Molecular specific marker for identifying genetic sex of culter alburnus and application of molecular specific marker

Abstract

The invention discloses a molecular specific marker for identifying genetic sex of culter alburnus and application of the molecular specific marker, and relates to the technical field of animal molecular genetics. The specific preparation method comprises the following steps: firstly, extracting culter alburnus genome DNA; then screening by utilizing the genomic DNA of the culter alburnus to obtain a culter alburnus genetic sex molecule specific marker; the method comprises the following steps: designing a primer according to a culter alburnus genetic sex molecule specific marker, and amplifying a culter alburnus genome sample to be detected; if the PCR amplification product is a single bright specific band, the individual is a female individual, and if the PCR amplification product has two bands, the individual is a male individual. The genetic sex of the culter alburnus can be quickly and accurately identified by utilizing the method, so that the method has important scientific value on the research on the sex mechanism of the culter alburnus, and has important significance and application value on the sex control and selective breeding of the culter alburnus.

Description

Technical Field

[0001] The invention relates to the technical field of animal molecular genetics, and in particular to a molecular specific marker for identifying the genetic sex of Culter alba and an application thereof. Background Art

[0002] Culter alba ( Culter alburnus Basilewsky, commonly known as whitefish or white stripe, belongs to the Cyprinidae, subfamily Culterinae, and genus Culter. It is a large, pelagic, eurythermal freshwater fish and one of the most widely distributed commercial fish. In recent years, with the continuous improvement and promotion of artificial breeding and reproduction techniques, it has gradually become a major aquaculture species. Years of breeding experience have shown significant differences in body size and growth rate between male and female Culter bream, with females growing over 10% faster than males of the same age, demonstrating significant sexual dimorphism. Therefore, breeding all-female Culter bream and implementing monosexed aquaculture are of great significance and application value for accelerating Culter bream growth, controlling overbreeding, improving the quality of commercial fish, and increasing economic benefits. However, before gonadal development matures, it is difficult to accurately distinguish between male and female individuals based on external morphological characteristics, and the key regulatory genes and mechanisms involved in sex determination and differentiation in Culter bream are still unclear. Therefore, there is still a need for a specific molecular marker that can accurately identify the genetic sex of male and female Culter carp, which will not only help to gain a deeper understanding of the sex determination mechanism of Culter carp, but also provide an important genetic basis for better development of Culter carp sex control breeding technology. Summary of the Invention

[0003] The purpose of the present invention is to provide a molecular specific marker for identifying the genetic sex of Culter alba and its application, so as to solve the problem that it is difficult to accurately distinguish between male and female individuals of Culter alba by external morphological characteristics before the gonads mature.

[0004] In order to solve the above technical problems, the present invention specifically provides the following technical solutions: The invention discloses a molecular specific marker for identifying the genetic sex of Culter alba. The nucleic acid sequence of the molecular specific marker is shown as SEQ ID NO.1.

[0005] The present invention discloses a method for identifying the genetic sex of Culter alba, comprising: S1: Cut the fin rays of the C. alba sample into small pieces, add tissue cell lysis buffer and enzyme water bath, then add binding solution and magnetic beads for incubation; after incubation, centrifuge and magnetic separation, wash and dry the magnetic beads, then add buffer water bath, and finally centrifuge and magnetic separation to obtain C. alba genomic DNA; S2: designing primers based on the molecular specific marker according to claim 1, and performing PCR amplification using the Culter alba genomic DNA of S1 as a template to obtain a PCR amplification product, and subjecting the PCR amplification product to agarose gel electrophoresis; S3: Analysis results, the results are (1) or (2): (1) If the PCR amplification product is a single bright specific band, it is a female individual; (2) If the PCR amplification product has two bands, it is a male individual.

[0006] Preferably, the magnetic beads in S1 are prepared from Fe₃O₄ and a chitosan derivative, wherein the chitosan derivative is prepared from chitosan, 3-chloro-2,2-dimethyl-1-propanol, and 2-chloroethoxyethanol. The use of Fe₃O₄ and a chitosan derivative to prepare magnetic beads modifies the Fe₃O₄ surface with functional groups that can specifically bind to DNA molecules through hydrogen bonding, electrostatic interactions, and the like. Furthermore, the magnetic beads can be effectively separated from the sample liquid phase to remove impurities, and high-concentration and high-purity DNA can be obtained through elution.

