Foot and mouth disease virus recombinant strain with heat-resistant characteristic as well as preparation method and application of foot and mouth disease virus recombinant strain

Abstract

The invention discloses a foot-and-mouth disease virus recombinant strain with a heat-resistant characteristic as well as a preparation method and application of the foot-and-mouth disease virus recombinant strain. The recombinant strain is obtained by rescuing foot-and-mouth disease virus infectious cDNA containing mutation sites through a reverse genetic technology, and the foot-and-mouth disease virus infectious cDNA containing mutation sites is obtained by mutating 4863rd nucleotide A into C through site-specific mutagenesis on the basis of a sequence shown in SEQ ID NO.1. The invention further discloses a preparation method of the foot-and-mouth disease virus infectious cDNA containing mutation sites. Experiments prove that compared with an original strain, the recombinant strain has higher heat resistance, the capsid complete splitting temperature of the recombinant strain is higher than that of the original strain, and after heat treatment, the proportion of complete virus particles of the recombinant strain is obviously higher than that of the original strain. Moreover, compared with an original strain, the recombinant strain shows better immunogenicity in a mouse body after being subjected to heat treatment at 37 DEG C. Therefore, the recombinant strain has an important application prospect in vaccine preparation, and a new technical means is provided for improving the heat stability of the vaccine and optimizing the foot-and-mouth disease prevention and control technology.

Description

Technical Field

[0001] The present invention relates to a recombinant strain of foot-and-mouth disease virus with heat resistance, a preparation method thereof and an application thereof. The present invention belongs to the field of medical technology. Background Art

[0002] Foot-and-mouth disease virus (FMDV) belongs to the Picornaviridae family and has a positive-sense, single-stranded RNA genome. Due to its simple structure and robust mutation capacity, FMDV persists worldwide for a long time and exhibits a high degree of genetic diversity. Foot-and-mouth disease (FMD) is a highly contagious disease with diverse transmission pathways, including direct contact, airborne transmission, contaminated feed or water, and mechanical vectors carrying the virus. The disease infects a wide range of species, with nearly all even-toed ungulates potentially becoming susceptible hosts. Livestock such as cattle, sheep, and pigs, which are important in the livestock industry, are particularly susceptible to outbreaks. Once an outbreak occurs, animals develop typical symptoms such as blisters and ulcers in the mouth and hooves, leading to a range of clinical manifestations, including loss of appetite, motor impairment, and decreased milk production. Severe infections can even cause the death of young animals.

[0003] The rapid spread and high infection rate of foot-and-mouth disease have had multiple negative impacts on the livestock industry. First, due to the impaired health of animals, production efficiency has dropped significantly, including a reduction in the output of animal products such as milk and meat. Second, animal products from infected areas may be restricted from entering domestic or international markets, resulting in trade restrictions and economic losses. In addition, in order to control the epidemic, farms and governments need to invest a lot of money in epidemic prevention measures such as vaccination, quarantine and culling, which further increases the economic burden. Therefore, foot-and-mouth disease not only affects the economic benefits of farms, but also has a significant impact on the regional and even global animal product supply chain.

[0004] In view of the serious harm caused by foot-and-mouth disease and the limitations of existing prevention and control measures, current research focuses on the development and improvement of foot-and-mouth disease vaccines. Although traditional inactivated vaccines are one of the main means of epidemic prevention, the foot-and-mouth disease virus itself has poor stability in the environment and is particularly susceptible to environmental factors such as temperature, which leads to the lysis of its virus particles, thereby weakening the immunogenicity of the vaccine. This low stability not only reduces the effectiveness of the vaccine in inducing an immune response in the body, but also limits the application of the vaccine in large-scale production and promotion. Therefore, based on the temperature requirements of the foot-and-mouth disease inactivated vaccine during preparation and storage, researchers are committed to solving the stability problems of the virus and related vaccines, and developing new vaccines that are more stable to the environment and have longer-lasting immune effects, thereby increasing the wide application and economic benefits of the vaccine. Summary of the Invention

[0005] One of the purposes of the present invention is to provide a recombinant strain of foot-and-mouth disease virus with heat-resistant properties.

[0006] The second object of the present invention is to provide a method for preparing the recombinant strain of foot-and-mouth disease virus with heat-resistant properties.

[0007] The third object of the present invention is to provide the application of the recombinant strain of foot-and-mouth disease virus with heat-resistant properties in the prevention and control of foot-and-mouth disease.

