693] Thermal hypersensitivity was assessed by measuring the paw withdrawal latency (PWL, in seconds) to radiant heat generated by a plantar apparatus (IITC, Woodland Hills, USA).

[0694] To investigate the effect of EE1 antibody on pain-like behaviors, we calculated the reversal of thermal hypersensitivity (as a percentage) by the following method:

[0695] Reversal percentage of each mouse = (paw withdrawal latency after EE1 antibody treatment - mean paw withdrawal latency after isotype control group treatment) / (mean paw withdrawal latency before isotype control group treatment - mean paw withdrawal latency after isotype control group treatment)

[0696] Before intraplantar injection of CFA, there were no differences in baseline levels of thermal hypersensitivity among all groups (data not shown).

[0697] On days 1, 4, and 7 after intraplantar injection of CFA, a significant decrease in paw withdrawal latency was observed in the mice treated with the isotype control 1B7.11, indicating that CFA induced thermal hypersensitivity (data not shown).

[0698] EE1 antibody administered intravenously 22 hours after intraplantar injection of CFA (i.e., on the first day after intraplantar injection of CFA) did not increase the paw withdrawal latency on the first day of mice, regardless of the dose used. However, EE1 significantly increased the paw withdrawal latency on the fourth day, and this effect was also seen on the seventh day ( Figure 11 ).

[0699] When EE1 was administered intravenously at doses of 2.5 and 30 mg / kg, the reversal of thermal hypersensitivity on days 4 and 7 was 41±15% and 58±21% (day 4), 46±10% and 52±17% (day 7), respectively (Table 31).

[0700] Table 31. Effect of EE1 antibody on CFA-induced thermal hypersensitivity in male C57B1 / 6 mice

[0701]

[0702] C.CCI (Chronic Constriction Injury)-induced Neuropathic Pain (Bennett's Model)

[0703] The CCI model was used as a model of peripheral nerve injury. Briefly, mice were anesthetized with 3% isoflurane, and the right sciatic nerve was exposed through a small incision at the mid-thigh level. Three loose 6.0 chromic gut sutures (Ethicon) were placed around the sciatic nerve with a 1 mm spacing. The muscle and skin were sutured to complete the surgery. The day of CCI surgery was designated day 0. Groups consisted of 6-10 male C57BL / 6 mice.

[0704] On day 11 after surgery, EE1 antibody 2.5 and 30 mg / kg were intravenously administered, and mechanical and thermal hypersensitivity reactions were assessed on days 12 (D12), 14 (D12), and 18 (D12) after surgery, which corresponded to day 1 (D1), day 3 (D3), and day 7 (D7) after antibody treatment, respectively.

[0705] C1. Mechanical hypersensitivity

[0706] Dynamic Plantar Aesthesiometer (Μgo-Basile, Italy) was used to measure the withdrawal threshold of injured (i.e., 1 psi) and non-injured (i.e., control) hind paws under increasing pressure. A steel rod was used to apply force to the mouse hind paw (5 g increments for 10 seconds).

[0707] To investigate the effect of EE1 antibody on pain-like behaviors, we calculated the reversal of mechanical hypersensitivity (as a percentage) by the following method:

[0708] Percent reversal for each mouse = (Ipsi after treatment - Ipsi before treatment) / (control before treatment - Ipsi before treatment).

[0709] After surgery, the injured paw of the operated mice showed increased sensitivity to mechanical stimulation, while the uninjured paw was unaffected. On day 11, the sensitivity of the injured paw to mechanical stimulation reached a plateau (data not shown).

[0710] On the 11th day after surgery, intravenous administration of EE1 antibody showed a slight reversal trend of its mechanical hypersensitivity induced by CCI on the 12th, 14th and 18th days. When the dosage was 2.5 and 30 mg / kg, the reversal was 15.2±4.9% and 15.2±5.7% (day 12), 26.8±5.7% and 25.7±4.5% (day 14), 30.3±7.1% and 20.8±5.9% (day 18), respectively. Figure 12 and Table 32).

