Trichoderma virens strain and application thereof
By screening and applying Trichoderma virens GZUAS831026, the problem of difficulty in using pepper straw and rotting diseases of ginger tubers is solved, rapid degradation of straw and disease prevention and control of diseases is achieved, and crop growth is promoted.
Patent Information
- Application Number
- CN202510418565.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-03
- Publication Date
- 2025-08-08
AI Technical Summary
Chili straw is difficult to directly utilize and part of lignin is slowly decomposed, which affects soil quality and subsequent crop growth. The rotting diseases of ginger tubers seriously affect yield and quality, and there is a lack of effective biological control methods.
Trichoderma virens GZUAS831026 was screened for the preparation of pepper straw degradation agents, growth promoters and ginger tuber rot prevention and control preparations, and straw degradation, promote crop growth and disease prevention and control through its biological enzyme activity and antagonism.
Trichoderma chlorophyces strains showed good cellulase activity and growth-promoting effect, which can effectively degrade pepper straw, promote the growth of corn and rapeseed, and have a significant antibacterial effect compared with Owenzia squirrel, and the effect of preventing and treating ginger tubers rot reached 71.39%.
Smart Images

Figure BDA0005344596560000071 
Figure BDA0005344596560000091 
Figure BDA0005344596560000101
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of microorganisms, and particularly relates to a Trichoderma viride strain and application thereof. Background Art
[0002] Pepper straw, a byproduct of pepper harvesting, is produced annually in enormous quantities. Due to its high cellulose and lignin content, pepper straw is difficult to utilize directly. Traditional methods of burning and discarding it pollute the environment and result in significant resource waste. Returning crop straw to the field is a primary resource-recycling method for crop straw. However, the slow decomposition of the lignin in straw significantly impacts soil quality and subsequent crop growth, making the development of a rapid straw decomposition method particularly important.
[0003] Trichoderma fungi are widely found in nature and are recognized as beneficial bacteria for their health and pollution-free properties, including improving soil conditions, promoting plant growth, and degrading agricultural straw. Trichoderma fungi, such as Trichoderma harzianum, Trichoderma longibrachiatum, and Trichoderma atroviride, can produce enzymes such as cellulase and manganese peroxidase. Some Trichoderma fungi, such as Trichoderma asperellum, Trichoderma brevicompactum, and Trichoderma hamatum, can also produce high levels of IAA.
[0004] Ginger (Zingiber officinale Roscoe) is a perennial herbaceous plant of the Zingiberaceae family and an important economic vegetable crop used for both medicinal and edible purposes. my country is one of the major ginger producers. The repeated occurrence of diseases such as ginger tuber rot has severely impacted ginger yield and quality, causing significant economic losses. Reported pathogens causing ginger tuber rot include Ralstonia solanacearum, Erwinia spp., Bacillus pumilus, Pythium myriotylum, and Fusarium oxysporum. Currently, there is limited research on biological control methods for ginger tuber rot, and Trichoderma viride has not been used in this area.
[0005] To this end, the present invention team screened out a Trichoderma viride strain that can degrade straw, promote growth and have an antagonistic effect on Erwinia bienieri. It can be used to degrade pepper straw and return it to the field, promote the growth of corn and rapeseed, and prevent and control ginger tuber rot. Summary of the Invention
[0006] The present invention aims to provide a Trichoderma virens GZUAS831026 strain.
[0007] Another object of the present invention is to provide the use of Trichoderma virens GZUAS831026 in preparing a pepper straw degrading agent.
[0008] Another object of the present invention is to provide the use of Trichoderma virens GZUAS831026 in the preparation of a growth promoting agent for corn and rapeseed.
[0009] Another object of the present invention is to provide a use of the Trichoderma virens GZUAS831026 strain in preparing a ginger tuber rot prevention and treatment preparation.
[0010] The ginger tuber rot disease of the present invention is caused by Erwinia biewinii.
[0011] The isolation and screening method of the Trichoderma virens GZUAS831026 of the present invention comprises the following steps:
[0012] (1) Collect pepper field soil, weigh 10 g of soil and add it to 90 mL of sterile water, shake it for 15 min, let it stand for 10 min, aspirate the supernatant, spread it on screening medium 1, and culture it at 28°C for 5 days. Pick a single colony and purify it on modified PDA agar medium. Resuspend the purified strain in 25% glycerol solution and store it at -80°C.