[0008] In order to achieve the above object, the present invention adopts the following technical means:

[0009] The present invention uses wild-type O foot-and-mouth disease virus (WT) as a basis, and screens for mutant virus strains with significant heat resistance by repeatedly passage-adapting the virus in an environment treated with the heat shock protein 60 (HSP60) inhibitor Mizoribine. Viral titer testing revealed that after passage of the virus in a cell environment treated with the HSP60 inhibitor Mizoribine, the viral titer initially decreased and then increased. After the viral titer returned to the level of the wild-type strain, key amino acid sites in the virus selected for resistance to the HSP60 inhibitor were further identified.

[0010] To confirm the significant impact of mutation sites on heat resistance, we systematically analyzed key mutation sites using reverse genetic manipulation. Recombinant virus strains with various amino acid mutation sites were constructed. Resistance to HSP60 inhibitors in the rescued point mutation strains was verified using plaque reduction assays, one-step growth curves, and viral structural protein levels. Subsequently, the thermostability of the mutant strains was verified using viral TCID50 assays, PaSTRY assays, and ELISA methods. The results showed that the T171P-VP1 strain was resistant to HSP60 inhibitors.

[0011] In the immune protection trial, mice were evaluated for immune responses using an inactivated vaccine prepared with the T171P-VP1 strain. The results showed that after heat treatment, the T171P-VP1 vaccine group had significantly higher levels of specific and neutralizing antibodies than the WT vaccine group. A comparative analysis of their survival rates under high-temperature conditions was also conducted. The results indicate that the T171P-VP1 strain possesses greater heat resistance and provides superior immune protection compared to the non-mutated strain.

[0012] Based on the above research, the present invention proposes a recombinant strain of foot-and-mouth disease virus with heat-resistant properties. The recombinant strain is obtained by rescuing an infectious cDNA expression plasmid of foot-and-mouth disease virus containing a mutation site through reverse genetic technology, wherein the infectious cDNA expression plasmid of foot-and-mouth disease virus containing a mutation site is obtained by mutating the 4863rd nucleotide A to C through site-directed mutagenesis based on the sequence shown in SEQ ID NO.1.

[0013] Among them, preferably, the foot-and-mouth disease virus infectious cDNA expression plasmid containing the mutation site is transfected into the BHK-21 cell line expressing the T7 polymerase gene to obtain the rescued foot-and-mouth disease virus recombinant strain with heat-resistant properties.

[0014] Furthermore, the present invention also proposes a method for obtaining the recombinant strain, comprising the following steps:

[0015] (1) Synthesis of template plasmid

[0016] A full-length FMDV plasmid for reverse genetics manipulation was designed based on the nucleic acid sequence of the wild-type strain of foot-and-mouth disease virus type O. The pcDNA3.1(+) vector was used as the backbone, a hammerhead ribozyme cDNA sequence was added to the 5' end, a synonymous mutation was introduced at the G9052 site of the viral 3D nucleic acid sequence to add a Stu I restriction enzyme site, and a T7 terminator sequence was added to the 3' end. The full-length FMDV plasmid was synthesized and named pCFMDV. The nucleotide sequence is shown in SEQ ID NO. 1.

[0017] (2) Construction of intermediate plasmid

[0018] The target intermediate sequence was obtained by PCR amplification using the full-length FMDV plasmid pCFMDV as a template. The primer sequences used are as follows:

[0019] nZJT-3-F: GCAGATATCCAACTGGAGAACATTACTGGTTT;

[0020] nZJT-3-R:ATAAGAATGCGGCCGCCGGCGTTCACCCAACGCAG;

[0021] Then, the amplified intermediate sequence was inserted into the pcDNA3.1 vector using the EcoR V and Not I restriction sites to obtain an intermediate plasmid named pZJT;

[0022] (3) Introduction of mutation sites

[0023] Using site-directed mutagenesis, the intermediate plasmid pZJT was used as a template. PCR amplification with primers VP1-T171P-F / R introduced the mutation site T171P. After Dpn I digestion, the product was transformed into competent bacteria. After screening and sequencing confirmation, an intermediate plasmid containing the mutation site was obtained and named pZJT-T171P. The primer sequences used are as follows:

[0024] VP1-T171P-F: AACTACGGTGCCATCAAAGCCCCTCGGGTGACAGAACTGCTGT;