[0007] Preferably, the mass ratio of the sample fins to the magnetic beads in S1 is 1:0.0008-0.002.

[0008] Preferably, the ratio of sample fin ray to tissue cell lysate in S1 is 1 mg: 8-15 μL.

[0009] Preferably, the enzyme in S1 is proteinase K, and the usage ratio of sample fin ray to proteinase K is 1 mg: 0.15-0.5 μL.

[0010] Preferably, the combining solution in S1 is a sodium chloride solution and a PEG6000 solution, the sodium chloride solution is composed of sodium chloride and water, the amount of sodium chloride in the sodium chloride solution is 4-4.5 g / L, the PEG6000 solution is composed of PEG6000 and water, the amount of PEG6000 in the PEG6000 solution is 0.15-0.3 g / ml, and the usage ratio of the sample fin to the sodium chloride solution is 1 mg: 2-5 μL.

[0011] More preferably, the volume ratio of the sodium chloride solution to the PEG6000 solution is 1:0.8-1.2.

[0012] Preferably, the buffer in S1 is EB elution buffer, and the usage ratio of magnetic beads to EB elution buffer is 1 μg:0.8-1.5 μL.

[0013] Preferably, the PCR amplification system in S2 comprises 10× Buffer solution, dNTPs, primers, rTaq enzyme, genomic DNA template and water.

[0014] The present invention discloses a method for identifying the genetic sex of Culter alba, comprising: S1 Extraction of Culter albus genomic DNA: Select sexually mature male and female Culter albus, cut the tail fins and freeze them in liquid nitrogen to obtain sample fin rays, which are then stored at -75--85°C. Mince the Culter albus fin rays, add tissue cell lysis buffer and enzyme, and incubate in a water bath at 50-65°C for 6-15 hours. Then, add binding solution and magnetic beads, adjust the pH to 3.5-4.5, and incubate at 20-30°C for 15-25 minutes. After incubation, centrifuge and magnetically separate the beads, wash and dry them. Then, add buffer and incubate in a water bath at 50-65°C for 5-10 minutes. Finally, centrifuge and magnetically separate the liquid to obtain Culter albus genomic DNA. S2 PCR amplification: according to the molecular specific marker of claim 1, primers are designed, and PCR amplification is performed using the genomic DNA of Culter alba in S1 as a template to obtain PCR amplification products, and the PCR amplification products are subjected to agarose gel electrophoresis; S3 analysis results, the results are (1) or (2): (1) If the PCR amplification product is a single bright specific band, it is a female individual; (2) If the PCR amplification product has two bands, it is a male individual.

[0015] Preferably, the ratio of sample fin ray to tissue cell lysate in S1 is 1 mg: 8-15 μL.

[0016] Preferably, the enzyme in S1 is proteinase K, and the usage ratio of sample fin ray to proteinase K is 1 mg: 0.15-0.5 μL.

[0017] Preferably, the combination solution in S1 is sodium chloride solution and PEG6000 solution, the usage ratio of sample fin ray to sodium chloride solution is 1 mg: 2-5 μL, and the volume ratio of sodium chloride solution to PEG6000 solution is 1: 0.8-1.2.

[0018] More preferably, the sodium chloride solution consists of sodium chloride and water, and the amount of sodium chloride in the sodium chloride solution is 4-4.5 g / L.

[0019] More preferably, the PEG6000 solution consists of PEG6000 and water, and the amount of PEG6000 in the PEG6000 solution is 0.15-0.3 g / ml.

[0020] Preferably, the mass ratio of the sample fins to the magnetic beads in S1 is 1:0.0008-0.002.

[0021] Preferably, the reagent used for washing in S1 is an ethanol solution.

[0022] More preferably, the ethanol solution consists of ethanol and water, and the volume ratio of ethanol in the ethanol solution is 65-75%.

[0023] Preferably, the buffer in S1 is EB elution buffer, and the usage ratio of magnetic beads to EB elution buffer is 1 μg:0.8-1.5 μL.