[0013] (2) The purified strain was inoculated on screening medium 2, cultured in an inverted manner at 28°C for 2 days, stained with 30 mL of Congo red solution for 20 min, and eluted three times with 30 mL of sodium chloride solution. The colony with the largest transparent zone was selected for sequencing and identification.
[0014] The formula of the screening culture medium 1 of the present invention is: 10 g / L of pepper straw powder, 20 g / L of ammonium chloride, 0.1 g / L of magnesium sulfate, 0.2 g / L of calcium chloride, 0.5 g / L of dipotassium hydrogen phosphate, 0.5 g / L of potassium dihydrogen phosphate, 0.1 g / L of ferrous sulfate, 15 g / L of agar, and natural pH.
[0015] The pepper straw powder described in the screening medium 1 of the present invention is passed through a 60-mesh sieve.
[0016] The formula of the screening culture medium 2 of the present invention is: CMC-Na 10g / L, ammonium sulfate 20g / L, magnesium sulfate 0.1g / L, calcium chloride 0.1g / L, potassium chloride 0.3g / L, dipotassium hydrogen phosphate 0.5g / L, potassium dihydrogen phosphate 0.5g / L, ferrous sulfate 0.1g / L, pH natural.
[0017] The improved PDA agar culture medium of the present invention has the following formula: 20 g / L potato extract powder, 14 g / L glucose, 20 g / L agar, 200 mg / L streptomycin, and natural pH.
[0018] The streptomycin in the improved PDA agar culture medium of the present invention is added after sterilization.
[0019] The concentration of the Congo red solution in step (2) of the present invention is 1 g / L.
[0020] The concentration of the sodium chloride solution in step (2) of the present invention is 58.5 g / L.
[0021] The identification method of the Trichoderma viride strain of the present invention includes morphological identification and molecular biological identification.
[0022] The morphological identification method of the Trichoderma viride strain of the present invention is as follows: the Trichoderma viride strain is inoculated on a PDA agar medium, statically cultured at 28° C. for 5 days, and the morphological characteristics of the colonies are observed.
[0023] The molecular biological identification method of the Trichoderma viride strain of the present invention is as follows: the purified strain is sent to Guangzhou Aiki Biotechnology Co., Ltd. for sequencing, and the obtained sequence is compared on NCBI.
[0024] Compared with the prior art, the present invention has the following beneficial effects:
[0025] 1. The Trichoderma virens GZUAS831026 obtained in the present invention has good biological enzyme activity, with cellulase activity of 2236.1±141.7 U / mL, filter paper enzyme activity of 799.5±28.3 U / mL, manganese peroxidase activity of 79±6.1 U / mL, and lignin degradation rate of 48.5%.
[0026] 2. The green Trichoderma strain Trichoderma virens GZUAS831026 obtained in the present invention has a good pepper straw degradation effect. The degradation test measured that the 20-day degradation rate of pepper straw in the test group was 42.4%, and the degradation rate of pepper straw in the blank control group was 15.1%; the soil covering degradation test measured that the 20-day degradation rate of pepper straw in the test group was 39.3%, and the degradation rate of pepper straw in the blank control group was 10.7%.
[0027] 3. The Trichoderma virens GZUAS831026 obtained in the present invention has a good growth-promoting effect. The IAA content of the fermentation broth of the strain GZUAS831026 was measured to be 46.6±5.9 ug / mL, which has a significant growth-promoting effect on corn and rapeseed plants.
[0028] 4. The Trichoderma virens GZUAS831026 obtained by the present invention has a good preventive effect on ginger tuber rot. The fermentation liquid of strain GZUAS831026 has an inhibition index of 2.11 against the pathogen of ginger tuber rot, Erwinia bieneusi, and the preventive effect on ginger tuber rot reaches 71.39%.
[0029] Preservation information:
[0030] Strain designation: Trichoderma virens GZUAS831026;
[0031] Depository: Guangdong Provincial Microbiological Culture Collection Center (GDMCC);
[0032] Storage address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou;
[0033] Deposit date: October 30, 2024;
[0034] The deposit number is GDMCC No: 65370. BRIEF DESCRIPTION OF THE DRAWINGS
[0035] Figure 1 Colony morphology and spore morphology of Trichoderma virens GZUAS831026 (a is colony morphology; b is spore morphology);
[0036] Figure 2 Phylogenetic tree of Trichoderma virens GZUAS831026;
[0037] Figure 3 Comparison of pepper straw before and after degradation (a is pepper straw before degradation; b is pepper straw after degradation; c is microscopic examination of pepper straw before degradation; d is microscopic examination of pepper straw after degradation);
[0038] Figure 4 Comparison of pepper straw before and after soil degradation (a is pepper straw before soil degradation; b is pepper straw after soil degradation; c is microscopic examination of pepper straw before soil degradation; d is microscopic examination of pepper straw after soil degradation);
[0039] Figure 5Comparison of corn plant growth between the experimental group and the control group (where a is the experimental group and b is the control group);
[0040] Figure 6 Comparison of rapeseed plant growth between the experimental group and the control group (where a is the experimental group and b is the control group);
[0041] Figure 7 Plate confrontation test between strain GZUAS831026 and Erwinia bienieri, the pathogen of ginger tuber rot. DETAILED DESCRIPTION
[0042] The technical solution of the present invention is further described in detail below through specific embodiments.