[0711] Table 32. Effect of EE1 antibody on CCI-induced mechanical hypersensitivity in male C57Bl / 6 mice

[0712]

[0713] C2. Thermal hypersensitivity

[0714] Thermal hypersensitivity of the injured paw was assessed by measuring the paw withdrawal latency (PWL, in seconds) to radiant heat generated by a plantar apparatus (IITC, Woodland Hills, USA).

[0715] To investigate the effect of EE1 antibody on pain-like behaviors, we calculated the reversal of thermal hypersensitivity (as a percentage) by the following method:

[0716] The reversal percentage of each mouse = (Ipsi after treatment - mean value of isotype control group after treatment) / (mean value of blank group after treatment - mean value of isotype control group after treatment).

[0717] After surgery, the injured paw of the operated mice showed increased sensitivity to heat stimulation, while the uninjured paw was unaffected. On day 11, the thermal sensitivity of the injured paw reached a plateau (data not shown).

[0718] On day 11 after surgery, intravenous administration of EE1 antibody did not significantly increase the withdrawal latency of the injured paw on day 12, although an increasing trend was observed. However, starting from day 14, EE1 antibody significantly increased the withdrawal latency ( Figure 13 ).

[0719] At doses of 2.5 and 30 mg / kg, reversal of thermal hypersensitivity was 41±16% and 56±24% (day 12), 51±16% and 98±48% (day 14), and 78±19% and 84±22% (day 18), respectively (Table 33).

[0720] Table 33. Effect of EE1 antibody on CCI-induced thermal hypersensitivity in male C57Bl / 6 mice

[0721]

[0722] The present invention further relates to the following technical solutions:

[0723] 1. An isolated monoclonal antibody or antigen-binding fragment thereof that specifically binds kallidin or des-Arg10-kallidin but not bradykinin or des-Arg9-bradykinin, wherein the antibody or antigen-binding fragment thereof comprises three heavy chain complementarity determining region (CDR) sequences and three light chain CDR sequences selected from the group consisting of:

[0724] (a) SEQ ID NO: 40;

[0725] SEQ ID NO:41;

[0726] SEQ ID NO:42;

[0727] SEQ ID NO:43;

[0728] SEQ ID NO: 17; and

[0729] SEQ ID NO:44;

[0730] (b) SEQ ID NO: 47;

[0731] SEQ ID NO:48;

[0732] SEQ ID NO: 49;

[0733] SEQ ID NO:50;

[0734] SEQ ID NO:51; and

[0735] SEQ ID NO:52; and

[0736] (c) SEQ ID NO: 55;

[0737] SEQ ID NO: 56;

[0738] SEQ ID NO: 57;

[0739] SEQ ID NO: 58;

[0740] SEQ ID NO:59; and

[0741] SEQ ID NO:60.

[0742] 2. An isolated monoclonal antibody or antigen-binding fragment thereof according to claim 1, wherein the antibody or antigen-binding fragment thereof adopts the Pro4 knob conformation of kallikrein (KD) or des-Arg10-kallikrein (DAKD), wherein the Pro4 knob conformation includes a type II tight turn at the proline at position 4.

[0743] 3. The antibody or antigen-binding fragment thereof according to claim 2, wherein the Pro4 knob conformation of the KD or DAKD further comprises an S-shaped amino acid repeat that arranges the hydrophobic side chains of the amino acid chains into a spatial stacking pattern.

[0744] 4. The antibody or antigen-binding fragment thereof according to any preceding claim, conjugated to a diagnostic or therapeutic agent.

[0745] 5. An isolated nucleic acid encoding the amino acid sequence of the antibody or antigen-binding fragment thereof according to any one of the preceding claims.

[0746] 6. A recombinant expression vector comprising the nucleic acid according to item 5.

[0747] 7. A host cell comprising the recombinant expression vector according to item 6.

[0748] 8. A method for producing an antibody or an antigen-binding fragment thereof that specifically binds to kallidin or des-Arg10-kalidin, comprising: culturing the host cell according to item 7 under conditions whereby the host cell produces an antibody that specifically binds to kallidin or des-Arg10-kalidin.