[0024] Preferably, the PCR amplification system comprises 10× Buffer solution, dNTPs, primers, rTaq enzyme, genomic DNA template and water.

[0025] The present invention also discloses a method for preparing a chitosan derivative, comprising: Chitosan is mixed with sodium hydroxide solution and stirred at 20-30°C for 20-30 hours to obtain a solution. 3-Chloro-2,2-dimethyl-1-propanol and 2-chloroethoxyethanol are added to isopropanol and mixed to obtain a mixed solution. The mixed solution is then added dropwise to the solution and allowed to react at 20-30°C for 4-8 hours. After the reaction is complete, the crude product is filtered to obtain a crude product. Water is added to the crude product to dissolve it, and the pH is adjusted to 6-8. Ethanol is then added to precipitate the product. The precipitate is washed with water and dried to obtain a chitosan derivative.

[0026] Preferably, the sodium hydroxide solution consists of sodium hydroxide and water, and the amount of sodium hydroxide in the sodium hydroxide solution is 0.3-0.5 g / ml.

[0027] Preferably, the ratio of chitosan to sodium hydroxide solution is 1 g: 18-50 ml.

[0028] Preferably, the usage ratio of 3-chloro-2,2-dimethyl-1-propanol to isopropanol is 1 g:8-15 ml.

[0029] Preferably, the mass ratio of 3-chloro-2,2-dimethyl-1-propanol to 2-chloroethoxyethanol is 1:0.8-1.2.

[0030] Preferably, the volume ratio of the dissolving solution to the mixed solution is 1:1.2-1.8.

[0031] The present invention discloses a method for preparing magnetic beads, comprising: Fe3O4 was mixed with water and ultrasonicated for 1 hour, and then chitosan derivative solution was added and stirred for 20-30 hours, followed by adding glutaraldehyde solution and reacting at 150-250 rpm / min for 3-5 hours. After the reaction, the magnetic beads were washed and dried.

[0032] Preferably, the ratio of Fe3O4 to water is 1g:25-35ml.

[0033] Preferably, the chitosan derivative solution consists of a chitosan derivative and an acetic acid solution, and the amount of the chitosan derivative in the chitosan derivative solution is 0.005-0.015 g / ml.

[0034] Preferably, the acetic acid solution consists of acetic acid and water, and the amount of acetic acid in the acetic acid solution is 0.005-0.02 g / ml.

[0035] Preferably, the usage ratio of Fe3O4 to chitosan derivative solution is 1g:75-130ml.

[0036] Preferably, the glutaraldehyde solution consists of glutaraldehyde and phosphate buffer, the amount of glutaraldehyde in the glutaraldehyde solution is 0.02-0.04 g / ml, and the amount of phosphate in the phosphate buffer is 0.15-0.25 mol / L.

[0037] Preferably, the usage ratio of Fe3O4 to glutaraldehyde solution is 1g:22-30ml.

[0038] More preferably, in the preparation process of the magnetic beads of the present invention, on the basis of using chitosan derivatives, 1,3-bis(3-aminopropyl)-1,1,3,3-tetramethyldisiloxane and the coordinated use and modification of 1,3-bis(3-aminopropyl)-1,1,3,3-tetramethyldisiloxane can be used to further supplement the functional groups, optimize the performance of the magnetic beads, and improve the adsorption efficiency of DNA molecules, thereby increasing the concentration of the prepared DNA and reducing the impurity adsorption content.

[0039] The present invention discloses a method for obtaining a molecular specific marker for the genetic sex of Culter alba, which specifically comprises: Libraries were constructed from the obtained genomic DNA of male and female C. albicans. Whole-genome resequencing was performed using the Illumina HiSeq4000 platform to generate high-throughput raw sequencing data. Bioinformatics analysis of the raw sequencing data was performed. Sequencing data from the same sex were aligned to the C. albicans genome (GCA_040182925.1) using BWA-MEM software. Reads from the paired-end alignments were extracted using samtools. Sequences from these regions were identified as common sequences for samples of the same sex, namely, female and male common sequences. These common sequences were aligned using BWA-MEM software. Coverage information for each genomic sequence was calculated using samtools. Sequences that were covered by 12 sequencing reads from the same sex (≥1) and not covered by any of the 12 samples from the opposite sex (≥1) were selected as candidate sex-specific sequences. Finally, a candidate sex-specific fragment was identified, which was identified as a molecular marker for genetic sex in C. albicans.