[0043] Example 1 Application of Trichoderma virens GZUAS831026 in Pepper Straw Degradation
[0044] (1) After the strain GZUAS831026 was cultured in a constant temperature incubator at 28°C for 5 days, the spores were washed with sterile purified water and diluted to 10 8 CFU / mL is reserved.
[0045] (2) Pepper straw was dried at 75°C to constant weight. The spore solution was sprayed on the pepper straw and inoculated with an equal amount of sterile purified water as a blank control. Each treatment was repeated three times. Solid fermentation was carried out in a constant temperature incubator at 28°C for 20 days. The morphological changes of the pepper straw were regularly observed. White hyphae began to appear on the surface of the pepper straw 3 days after inoculation, and green hyphae appeared 7 days later. No significant changes were observed in the control group.
[0046] (3) After 20 days of fermentation, each treatment was removed, the mycelium on the surface of the pepper straw was washed, and the pepper straw was dried at 75°C to a constant weight. The weight of the pepper straw was weighed and the relative weight loss was calculated.
[0047] Example 2 Application of Trichoderma virens GZUAS831026 in Promoting Rapeseed Growth
[0048] (1) Strain GZUAS831026 was inoculated into PDA liquid medium and cultured in a shake flask at 28°C and 180 rpm for 3 days. The culture medium was centrifuged at 10,000 r / min at 4°C for 10 min. The supernatant was the fermentation broth. The fermentation broth was diluted 100-fold with sterile purified water before use.
[0049] (2) Select plump, uniform-sized rapeseed seeds free of pests and diseases. Soak them in 1% sodium hypochlorite solution for 10 seconds, rinse with sterile purified water 3-4 times, and blot dry. Spread four layers of sterile gauze on a petri dish, place the seeds on the gauze, spray with sterile purified water in the dark (12 hours) at 26°C to accelerate germination. After germination, select seedlings that are growing well and uniformly for transplanting.
[0050] (3) The experiment set up an experimental group and a control group, with 3 replicates in each group and 30 seedlings in each replicate. Each seedling was irrigated with 20 mL of diluted fermentation liquid and sprayed with foliar fertilizer once every 5 days, based on the water dripping from the leaves. An equal amount of sterile purified water was used as the control group. The growth of the plants was observed and the growth indicators of the plants at 20 days were measured.
[0051] Example 3 Application of Trichoderma virens GZUAS831026 in Promoting Corn Growth
[0052] (1) Strain GZUAS831026 was inoculated into PDA liquid medium and cultured in a shake flask at 28°C and 180 rpm for 3 days. The culture medium was centrifuged at 10,000 r / min at 4°C for 10 min. The supernatant was the fermentation broth. The fermentation broth was diluted 100-fold with sterile purified water before use.
[0053] (2) Select plump, uniform-sized, pest-free corn seeds, soak them in 1% sodium hypochlorite solution for 10 seconds, rinse them 3-4 times with sterile purified water, and blot dry. Spread four layers of sterile gauze on a petri dish, place the seeds on the gauze, spray them with sterile purified water in the dark (12 hours), and germinate them at 26°C. After germination, select seedlings that are growing well and uniformly for transplanting.
[0054] (3) The experiment set up an experimental group and a control group, with 3 replicates in each group and 30 seedlings in each replicate. Each seedling was irrigated with 20 mL of diluted fermentation liquid and sprayed with foliar fertilizer once every 5 days, based on the water dripping from the leaves. An equal amount of sterile purified water was used as the control group. The growth of the plants was observed and the growth indicators of the plants at 20 days were measured.