[0025] VP1-T171P-R:ACAGCAGTTCTGTCACCCGAGGGGCTTTGATGGCACCGTAGTT;

[0026] (4) Construction of full-length mutant plasmid

[0027] The intermediate plasmid pZJT-T171P containing the mutation site was back-ligated into the full-length FMDV plasmid pCFMDV using seamless cloning technology. The specific steps were as follows: specific primers MU-INFUSION-F / R were designed for both ends of the BsiWI and StuI restriction sites on the intermediate plasmid to amplify the intermediate sequence containing the mutation; the full-length FMDV plasmid pCFMDV was digested with BsiWI I and Stu I, the vector fragment was isolated and recovered, and the intermediate sequence containing the mutation was ligated with the pCFMDV vector fragment obtained by restriction digestion by seamless cloning to construct the full-length FMDV plasmid containing the mutation site, which was named pT171P. The primer sequences used are as follows:

[0028] MU-INFUSION-F:GTGCTGGTCTTTGTCCCGTACGATCAAGAACCAC;

[0029] MU-INFUSION-R:GTCCAGAGTGGACGGCGAGGCCTGCCACGGAG;

[0030] (5) Rescue of heat-resistant recombinant strains of foot-and-mouth disease virus

[0031] The full-length FMDV plasmid pT171P containing the mutation site was transfected into the BHK-21 cell line expressing the T7 polymerase gene to obtain a rescued heat-resistant recombinant FMDV strain named T171P-VP1.

[0032] Preferably, the mutation site in step (3) is located at position 4863 of the sequence shown in SEQ ID NO. 1, and the nucleotide A at position 4863 is mutated to C by PCR amplification using primers VP1-T171P-F / R.

[0033] Preferably, in step (4), the intermediate plasmid pZJT-T171P containing the mutation site is ligated with the pCFMDV vector fragment obtained by enzyme digestion at a molar ratio of 3:1.

[0034] Among them, preferably, in step (4), the plasmid pT171P is an infectious cDNA expression plasmid for foot-and-mouth disease virus containing a mutation site, and its nucleotide sequence is obtained by mutating the 4863rd nucleotide A to C through site-directed mutagenesis based on the sequence shown in SEQ ID NO.1.

[0035] Preferably, the transfection in step (5) is performed by liposome transfection.

[0036] Furthermore, the present invention also proposes the use of the recombinant foot-and-mouth disease virus strain with heat resistance in the preparation of an inactivated foot-and-mouth disease vaccine.

[0037] Furthermore, the present invention also proposes a heat-resistant foot-and-mouth disease inactivated vaccine, which is prepared from the recombinant foot-and-mouth disease virus strain with heat-resistant properties and an adjuvant.

[0038] Compared with the prior art, the present invention has the following beneficial effects:

[0039] The present invention provides a recombinant strain of foot-and-mouth disease virus with heat-resistant properties constructed through a reverse genetic system, named T171P-VP1. Experimental results show that the temperature for complete lysis of the capsid of the T171P-VP1 strain is higher than that of the original strain. After heat treatment, the proportion of intact virus particles is significantly higher than that of the wild-type strain, further verifying its heat-resistant properties. Moreover, compared with the original strain, the T171P-VP1 strain showed better immunogenicity in mice after heat treatment at 37°C. Therefore, the strain of the present invention has important application prospects in vaccine preparation, and provides a new technical means for improving the thermal stability of vaccines and optimizing foot-and-mouth disease prevention and control technologies. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 The TCID50 trend of FMDV in BHK-21 cells with HSP60 function inhibition;

[0041] Figure 2 Plaque purification of FMDV mutants resistant to HSP60 inhibitors;

[0042] Figure 3 is the resistance of each mutant strain to HSP60 inhibitors;

[0043] Among them, A is the virus titer level; B is the virus structural protein level; C is the virus RNA level;

[0044] Figure 4 To validate the rescue strain;

[0045] Among them, A is the indirect immunofluorescence verification of the rescued strain; B is the one-step growth curve of the rescued strain;

[0046] Figure 5 for the successful rescue of point mutation viruses;

[0047] Among them, A is ordinary optical microscope observation; B is transmission electron microscope observation;

[0048] Figure 6 To detect the resistance of point mutant viruses and WT original strains to HSP60 inhibitors;

[0049] Among them, A plaque reduction test-virus titer change; B one-step growth curve; C virus structural protein level;

[0050] Figure 7 The difference in thermal stability between the point mutant virus and the WT original strain;