[0040] Compared with the prior art, the present invention has the following beneficial effects: The present invention proposes a molecular-specific marker for identifying the genetic sex of Culter albiflorus and its application. First, Culter albiflorus genomic DNA is extracted. Then, the Culter albiflorus genomic DNA is used to screen and obtain a molecular-specific marker for the genetic sex of Culter albiflorus. Primers are designed based on the molecular-specific marker for the genetic sex of Culter albiflorus, and amplification is performed on the Culter albiflorus genomic sample to be tested. If the PCR amplification product is a single bright specific band, the individual is female; if the PCR amplification product has two bands, the individual is male. The present invention can quickly and accurately identify the genetic sex of Culter albiflorus, and is expected to achieve fully feminized breeding of Culter albiflorus, rationally utilizing the human, material, and financial resources of Culter albiflorus breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] To more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for the embodiments or the description of the prior art. Obviously, the drawings described below are merely exemplary, and those skilled in the art can derive other implementation drawings based on the provided drawings without inventive effort.

[0042] Figure 1 The figure shows the agarose gel electrophoresis of 24 samples of male and female Culter alba using primers Sca826401-F / R. DETAILED DESCRIPTION

[0043] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0044] The following first describes the concepts involved in this application with reference to the accompanying drawings. It should be noted that the following description of each concept is intended only to make the content of this application easier to understand and does not limit the scope of protection of this application. At the same time, the embodiments and features in the embodiments of this application can be combined with each other unless there is a conflict. The following detailed description of this application will be made with reference to the accompanying drawings and in conjunction with the embodiments.

[0045] Example 1: Preparation of chitosan derivatives: Chitosan was mixed with sodium hydroxide solution and stirred at 25°C for 24 hours to obtain a solution. 3-Chloro-2,2-dimethyl-1-propanol and 2-chloroethoxyethanol were added to isopropanol and mixed to obtain a mixed solution. The mixed solution was then added dropwise to the solution and allowed to react at 25°C for 6 hours. After the reaction, the crude product was filtered to obtain a crude product. Water was added to dissolve the crude product, and the pH was adjusted to 7. Ethanol was then added to precipitate the product. The precipitate was washed with water and dried to obtain the chitosan derivative. The sodium hydroxide solution consists of sodium hydroxide and water, the amount of sodium hydroxide in the sodium hydroxide solution is 0.4 g / ml, the amount ratio of chitosan to sodium hydroxide solution is 1 g:20 ml, the amount ratio of 3-chloro-2,2-dimethyl-1-propanol to isopropanol is 1 g:10 ml, the mass ratio of 3-chloro-2,2-dimethyl-1-propanol to 2-chloroethoxyethanol is 1:1, and the volume ratio of the dissolved liquid to the mixed liquid is 1:1.5.

[0046] Preparation of magnetic beads: Fe3O4 and water were mixed by ultrasonication for 1 hour, and then a chitosan derivative solution was added and stirred for 24 hours. Then, a glutaraldehyde solution was added and reacted at 200 rpm / min for 4 hours. After the reaction, the magnetic beads were washed and dried to obtain the magnetic beads. The ratio of Fe3O4 to water was 1 g:30 ml, the chitosan derivative solution consisted of a chitosan derivative and an acetic acid solution, with the amount of the chitosan derivative in the chitosan derivative solution being 0.01 g / ml, the acetic acid solution consisted of acetic acid and water, with the amount of acetic acid in the acetic acid solution being 0.01 g / ml, the ratio of Fe3O4 to the chitosan derivative solution was 1 g:100 ml, the glutaraldehyde solution consisted of glutaraldehyde and phosphate buffer, with the amount of glutaraldehyde in the glutaraldehyde solution being 0.025 g / ml, the amount of phosphate in the phosphate buffer being 0.2 mol / L, and the ratio of Fe3O4 to the glutaraldehyde solution was 1 g:27 ml.