[0055] Example 4 Application of Trichoderma virens GZUAS831026 in the prevention and treatment of ginger tuber rot
[0056] (1) Strain GZUAS831026 was inoculated into PDA liquid medium and cultured in a shake flask at 28°C and 180 rpm / min for 3 days. The culture medium was centrifuged at 10,000 r at 4°C for 10 min. The supernatant was the fermentation broth, which was diluted 100-fold with sterile purified water before use.
[0057] (2) Dilute the pathogen of ginger tuber rot, Erwinia billingiae, to 1×10 8 CFU / mL, mix it evenly with nutrient soil at a volume ratio of 1:10, select healthy ginger seeds that have been germinated, disinfect the surface of the ginger seeds with an alcohol cotton ball, break the ginger to create wounds, and bury them in nutrient soil mixed with pathogens.
[0058] (3) Each ginger plant was irrigated with 60 mL of the diluted fermentation liquid of the strain GZUAS831026, and the same volume of sterile water was used as the control group.
[0059] (4) Three ginger plants were treated in each treatment, with three replicates. The disease index and control effect were calculated after 20 days.
[0060] (5) The grading standards for the ginger tuber rot disease index are as follows:
[0061] Level 1: no disease or almost no disease, representing a value of 0;
[0062] Level 2: The soft rot portion is less than 25%, representing a value of 1;
[0063] Level 3: Soft rot accounts for 25%-50%, representative value 2;
[0064] Level 4: The soft rot area is greater than 50%, representing a value of 3.
[0065] (6) The calculation formulas for morbidity, disease index and prevention and treatment effect are as follows:
[0066] Incidence rate (%) = (number of diseased plants / total number of plants) × 100;
[0067] Disease index = 100 × ∑ (number of plants at each disease level × representative value of each level) / (total number of plants surveyed × highest representative value);
[0068] The control effect (%) = 100 × (disease index of the control group - disease index of the treatment group) / disease index of the control group.
[0069] Example 5 Screening Medium 1
[0070] The formulation of screening medium 1 is: chili straw powder 10 g / L, ammonium chloride 20 g / L, magnesium sulfate 0.1 g / L, calcium chloride 0.2 g / L, dipotassium hydrogen phosphate 0.5 g / L, potassium dihydrogen phosphate 0.5 g / L, ferrous sulfate 0.1 g / L, agar 15 g / L, pH natural. Chili straw powder was sieved through a 60-mesh sieve.
[0071] Example 6 Screening Medium 2
[0072] The formula of screening medium 2 is: CMC-Na 10 g / L, ammonium sulfate 20 g / L, magnesium sulfate 0.1 g / L, calcium chloride 0.1 g / L, potassium chloride 0.3 g / L, dipotassium hydrogen phosphate 0.5 g / L, potassium dihydrogen phosphate 0.5 g / L, ferrous sulfate 0.1 g / L, pH natural.
[0073] Example 7 Improved PDA agar medium
[0074] The formula of the improved PDA agar medium is: potato extract powder 20g / L, glucose 14g / L, agar 20g / L, streptomycin 200mg / L (added after streptomycin is sterilized), and natural pH.
[0075] The culture medium of Examples 5-7 was applied to the separation and screening method of Example 8
[0076] Example 8 Isolation and Screening Method of Trichoderma virens GZUAS831026
[0077] (1) Collect pepper field soil, weigh 10 g of soil and add it to 90 mL of sterile water, shake it for 15 min, let it stand for 10 min, aspirate the supernatant, spread it on screening medium 1, and culture it at 28°C for 5 days. Pick a single colony and purify it on modified PDA agar medium. Resuspend the purified strain in 25% glycerol solution and store it at -80°C.
[0078] (2) The purified strain was inoculated on screening medium 2 and inverted for 2 days at 28°C. The strain was stained with 30 mL of 1 g / L Congo red solution for 20 min and eluted three times with 30 mL of 58.5 g / L sodium chloride solution. The colony with the largest transparent zone was selected for sequencing and identification.
[0079] Example 9 Identification Method of Trichoderma virens GZUAS831026
[0080] (1) Morphological identification
[0081] Trichoderma viride was inoculated on PDA agar medium and cultured at 28°C for 7 days. The colonies were green or yellow-green in the early stage and dark green in the later stage. The colony surface was felt-like. The spores were oval or ovate, 3.2-4.5×4.3-4.9um. The hyphae were septate, 3.1-5.9um in diameter, and had opposite branches on the side branches.