[0051] Among them, A shows the difference in virulence between the point mutant virus and the WT original strain after treatment at different temperatures for 30 minutes; B shows the difference in particle thermal stability between the T171P-VP1 strain and the WT original strain; C shows the proportion of intact particles between the T171P-VP1 strain and the WT original strain after treatment at 37°C for different times;

[0052] Figure 8 The difference in immunogenicity between the T171P-VP1 strain and the WT original strain;

[0053] Among them, A is the level of specific antibodies; B is the level of neutralizing antibodies. DETAILED DESCRIPTION

[0054] The experimental method of the present invention is described in detail below in conjunction with the examples to more clearly illustrate its technical features and implementation steps. It should be understood by those skilled in the art that the embodiments are merely typical examples of the present invention and do not constitute any limitation to the scope of the present invention. Without departing from the spirit and scope of the present invention, the technical details may be adjusted or replaced, and these adjustments and replacements all fall within the scope of protection of the present invention.

[0055] Example 1 Obtaining FMDV mutants that are independent of HSP60

[0056] In order to study the effect of HSP60 function inhibition on the proliferation ability of foot-and-mouth disease virus (FMDV), Mizoribine, a specific inhibitor of HSP60, was used in the experiment to effectively inhibit the function of HSP60 in BHK-21 cells. First, HSP60 inhibitors were added to BHK-21 cells for treatment, and then the FMDV inoculation experiment was performed. After virus inoculation, the cells were cultured at 37°C and 5% CO2 for 10 hours, and the cell status was observed. When more than 80% of the cells showed typical lesions (such as cell rounding, shedding, etc.), the cell lysate was collected as a sample for later use. Subsequently, the virus sample collected last time was re-inoculated into the BHK-21 cells that had been inhibited by HSP60 function, and the inoculation and culture steps were repeated. After each inoculation, the cell lesions were observed for 10 hours, and the samples were collected again after confirming that the lesions reached more than 80%, and the virus samples were continuously passaged. At the same time, TCID 50 The toxicity of the collected virus samples was measured in the 50% tissue culture infectious dose (TCID) test to evaluate the changing trend of the virus's proliferation ability. Figure 1 The results showed that the virus titer first decreased and then increased with passage. This phenomenon suggests that the initial inhibition of HSP60 function limited FMDV's proliferation, leading to a decrease in titer. However, after multiple generations of adaptation, the virus gradually regained its replication ability, and the titer rose again. When the titer returned to the initial level, the virus of that generation was considered to have acquired resistance to the HSP60 inhibitor.

[0057] Example 2 Obtaining a single strain of FMDV mutants that is independent of HSP60

[0058] Based on the FMDV mutants with HSP60 inhibitor resistance, a single strain was further selected for subsequent sequencing. First, the mutant virus was subjected to plaque assay. The virus suspension was diluted by gradient dilution (e.g., 10 -1 , 10 -2 , 10 -3A series of virus dilutions were prepared (with equal dilution multiples). 100 μl of virus solution of different dilutions was inoculated into a 12-well plate covered with a monolayer of BHK-21 cells per well, and gently shaken to ensure uniform distribution of the virus. Subsequently, the cells were adsorbed in a 37°C, 5% CO2 incubator for 1 hour to ensure that the virus was fully bound to the host cells. After the adsorption was completed, the unadsorbed virus solution was carefully aspirated and the cells were washed twice with serum-free DMEM medium to remove excess virus particles. After that, a mixture of culture medium mixed with tragacanth solution covering the cells and DMEM containing 2% FBS was added to each well, 1 ml per well, to prevent the virus from spreading to non-infected areas. The 12-well plate was placed in an incubator and cultured for a further 72 hours. The 12-well plate could not be moved during this period. After 72 hours, the tragacanth culture solution was gently removed, and the cell surface was slowly washed twice with PBS. It was observed that the plaque area was fixed and clearly visible. Observe the plaque area, select independent plaques with clear edges, gently pick up the plaque area with a sterile pipette tip, place it in 1 ml of DMEM culture medium containing 2% FBS and gently mix it. The picked plaque liquid is broken by three freeze-thaw cycles and then sterilized by filtration through a 0.22 μm filter membrane. Subsequently, the filtered virus liquid is re-inoculated into new BHK-21 cells and passaged and purified until a stable virus strain is obtained. Select plaques of different diameters for picking, and the obtained samples are used for the next plaque test. After three consecutive times, the plaque purification is completed, and the results are as follows: Figure 2 The samples obtained from plaque purification were further diluted in a 96-well plate, and samples with single lesions observed under a microscope were selected to obtain multiple single strains.