[0047] Extraction of genomic DNA from Culter albus: Twelve sexually mature male and female Culter albus were randomly selected from aquaculture ponds at the Balidian Comprehensive Experimental Base of the Zhejiang Freshwater Fisheries Research Institute. The caudal fins were clipped and quickly frozen in liquid nitrogen to obtain fin ray samples, which were then stored at -80°C. Fin ray samples were removed and thoroughly minced. Tissue cell lysis buffer and proteinase K (20 mg / ml) were added and incubated in a 56°C waterbath for 12 hours. After the incubation period, sodium chloride solution, PEG 6000 solution, and magnetic beads were added, and the pH was adjusted to 4. Mix well and incubate at 25°C for 20 minutes. After incubation, the samples were centrifuged and placed on a magnetic rack. The liquid was discarded and washed with ethanol twice. The samples were then dried and eluted with EB elution buffer at 56°C for 8 minutes. After the incubation period, the samples were centrifuged and placed on a magnetic rack to separate the solution, thereby obtaining Culter albus genomic DNA. The usage ratio of sample fin rays to tissue cell lysate is 1 mg:10 μL, the usage ratio of sample fin rays to proteinase K is 1 mg:0.2 μL, the sodium chloride solution consists of sodium chloride and water, and the amount of sodium chloride in the sodium chloride solution is 4.27 g / L, the PEG6000 solution consists of PEG6000 and water, and the amount of PEG6000 in the PEG6000 solution is 0.2 g / ml, the usage ratio of sample fin rays to sodium chloride solution is 1 mg:3 μL, the volume ratio of sodium chloride solution to PEG6000 solution is 1:1, the mass ratio of sample fin rays to magnetic beads is 1:0.001, the ethanol solution consists of ethanol and water, and the volume ratio of ethanol in the ethanol solution is 70%, the usage ratio of magnetic beads to ethanol solution is 1 μg:10 μL, and the usage ratio of magnetic beads to EB elution buffer is 1 μg:1 μL.

[0048] Example 2: The preparation of chitosan derivatives is the same as in Example 1.

[0049] Preparation of magnetic beads: The preparation of magnetic beads in this embodiment is compared with that in Example 1, except that the usage ratio of Fe3O4 to chitosan derivative solution is 1g:120ml, and other conditions and parameters are the same as in Example 1.

[0050] Extraction of Culter alba genomic DNA: The extraction of Culter alba genomic DNA in this example is compared with that in Example 1, except that the magnetic beads used are the magnetic beads prepared in this example, and other conditions and parameters are the same as in Example 1.

[0051] Example 3: The preparation of chitosan derivatives is the same as in Example 1.

[0052] Preparation of magnetic beads: The preparation of magnetic beads in this embodiment is compared with that in Example 1, except that the usage ratio of Fe3O4 to chitosan derivative solution is 1g:80ml, and other conditions and parameters are the same as in Example 1.

[0053] Extraction of Culter alba genomic DNA: The extraction of Culter alba genomic DNA in this example is compared with that in Example 1, except that the magnetic beads used are the magnetic beads prepared in this example, and other conditions and parameters are the same as in Example 1.

[0054] Example 4: The preparation of chitosan derivatives is the same as in Example 1.

[0055] Preparation of magnetic beads: Fe3O4 was mixed with water and ultrasonicated for 1 hour, and then chitosan derivative solution and 1,3-bis(3-aminopropyl)-1,1,3,3-tetramethyldisiloxane were added and stirred for 24 hours. Then glutaraldehyde solution was added and reacted at 200 rpm / min for 4 hours. After the reaction, the magnetic beads were washed and dried to obtain magnetic beads. The amount ratio of Fe3O4 to water is 1g:30ml, the chitosan derivative solution consists of a chitosan derivative and an acetic acid solution, the amount of the chitosan derivative in the chitosan derivative solution is 0.01g / ml, the acetic acid solution consists of acetic acid and water, the amount of acetic acid in the acetic acid solution is 0.01g / ml, the amount ratio of Fe3O4 to the chitosan derivative solution is 1g:100ml, the mass ratio of Fe3O4 to 1,3-bis(3-aminopropyl)-1,1,3,3-tetramethyldisiloxane is 1:0.4, the glutaraldehyde solution consists of glutaraldehyde and phosphate buffer, the amount of glutaraldehyde in the glutaraldehyde solution is 0.025g / ml, the amount of phosphate in the phosphate buffer is 0.2mol / L, and the amount ratio of Fe3O4 to the glutaraldehyde solution is 1g:27ml.