[0082] (2) Molecular biological identification
[0083] The purified strain was sent to Guangzhou Aiki Biotechnology Co., Ltd. for sequencing. The resulting sequence was uploaded to the NCBI database. BLAST comparison revealed 100% similarity between strain GZUAS831026 and Trichoderma virens. A phylogenetic tree of strain GZUAS831026 constructed using MEGAX software revealed that strain GZUAS831026 and MK841029.1 were located on the same branch. Based on its morphological characteristics and ITS sequence alignment, strain GZUAS831026 was identified as Trichoderma virens.
[0084] In order to verify the effectiveness of the present invention, the invention team conducted a series of experiments, as follows:
[0085] 1. Isolation and Screening Method of Trichoderma virens GZUAS831026
[0086] 1.1 Culture medium preparation
[0087] The formulation of screening medium 1 is: chili straw powder 10 g / L, ammonium chloride 20 g / L, magnesium sulfate 0.1 g / L, calcium chloride 0.2 g / L, dipotassium hydrogen phosphate 0.5 g / L, potassium dihydrogen phosphate 0.5 g / L, ferrous sulfate 0.1 g / L, agar 15 g / L, pH natural. Chili straw powder was sieved through a 60-mesh sieve.
[0088] The formula of screening medium 2 is: CMC-Na 10 g / L, ammonium sulfate 20 g / L, magnesium sulfate 0.1 g / L, calcium chloride 0.1 g / L, potassium chloride 0.3 g / L, dipotassium hydrogen phosphate 0.5 g / L, potassium dihydrogen phosphate 0.5 g / L, ferrous sulfate 0.1 g / L, pH natural.
[0089] The formula of the improved PDA agar medium is: potato extract powder 20g / L, glucose 14g / L, agar 20g / L, streptomycin 200mg / L (added after streptomycin is sterilized), and natural pH.
[0090] 1.2 Separation and screening methods
[0091] (1) Collect pepper field soil, weigh 10 g of soil and add it to 90 mL of sterile water, shake it for 15 min, let it stand for 10 min, aspirate the supernatant, spread it on screening medium 1, and culture it at 28°C for 5 days. Pick a single colony and purify it on modified PDA agar medium. Resuspend the purified strain in 25% glycerol solution and store it at -80°C.
[0092] (2) The purified strain was inoculated on screening medium 2 and inverted for 2 days at 28°C. The strain was stained with 30 mL of 1 g / L Congo red solution for 20 min and eluted three times with 30 mL of 58.5 g / L sodium chloride solution. The colony with the largest clear zone was selected for sequencing and identification and named GZUAS831026.
[0093] 2. Identification of Trichoderma virens GZUAS831026
[0094] (1) Morphological identification
[0095] Inoculate Trichoderma viride on PDA agar medium and incubate at 28°C for 7 days. The colony is green or yellow-green in the early stage and dark green in the later stage. The surface of the colony is felt-like. The spores are oval or ovate, 3.2-4.5×4.3-4.9um. The hyphae are septate, 3.1-5.9um in diameter, and opposite branches on the side branches. The morphology of Trichoderma viride colonies and spores can be seen in the following table: Figure 1 .
[0096] (2) Molecular biological identification
[0097] The purified strain was sent to Guangzhou Aiji Biotechnology Co., Ltd. for sequencing. The obtained ITS rRNA gene sequence was uploaded to the NCBI database. The BLAST comparison results are shown in Table 1. The similarity between strain GZUAS831026 and Trichoderma virens was 100%. The phylogenetic tree of strain GZUAS831026 was constructed using MEGAX software (see Table 1). Figure 2 ), strain GZUAS831026 was found to be in the same branch as MK841029.1. Based on the morphological characteristics of strain GZUAS831026 and the results of ITS sequence comparison, strain GZUAS831026 was identified as Trichoderma virens.
[0098] Table 1 BLAST alignment results of strain GZUAS831026 gene sequence
[0099]
[0100] 3. Study on the degradation of pepper straw by Trichoderma virens GZUAS831026
[0101] 3.1 Determination of enzyme activity of strain GZUAS831026
[0102] (1) The strain GZUAS831026 was inoculated into PDA liquid culture medium and cultured at 28°C with shaking at 180 rpm for 4 days.
[0103] (2) Centrifuge the culture medium at 10,000 r / min at 4°C for 10 min. The supernatant is the crude enzyme solution.
[0104] (3) The DNS method was used to determine the activities of cellulase and filter paper enzyme. The cellulase activity was 2236.1±141.7 U / mL, and the filter paper enzyme activity was 799.5±28.3 U / mL.