[0059] The full viral sequence of each strain was amplified. The amplified products were sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. After obtaining the sequencing results, the sequences were compared with those of the original strain to confirm multiple mutation sites.

[0060] At the same time, the genetic stability of multiple single mutant strains was verified. After the mutant virus was subcultured for ten generations, RNA was extracted from the fifth and tenth generations of the virus, and the sequence of each site was amplified after reverse transcription. The sequence obtained was compared with the sequence of the first generation mutant virus to confirm the genetic stability of each mutation site.

[0061] The mutation sites of each single strain were analyzed. For strains with the same mutation site, only one strain was selected as a representative for subsequent experiments. The resistance of each strain to HSP60 inhibitors was tested by observing the changes in the toxicity, structural protein and viral RNA levels of BHK-21 cells treated with inhibitors or DMSO. Figure 3As shown, strains 5 / 8, 6 / 8 and 9 / 9 all showed high resistance to HSP60 inhibitors, so the mutation sites of strains 5 / 8, 6 / 8 and 9 / 9 were selected for the next test.

[0062] Example 3 Construction and rescue of reverse genetic toxins

[0063] A full-length FMDV plasmid for reverse genetic manipulation was designed based on the nucleotide sequence of the wild-type strain of foot-and-mouth disease virus (FMDV) type O. Using the pcDNA 3.1(+) vector as the backbone, a hammerhead ribozyme cDNA sequence was added to the 5' end. A synonymous mutation was introduced at position G9052 of the viral 3D nucleotide sequence to add a Stu I restriction enzyme site. A T7 terminator sequence was added to the 3' end. This resulted in a full-length FMDV plasmid, named pCFMDV. The plasmid design was sent to Nanjing GenScript Biotechnology Co., Ltd. for synthesis. Following synthesis, the full-length sequence of the original strain was sequenced to ensure accuracy. The nucleotide sequence of the resulting plasmid, pCFMDV, containing the full-length sequence of the original FMDV strain is shown in SEQ ID NO. 1. After sequence confirmation, virus rescue was performed using BHK-21 cells. This was achieved by lipofectamine transfection. Following transfection, cells were regularly monitored and harvested at appropriate times for passage and viral amplification. When it was passed to the third generation, a typical cytopathic effect (CPE) appeared 36 hours after infection, manifested as symptoms such as cell rounding and shedding, indicating that the virus has a good proliferation ability. When it was passed to the fourth generation, the virus proliferation rate was further increased. About 80% of the BHK-21 cells were observed to have obvious pathological changes 8 hours after infection, indicating that the virus has efficient replication ability. Subsequently, in order to further confirm the infectivity and antigen expression of the virus, an indirect immunofluorescence assay (IFA) was used for verification. The results showed that both the original strain and the rescued strain showed specific fluorescent signals in the infected cells, further confirming that the virus was successfully rescued and active. In addition, in order to evaluate the proliferation characteristics of the virus, a standard one-step growth curve experiment was performed on the virus. During this process, the virus was inoculated into BHK-21 cells at a high multiplicity of infection (MOI), and the cell supernatant was collected at different time points. The TCID 50 The virus titer was detected by the method. Figure 4 As shown, the results showed that the rescued strain and the original strain showed similar titers at different time points and exhibited the same trend of change, indicating that the rescued strain was the same as the original strain, had strong infection ability, and could be used for subsequent studies.

[0064] Example 4 Construction and identification of point mutation viruses

[0065] 1. Construction and rescue of point mutation viruses

[0066] Based on the FMDV full-length plasmid pCFMDV constructed in Example 3, the plasmid was subjected to site-directed mutagenesis to introduce the target mutation site. However, since the FMDV full-length plasmid pCFMDV contains two repeated sequences, Poly C and Poly A, these regions cause difficulties in the amplification of the plasmid during point mutations, and conventional amplification cannot be performed directly. Therefore, an intermediate plasmid was first designed and constructed to complete the introduction of the mutation site and subsequent recombination on its basis. During the construction of the intermediate plasmid, PCR was used to amplify the 2433bp-9162bp region of SEQ ID NO.1 for the subsequent insertion and recombination of the mutant intermediate sequence. The specific steps are as follows:

[0067] Using the full-length FMDV plasmid pCFMDV (SEQ ID NO. 1) as a template, PCR amplification yielded the target intermediate sequences (nZJT-3-F: GCAGATATCCAACTGGAGAACATTACTGGTTT; nZJT-3-R: ATAAGAATGCGGCCGCCGGCGTTCACCCAACGCAG). Next, the amplified intermediate sequences were inserted into the pcDNA3.1 vector using the EcoRV and NotI restriction sites to generate the intermediate plasmid, named pZJT. This step ensured sufficient flexibility in the intermediate plasmid for easy introduction of mutation sites.