[0749] 9. A pharmaceutical composition comprising the antibody or antigen-binding fragment thereof according to any one of items 1 to 3 and one or more pharmaceutically acceptable carriers.

[0750] 10. The pharmaceutical composition according to item 9, for use in treating a disease or disorder associated with kallidin or des-Arg10-kalidin.

[0751] 11. The pharmaceutical composition of claim 10, wherein the disease or disorder is chronic pain, acute pain or inflammation.

[0752] 12. A method for producing an antibody according to claim 1, comprising: immunizing a non-human animal with an immunogen comprising a peptide, wherein the peptide contains the amino acid sequence shown in SEQ ID No: 11, and wherein the arginine at the amino terminus of the peptide is indirectly coupled to a carrier group via a linker, so that the immune system of the animal produces antibodies that specifically bind to des-Arg9-bradykinin, des-Arg10-kallikrein and des-Arg10-kallikrein-like peptide.

[0753] 13. The method of claim 12, further comprising isolating the antibody from the non-human animal, isolating the nucleic acid encoding the antibody, or isolating immune cells expressing the antibody.

[0754] 14. A method according to item 12, wherein the carrier group is a protein.

[0755] 15. The method of claim 14, wherein the protein is keyhole limpet hemocyanin (KLH).

[0756] 16. The method of claim 15, wherein the linker group comprises: [Gly-Gly-Gly]n, wherein n is at least 1.

[0757] 17. An isolated monoclonal antibody or antigen-binding fragment thereof that specifically binds kallidin or des-Arg10-kalidin but not bradykinin or des-Arg9-bradykinin according to claim 1, wherein the antibody or antigen-binding fragment comprises:

[0758] a) a heavy chain variable region comprising HCDR3, HCDR2, and HCDR1 regions having the amino acid sequences shown in SEQ ID NOs: 40, 41, and 42, respectively; and

[0759] b) a light chain variable region comprising LCDR3, LCDR2 and LCDR1 regions having amino acid sequences as shown in SEQ ID NOs: 43, 17 and 44, respectively.

[0760] 18. An isolated monoclonal antibody or antigen-binding fragment thereof that specifically binds kallidin or des-Arg10-kalidin but not bradykinin or des-Arg9-bradykinin according to claim 1, wherein the antibody or antigen-binding fragment comprises:

[0761] a) a heavy chain variable region comprising HCDR3, HCDR2, and HCDR1 regions having the amino acid sequences shown in SEQ ID NOs: 47, 48, and 49, respectively; and

[0762] b) a light chain variable region comprising LCDR3, LCDR2 and LCDR1 regions having the amino acid sequences shown in SEQ ID NOs: 50, 51 and 52, respectively.

[0763] 19. An isolated monoclonal antibody or antigen-binding fragment thereof that specifically binds kallidin or des-Arg10-kallidin but not bradykinin or des-Arg9-bradykinin according to claim 1, wherein the antibody or antigen-binding fragment comprises:

[0764] a) a heavy chain variable region comprising HCDR3, HCDR2, and HCDR1 regions having the amino acid sequences shown in SEQ ID NOs: 55, 56, and 57, respectively; and

[0765] b) a light chain variable region comprising LCDR3, LCDR2 and LCDR1 regions having the amino acid sequences shown in SEQ ID NOs: 58, 59 and 60, respectively.

[0766] 20. An isolated monoclonal antibody or antigen-binding fragment thereof that specifically binds kallidin or des-Arg10-kalidin but not bradykinin or des-Arg9-bradykinin, wherein the antibody or antigen-binding fragment comprises heavy and light chain variable domains having the amino acid sequences set forth in SEQ ID NOs: 38 and 39, respectively.

[0767] 21. An isolated monoclonal antibody or antigen-binding fragment thereof that specifically binds kallidin or des-Arg10-kallidin but not bradykinin or des-Arg9-bradykinin, wherein the antibody or antigen-binding fragment comprises heavy and light chain variable domains having the amino acid sequences set forth in SEQ ID NOs: 45 and 46, respectively.