[0105] (4) The manganese peroxidase activity was determined using a kit, and the manganese peroxidase activity was 79±6.1 U / mL.
[0106] (5) The lignin degradation rate was determined to be 48.5%.
[0107] 3.2 Pepper straw degradation test using strain GZUAS831026
[0108] (1) After the strain GZUAS831026 was cultured in a constant temperature incubator at 28°C for 5 days, the spores were washed with sterile purified water and diluted to 10 8 CFU / mL is reserved.
[0109] (2) Pepper straw was dried at 75°C to constant weight. The spore solution was sprayed on the pepper straw and inoculated with an equal amount of sterile purified water as a blank control. Each treatment was repeated three times. Solid fermentation was carried out in a constant temperature incubator at 28°C for 20 days. The morphological changes of the pepper straw were regularly observed. White hyphae began to appear on the surface of the pepper straw 3 days after inoculation, and green hyphae appeared 7 days later. No significant changes were observed in the control group.
[0110] (3) After 20 days of fermentation, each treatment was removed, the mycelium on the surface of the pepper straw was washed, and the pepper straw was dried at 75°C to a constant weight. The weight of the pepper straw was weighed and the relative weight loss was calculated.
[0111] (4) After 20 days, the surface of pepper straw was covered with dark green hyphae and softened. The degradation rate of pepper straw in the test group was 42.4% after 20 days, while the degradation rate of pepper straw in the blank control group was 15.1%. Figure 3 shown.
[0112] 3.3 Pepper straw degradation test using strain GZUAS831026 in soil covering
[0113] (1) After the strain GZUAS831026 was cultured in a constant temperature incubator at 28°C for 5 days, the spores were washed with sterile purified water and diluted to 10 8 CFU / mL is reserved.
[0114] (2) Pepper straw was dried at 75℃ to constant weight, cut into 5cm small sections, and placed in nylon bags. The spore solution was sprayed on the pepper straw until the straw was thoroughly moistened. Three replicates were applied for each treatment. The straw was placed in a pot and covered with 10cm of soil. An equal amount of sterile purified water was inoculated as a blank control. After 20 days, the mycelium on the surface of the pepper straw was washed off and dried at 75℃ to constant weight. The pepper straw was weighed and the relative weight loss was calculated.
[0115] (3) The degradation rate of pepper straw in the test group was 39.3% after 20 days, while that in the blank control group was 10.7%. Figure 4 shown.
[0116] 4. Study on the growth-promoting effect of Trichoderma virens GZUAS831026
[0117] 4.1 Determination of IAA content in strain GZUAS831026
[0118] The strain GZUAS831026 was inoculated into liquid PDA medium and cultured in a shaking flask at 28°C and 180 rpm / min for 3 days. The culture medium was centrifuged at 10,000 r at 4°C for 10 min, and the supernatant was used as the test solution.
[0119] The method for determining the IAA content is as follows:
[0120] (1) Salkowski reagent: 0.5 mol / L FeCl3 (1.5 mL) + concentrated sulfuric acid (30 mL) + distilled water (50 mL). Mix well before use and store in a dark place.
[0121] (2) Prepare IAA standard solution: Weigh 10 mg of IAA, dissolve it in a small amount of ethanol, and then dilute to 100 mL with distilled water (concentration: 100 μg / mL).
[0122] (3) Take 8 test tubes and add 2 mL of IAA solution with a concentration gradient of 0, 5.0, 10.0, 15.0, 20.0, and 25.0 μg / mL in sequence. Add 8 mL of Salkowski reagent to each tube and mix well. React in the dark for 30 min. Measure the absorbance on a spectrophotometer with a wavelength set at 530 nm.
[0123] (4) Draw an IAA standard curve with IAA concentration as the horizontal axis and absorbance value as the vertical axis.
[0124] (5) Take 1 mL of the test solution and add 9 mL of Salkowski reagent, mix well, and react in the dark for 30 min. Repeat 3 times for each group, using purified water as the control.
[0125] (6) Measure the absorbance value on a spectrophotometer with the wavelength set at 530 nm and measure OD530.
[0126] (7) The IAA content was determined to be 46.6±5.9ug / mL.
[0127] 4.2 Effect of strain GZUAS831026 on corn growth promotion
[0128] (1) Strain GZUAS831026 was inoculated into PDA liquid medium and cultured in a shake flask at 28°C and 180 rpm for 3 days. The culture medium was centrifuged at 10,000 r / min at 4°C for 10 min. The supernatant was the fermentation broth. The fermentation broth was diluted 100-fold with sterile purified water before use.