[0068] Subsequently, based on the intermediate plasmid pZJT, point mutagenesis was performed at the target mutation sites based on the amino acid mutation sites of three single mutant strains (5 / 8, 6 / 8, and 9 / 9) that were screened for resistance to HSP60 inhibitors. Primers were designed to strictly target the specific sites screened, and high-fidelity PCR was used for amplification and mutation introduction. The primer sequences are shown in Table 1.

[0069] Table 1 Primers for site-directed mutagenesis

[0070]

[0071]

[0072] After mutagenesis, sequencing confirmed that the intermediate plasmid had successfully introduced the desired point mutation and that the sequence was correct. Next, the mutated intermediate sequence was back-ligated into the full-length FMDV plasmid pCFMDV using seamless cloning. The following steps were used: Specific primers were designed at both ends of the BsiW I and Stu I restriction sites on the intermediate plasmid to amplify the intermediate sequence containing the mutation (MU-INFUSION-F: GTGCTGGTCTTTGTCCCGTACGATCAAGAACCAC; MU-INFUSION-R: GTCCAGAGTGGACGGCGAGGCCTGCCACGGAG). The original FMDV full-length plasmid pCFMDV was digested with BsiW I and Stu I, and the vector fragment was isolated and recovered. The intermediate sequence containing the point mutation and the pCFMDV vector fragment obtained by digestion were recombined at a molar ratio of 3:1 using 2× ClonExpress Mix (Nanjing Novozymes Biotech Co., Ltd.) at 50°C for 5-15 minutes. The recombinant product was directly transformed into competent cells. The transformed colonies were screened and sequenced for verification, and the full-length plasmid sequence of FMDV with specific site mutations was successfully obtained.

[0073] Subsequently, sequencing was used to verify the correct point mutation full-length plasmid for virus rescue experiments. The virus rescue method was the same as the above method. After 3 to 7 generations of blind transmission, five FMDV virus strains with point mutations were successfully obtained (L148H-VP1, T171P-VP1, H209Y-VP2, T129A-2C and D136G-3A). The genomes of these five point mutation viruses were sequenced using sequencing technology, and the results showed that all mutation sites were correct, and no unexpected base changes or mutation drift occurred. Under an ordinary optical microscope, the infected cells showed obvious CPE (see Figure 5 A); Through transmission electron microscopy, FMDV virus particles with typical morphological characteristics can be clearly seen (see Figure 5 B), showing regular structures with sizes ranging from 20 to 30 nm. These results indicate that the point mutation virus was successfully rescued.

[0074] 2. Analysis of HSP60 Inhibitor Resistance of Point-Mutation Viruses

[0075] In order to verify the resistance of each point mutation virus to HSP60 inhibitors, we performed plaque reduction assays, one-step growth curve analysis, and detected the protein levels of each strain when the cells were treated with HSP60 inhibitors. The first is the plaque reduction assay. Measuring the reduction in the number of plaques can intuitively reflect the sensitivity of the virus to the compound. In this study, each point mutation virus was used to infect cells treated with DMSO or HSP60 inhibitors. Samples were collected 8 hours after infection and a plaque assay was performed. The experimental process is the same as the above-mentioned plaque assay method. Here, due to the differences in virulence of each strain, different dilutions were used for plaque tests for different point mutation virus strains in order to observe and count plaques. The results showed that compared with other point mutation strains and WT, there was no statistically significant difference in viral titer between the DMSO-treated group and the HSP60 inhibitor-treated group for the T171P-VP1 strain ( Figure 6 A). One-step growth curves are commonly used to study the replication cycle and proliferation characteristics of viruses in host cells. They are also used to observe the effects of antiviral drugs on viral proliferation curves and evaluate the inhibitory effects of drugs. After treatment with DMSO or HSP60 inhibitors, the one-step growth curves of each strain were analyzed. The results showed that among the WT and point mutant virus strains, the T171P-VP1 strain had no difference between the DMSO-treated group and the HSP60 inhibitor-treated group ( Figure 6 B). In addition, the results of the detection of viral structural protein levels also showed that the T171P-VP1 strain showed resistance to the inhibitor ( Figure 6 Therefore, based on the above results, it can be considered that the T171P-VP1 strain is resistant to HSP60 inhibitors.