[0768] 22. An isolated monoclonal antibody or antigen-binding fragment thereof that specifically binds kallidin or des-Arg10-kalidin but not bradykinin or des-Arg9-bradykinin, wherein the antibody or antigen-binding fragment comprises heavy and light chain variable domains having the amino acid sequences set forth in SEQ ID NOs: 53 and 54, respectively.

[0769] 23. An isolated monoclonal antibody or antigen-binding fragment thereof that specifically binds kallidin or des-Arg10-kalidin but not bradykinin or des-Arg9-bradykinin, wherein the antibody or antigen-binding fragment comprises heavy and light chain variable domains having the amino acid sequences set forth in SEQ ID NOs: 61 and 62, respectively.

[0770] 24. An isolated antibody or antigen-binding fragment thereof, which:

[0771] a) specifically binds to kallidin or des-Arg10-kallidin but not to bradykinin or des-Arg9-bradykinin;

[0772] b) with a value less than 1x10 -10 The KD value of M specifically binds to kallikrein or des-Arg10-kallikrein;

[0773] c) with a value less than 1x10 4 s -1 K off specifically binds to kallikrein or des-Arg10-kallikrein; and / or

[0774] d) It specifically binds to kallidin or des-Arg10-kalidin and inhibits its binding to the bradykinin B1 receptor.

Claims

1. An isolated monoclonal antibody or antigen-binding fragment thereof that specifically binds kallidin or des-Arg10-kallidin but not bradykinin or des-Arg9-bradykinin, wherein the antibody or antigen-binding fragment thereof comprises three heavy chain complementarity determining region (CDR) sequences and three light chain CDR sequences selected from the group consisting of: (a) SEQ ID NO: 40; SEQ ID NO:41; SEQ ID NO:42; SEQ ID NO:43; SEQ ID NO: 17; and SEQ ID NO:44; (b) SEQ ID NO: 47; SEQ ID NO:48; SEQ ID NO: 49; SEQ ID NO:50; SEQ ID NO:51; and SEQ ID NO:52; and (c) SEQ ID NO: 55; SEQ ID NO: 56; SEQ ID NO: 57; SEQ ID NO: 58; SEQ ID NO:59; and SEQ ID NO:

60.

2. The isolated monoclonal antibody or antigen-binding fragment thereof of claim 1, wherein the antibody or antigen-binding fragment thereof adopts the Pro4 knob conformation of kallikrein (KD) or des-Arg10-kallikrein (DAKD), wherein the Pro4 knob conformation includes a type II tight turn at proline 4.

3. The antibody or antigen-binding fragment thereof according to claim 2, wherein the Pro4 knob conformation of the KD or DAKD further comprises an S-shaped amino acid repeat that arranges the hydrophobic side chains of the amino acid chains into a spatial stacking pattern.

4. The antibody or antigen-binding fragment thereof according to any one of the preceding claims, conjugated to a diagnostic or therapeutic agent.

5. An isolated nucleic acid encoding the amino acid sequence of the antibody or antigen-binding fragment thereof according to any one of the preceding claims. A recombinant expression vector comprising the nucleic acid according to claim 5 . A host cell comprising the recombinant expression vector according to claim 6 .

8. A method for producing an antibody or antigen-binding fragment thereof that specifically binds to kallikrein or des-Arg10-kallikrein, comprising: The host cell according to claim 7 is cultured under conditions that allow the host cell to produce an antibody that specifically binds to kallikrein or des-Arg10-kallikrein.

9. A pharmaceutical composition comprising the antibody or antigen-binding fragment thereof according to any one of claims 1 to 3 and one or more pharmaceutically acceptable carriers.

10. The pharmaceutical composition according to claim 9 for use in treating kallikrein or des-Arg10-kallikrein-related diseases or disorders.

Citation Information

Patent Citations

  • Antibodies to bradykinin b1 receptor ligands

    CN113773385A

  • Recombinant antibodies and methods for their production

    EP0239400A2

  • A novel antibody delivery system for biological response modifiers

    EP0396387A2

  • A method for reducing the immunogenicity of antibody variable domains

    EP0519596A1

  • Resurfacing of rodent antibodies

    EP0592106A1