[0129] (2) Select plump, uniform-sized, pest-free corn seeds, soak them in 1% sodium hypochlorite solution for 10 seconds, rinse them 3-4 times with sterile purified water, and blot dry. Spread four layers of sterile gauze on a petri dish, place the seeds on the gauze, spray them with sterile purified water in the dark (12 hours), and germinate them at 26°C. After germination, select seedlings that are growing well and uniformly for transplanting.
[0130] (3) The experiment set up an experimental group and a control group, with three replicates per group and 30 seedlings per replicate. Each seedling was irrigated with 20 mL of diluted fermentation liquid and sprayed with foliar fertilizer once every 5 days, based on the amount of water dripping from the leaves. An equal amount of sterile purified water served as the control group. Plant growth was observed and growth indicators were measured at 20 days. The results are shown in Table 2.
[0131] Table 2 Results of the growth-promoting effect of the fermentation liquid of strain GZUAS831026 on corn plants
[0132]
[0133] As shown in Table 2, the fermentation liquid of strain GZUAS831026 has a significant growth-promoting effect on corn plants. Figure 5 .
[0134] 4.3 Effect of strain GZUAS831026 on rapeseed growth promotion
[0135] (1) Strain GZUAS831026 was inoculated into PDA liquid medium and cultured in a shake flask at 28°C and 180 rpm for 3 days. The culture medium was centrifuged at 10,000 r / min at 4°C for 10 min. The supernatant was the fermentation broth. The fermentation broth was diluted 100-fold with sterile purified water before use.
[0136] (2) Select plump, uniform-sized rapeseed seeds free of pests and diseases. Soak them in 1% sodium hypochlorite solution for 10 seconds, rinse with sterile purified water 3-4 times, and blot dry. Spread four layers of sterile gauze on a petri dish, place the seeds on the gauze, spray with sterile purified water in the dark (12 hours) at 26°C to accelerate germination. After germination, select seedlings that are growing well and uniformly for transplanting.
[0137] (3) The experiment set up an experimental group and a control group, with three replicates per group and 30 seedlings per replicate. Each seedling was irrigated with 20 mL of diluted fermentation liquid and sprayed with foliar fertilizer once every 5 days, based on the amount of water dripping from the leaves. An equal amount of sterile purified water served as the control group. Plant growth was observed and growth indicators were measured at 20 days. The results are shown in Table 3.
[0138] Table 3 Results of the growth-promoting effect of the fermentation liquid of strain GZUAS831026 on rapeseed plants
[0139]
[0140] As shown in Table 3, the fermentation liquid of strain GZUAS831026 has a significant growth-promoting effect on rapeseed plants. Figure 6 .
[0141] 5. Study on the anti-ginger tuber rot effect of Trichoderma virens GZUAS831026
[0142] 5.1 Antagonistic test between strain GZUAS831026 and Erwinia billingiae, the pathogen causing ginger tuber rot
[0143] (1) Strain GZUAS831026 was inoculated into PDA liquid medium and cultured in a shake flask at 28°C and 180 rpm / min for 3 days. The culture medium was centrifuged at 10,000 r at 4°C for 10 min, and the supernatant was the fermentation broth.
[0144] (2) Streak the pathogenic bacteria Erwinia bienieri on LB agar medium and activate it in a 28°C incubator for 36 hours. 6 CFU / mL of bacterial suspension.
[0145] (3) Prepare LB solid culture medium. After sterilization, when the culture medium cools to 50°C, add 25 μL of bacterial suspension to every 50 mL of culture medium, mix well, and let it stand to solidify.
[0146] (4) After the culture medium solidifies, use a cork punch to punch a hole in the center of the culture medium. Inject 100 μL of fermentation liquid into the hole. After the fermentation liquid is completely absorbed, place the culture medium in a constant temperature incubator at 28°C for 24 h. Observe the test results and calculate the inhibition index. The calculation formula is as follows: Inhibition index = (diameter of inhibition zone - diameter of hole) / diameter of inhibition zone.
[0147] (5) The results are as follows Figure 7 As shown, the inhibitory index of strain GZUAS831026 against the pathogen Erwinia bieneusi was 2.11.
[0148] 5.2 Application of strain GZUAS831026 to control ginger tuber rot
[0149] (1) Strain GZUAS831026 was inoculated into PDA liquid medium and cultured in a shake flask at 28°C and 180 rpm / min for 3 days. The culture medium was centrifuged at 10,000 r at 4°C for 10 min. The supernatant was the fermentation broth, which was diluted 100-fold with sterile purified water before use.