[0076] 3. Thermal stability analysis of point mutation viruses

[0077] To verify the difference in thermal stability between the point mutant virus and the original strain, we incubated the virus at different temperatures for 30 minutes to observe its effect on virulence. The results showed that after 30 minutes, the T171P-VP1 strain was inactivated at 65°C, while the L148H-VP1, H209Y-VP2, T129A-2C, D136G-3A and WT strains were inactivated at 63°C ( Figure 7 A). Therefore, the thermal stability of the T171P-VP1 strain is better than that of other strains. Next, the WT original strain and T171P-VP1 virus particles purified by SDGC were used to perform Pastry experiments to test their thermal stability. In the PaSTRy test of picornavirus, after the virus is heat-treated, the virus particles will dissociate at a certain temperature, exposing the viral genome. The fluorescent probe (such as SYTO-9 used in this study) will bind to the exposed genome and emit a strong fluorescent signal. Figure 7As shown in B, the temperature at which the T171P-VP1 strain emits a fluorescent signal is higher than that of the WT original strain, indicating that the T171P-VP1 strain is more heat-resistant. In addition, this study also used an ELISA method to detect complete FMDV particles (using a single-domain antibody fragment (VHH) that specifically recognizes 146S particles as the primary antibody) to verify the proportion of complete virus particles after heat treatment of the two viruses. The results showed that when the purified virus was placed at 37°C for different time periods, the T171P-VP1 strain still had more than 50% of the virus particles intact within 24 hours ( Figure 7 C). Although no significant differences were observed after 36 and 48 hours of heat treatment, the proportion of intact particles in the T171P-VP1 strain was significantly higher than that in the WT original strain after 24 hours of treatment at 37°C. These results suggest that the T171P-VP1 strain has better thermostability than the WT original strain.

[0078] 4. Immunogenicity Analysis of the Point Mutation Virus T171P-VP1 Strain

[0079] The same titer (10 7 TCID 50 / 0.1ml) and the WT original strain were treated at 37°C for 12 hours and 24 hours, respectively. The virus was then inactivated using BEI, concentrated three times after inactivation, and emulsified in ISA-206 for use in mouse immunization experiments. At the same time, a non-heat-treated strain group was set as a control. According to the experimental design, blood was collected through the eyeballs on days 0, 7, 14, 21 and 28, and serum samples collected at each time point were used to detect specific antibodies and neutralizing antibody levels. The FMDV-specific antibody and neutralizing antibody titers were detected by sandwich ELISA and virus neutralization test, respectively. In the WT group, 7-28 days after inoculation, the specific antibodies of the heat-treated WT group ( Figure 8 A) and neutralizing antibodies ( Figure 8 B) was significantly lower than that of the untreated WT group. In the T171P-VP1 group, on day 28 after inoculation, the specific antibody level of the heat-treated group was not significantly different from that of the untreated group ( Figure 8 A). In addition, at 21 and 28 dpv, the neutralizing antibody levels of the T171P-VP1 group were significantly higher than those of the heat-treated and untreated groups. B). These results indicate that the point mutant virus T171P-VP1 exhibited better immunogenicity in mice after heat treatment at 37°C compared with the WT original strain.

Claims

1. A recombinant strain of foot-and-mouth disease virus (FMDV) with heat resistance, characterized in that: The recombinant strain is obtained by rescuing an infectious cDNA expression plasmid of foot-and-mouth disease virus containing a mutation site through reverse genetic technology, wherein the infectious cDNA expression plasmid of foot-and-mouth disease virus containing a mutation site is obtained by mutating the 4863rd nucleotide A to C through site-directed mutagenesis based on the sequence shown in SEQ ID NO.

1.

2. The recombinant strain according to claim 1, characterized in that The infectious cDNA expression plasmid of foot-and-mouth disease virus containing the mutation site was transfected into the BHK-21 cell line expressing the T7 polymerase gene to obtain the rescued heat-resistant recombinant strain of foot-and-mouth disease virus.

3. A method for obtaining the recombinant strain according to claim 1 or 2, characterized in that: The following steps are involved: (1) Synthesis of template plasmid A full-length FMDV plasmid for reverse genetics manipulation was designed based on the nucleic acid sequence of the wild-type strain of foot-and-mouth disease virus type O. The pcDNA3.1(+) vector was used as the backbone, a hammerhead ribozyme cDNA sequence was added to the 5' end, a synonymous mutation was introduced at the G9052 site of the viral 3D nucleic acid sequence to add a Stu I restriction enzyme site, and a T7 terminator sequence was added to the 3' end. The full-length FMDV plasmid was synthesized and named pCFMDV. The nucleotide sequence is shown in SEQ ID NO.

1. (2) Construction of intermediate plasmid The target intermediate sequence was obtained by PCR amplification using the full-length FMDV plasmid pCFMDV as a template. The primer sequences used are as follows: nZJT-3-F: GCAGATATCCAACTGGAGAACATTACTGGTTT; nZJT-3-R:ATAAGAATGCGGCCGCCGGCGTTCACCCAACGCAG; Then, the amplified intermediate sequence was inserted into the pcDNA3.1 vector using the EcoR V and Not I restriction sites to obtain an intermediate plasmid named pZJT; (3) Introduction of mutation sites Using site-directed mutagenesis, the intermediate plasmid pZJT was used as a template. PCR amplification with primers VP1-T171P-F / R introduced the mutation site T171P. After Dpn I digestion, the product was transformed into competent bacteria. After screening and sequencing confirmation, an intermediate plasmid containing the mutation site was obtained and named pZJT-T171P. The primer sequences used are as follows: VP1-T171P-F: AACTACGGTGCCATCAAAGCCCCTCGGGTGACAGAACTGCTGT; VP1-T171P-R:ACAGCAGTTCTGTCACCCGAGGGGCTTTGATGGCACCGT AGTT; (4) Construction of full-length mutant plasmid The intermediate plasmid pZJT-T171P containing the mutation site was back-ligated into the full-length FMDV plasmid pCFMDV using seamless cloning technology. The specific steps were as follows: specific primers MU-INFUSION-F / R were designed for both ends of the BsiWI and Stu I restriction sites on the intermediate plasmid to amplify the intermediate sequence containing the mutation; the full-length FMDV plasmid pCFMDV was digested with BsiWI and Stu I, the vector fragment was isolated and recovered, and the intermediate sequence containing the mutation was ligated with the pCFMDV vector fragment obtained by restriction digestion by seamless cloning to construct the full-length FMDV plasmid containing the mutation site, which was named pT171P. The primer sequences used are as follows: MU-INFUSION-F:GTGCTGGTCTTTGTCCCGTACGATCAAGAACCAC; MU-INFUSION-R:GTCCAGAGTGGACGGCGAGGCCTGCCACGGAG; (5) Rescue of heat-resistant recombinant strains of foot-and-mouth disease virus The full-length FMDV plasmid pT171P containing the mutation site was transfected into the BHK-21 cell line expressing the T7 polymerase gene to obtain a rescued heat-resistant recombinant FMDV strain named T171P-VP1.

4. The method according to claim 3, wherein In step (3), the mutation site is located at position 4863 of the sequence shown in SEQ ID NO. 1, and the nucleotide A at position 4863 is mutated to C by PCR amplification using primers VP1-T171P-F / R.

5. The method according to claim 3, wherein In step (4), the intermediate plasmid pZJT-T171P containing the mutation site is ligated with the pCFMDV vector fragment obtained by enzyme digestion at a molar ratio of 3:

1.

6. The method according to claim 3, wherein In step (4), the plasmid pT171P is an infectious cDNA expression plasmid for foot-and-mouth disease virus containing a mutation site, and its nucleotide sequence is obtained by mutating the 4863rd nucleotide A to C through site-directed mutagenesis based on the sequence shown in SEQ ID NO.

1.

7. The method according to claim 3, wherein In step (5), the transfection is carried out by liposome transfection.

8. Use of the heat-resistant recombinant foot-and-mouth disease virus strain according to claim 1 or 2 in the preparation of an inactivated foot-and-mouth disease vaccine.

9. A heat-resistant inactivated vaccine for foot-and-mouth disease, characterized in that: The invention is prepared from the recombinant foot-and-mouth disease virus strain with heat resistance as claimed in claim 1 or 2 and an adjuvant.

Images