[0150] (2) Dilute the pathogen of ginger tuber rot, Erwinia billingiae, to 1×10 8 CFU / mL, mix it evenly with nutrient soil at a volume ratio of 1:10, select healthy ginger seeds that have been germinated, disinfect the surface of the ginger seeds with an alcohol cotton ball, break the ginger to create wounds, and bury them in nutrient soil mixed with pathogens.
[0151] (3) Each ginger plant was irrigated with 60 mL of the diluted fermentation liquid of the strain GZUAS831026, and the same volume of sterile water was used as the control group.
[0152] (4) Three ginger plants were treated in each treatment, with three replicates. The disease index and control effect were calculated after 20 days.
[0153] (5) The grading standards for the ginger tuber rot disease index are as follows:
[0154] Level 1: no disease or almost no disease, representing a value of 0;
[0155] Level 2: The soft rot portion is less than 25%, representing a value of 1;
[0156] Level 3: Soft rot accounts for 25%-50%, representative value 2;
[0157] Level 4: The soft rot area is greater than 50%, representing a value of 3.
[0158] (6) The calculation formulas for morbidity, disease index and prevention and treatment effect are as follows:
[0159] Incidence rate (%) = (number of diseased plants / total number of plants) × 100;
[0160] Disease index = 100 × ∑ (number of plants at each disease level × representative value of each level) / (total number of plants surveyed × highest representative value);
[0161] The control effect (%) = 100 × (disease index of the control group - disease index of the treatment group) / disease index of the control group.
[0162] (7) As shown in Table 4, the incidence rate and disease index of the potted fruit test group were significantly lower than those of the control group, and the prevention efficiency was 71.39%.
[0163] Table 4 Results of the control effect of strain GZUAS831026 on ginger tuber rot
[0164]
[0165] 6. ITS rRNA gene sequence of Trichoderma virens GZUAS831026
[0166] CGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGATCTCTGCCCCGGGTGCGTCGCAGCCCCGGACCAAGGCGCCCGCCGGAGGACCAACCAAAACTCTTATTGTATA CCCCCTCGCGGGTTTTTTACTATCTGAGCCATCTCGGCGCCCCTCGTGGGCGTTTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAG AATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGCCCTTTACGGGGCCGGCCCCGAAAT ACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACACTCGCATCGGGAGCGCGGCGCGTCCACAGCCGTTAAACACCCCAAACTTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATA
[0167] Although the present invention has been described in detail above using general explanations, specific embodiments, and experiments, it will be apparent to those skilled in the art that modifications and improvements may be made based on the present invention. Therefore, such modifications and improvements, which do not depart from the spirit of the present invention, are intended to be within the scope of protection claimed herein.
Claims
1. A Trichoderma virens strain GZUAS831026, characterized in that: The Trichoderma virens strain GZUAS831026 is deposited in Guangdong Provincial Microbiological Culture Collection Center with a deposit number of GDMCC No: 65370.
2. The use of Trichoderma virens GZUAS831026 according to claim 1, characterized in that: The invention relates to an application of the Trichoderma virens strain GZUAS831026 in preparing a pepper straw degrading agent.
3. The use of Trichoderma virens GZUAS831026 according to claim 1, characterized in that: The invention relates to an application of the Trichoderma virens strain GZUAS831026 in the preparation of a growth promoting agent for corn and rapeseed.
4. The use of Trichoderma virens GZUAS831026 according to claim 1, characterized in that The invention relates to an application of the Trichoderma virens strain GZUAS831026 in preparing a ginger tuber rot prevention and treatment preparation.
5. The use of Trichoderma virens GZUAS831026 according to claim 4, characterized in that: The ginger tuber rot disease is caused by Erwinia biewinii.
Citation Information
Patent Citations
Trichoderma viride strain, and applications thereof
CN105647813A
Microorganism bacterium agent for preventing and treating ginger basal stem rot and preparation method and application thereof
CN107212021A
Ginger endophytic Trichoderma viride and application thereof
CN109971656A
Trichoderma atroviride Ta102, multifunctional organic fertilizer and application thereof
CN115820433A
Trichoderma aureoviride strain, trichoderma aureoviride agent and preparation method and application thereof
CN118460383A
Cited By
Trichoderma strain JLAU-2156 and application thereof in promoting plant growth
CN121203827A