[0056] Extraction of Culter alba genomic DNA: The extraction of Culter alba genomic DNA in this example is compared with that in Example 1, except that the magnetic beads used are the magnetic beads prepared in this example, and other conditions and parameters are the same as in Example 1.

[0057] Example 5: The preparation of chitosan derivatives is the same as in Example 1.

[0058] Preparation of magnetic beads: The preparation of magnetic beads in this embodiment is different from that in Example 4, except that the mass ratio of Fe3O4 to 1,3-bis(3-aminopropyl)-1,1,3,3-tetramethyldisiloxane is 1:0.8, and other conditions and parameters are the same as Example 4.

[0059] Extraction of Culter alba genomic DNA: The extraction of Culter alba genomic DNA in this example is compared with that in Example 1, except that the magnetic beads used are the magnetic beads prepared in this example, and other conditions and parameters are the same as in Example 1.

[0060] Example 6: The preparation of chitosan derivatives is the same as in Example 1.

[0061] The preparation of magnetic beads is the same as in Example 1.

[0062] The extraction of Culter alba genomic DNA was the same as in Example 1.

[0063] To obtain molecular markers specific for genetic sex in C. albicans (C. albicans): Genomic DNA libraries were constructed from both male and female C. albicans, and whole-genome resequencing was performed using the Illumina HiSeq4000 platform to generate high-throughput raw sequencing data. Bioinformatics analysis of the raw sequencing data was performed. Sequencing data from both sexes were aligned to the C. albicans genome (GCA_040182925.1) using BWA-MEM software. Reads from the paired-end alignments were extracted using samtools software. Sequences from these regions were then extracted and used as common sequences for samples of the same sex, namely, common sequences for both males and females. The common sequences of males and females were aligned using BWA-MEM software. The coverage information of each genomic sequence was calculated using samtools. Sequences that were simultaneously covered by 12 same-sex sequencing reads (=12) and not covered by any of the 12 opposite-sex samples (≥1) were selected using bedtools as candidate specific sequences. Finally, a candidate specific fragment was screened, namely the genetic sex-specific molecular marker of Culter alba, whose nucleic acid sequence is shown in SEQ ID NO.1.

[0064] SEQ ID NO.1: AGATTATCGATTAATTAAGACTTATTTTCATGCAGTTCCATGCACAATATGTTATGACCTCAAAACACTTTTTATGGAGCATGATTTGTAATCTAATACAATATGAAATGTGCATGACATAACTAACTCCATATGCATAGCTTTTCTGACATAGTAAACTTGCTTG AGTCTCGTGAAAAGCGAGTCACGATAAAATAGTTCAAAGACATAAGCCAGCTAAAAGGGCATGGTTGCTTCAACAAATGTCTGTTTATTTCACATTTGACCACTATCGCTTAGGTTTAGAGTGGGGTTTAGTGCATTCTTAAAAATAAATGTTCTTTACTGACATT Comparative Example 1: The preparation of chitosan derivatives is the same as in Example 1.

[0065] Preparation of magnetic beads: The preparation of magnetic beads in this embodiment is compared with that in Example 1, except that the usage ratio of Fe3O4 to chitosan derivative solution is 1g:10ml, and other conditions and parameters are the same as in Example 1.

[0066] Extraction of Culter alba genomic DNA: The extraction of Culter alba genomic DNA in this example is compared with that in Example 1, except that the magnetic beads used are the magnetic beads prepared in this example, and other conditions and parameters are the same as in Example 1.

[0067] Experimental Example 1: For the identification of the genetic sex of Culter alba, primer sequences Sca826401-F and Sca826401-R were designed based on the Culter alba genetic sex molecular specific marker obtained in Example 6, as shown in SEQ ID NO.2 and SEQ ID NO.3.

[0068] Sca826401-F (SEQ ID NO.2): TATCGATTAATTAAGACTTATTTTC Sca826401-R (SEQ ID NO.3):ATTTATTTTTAAGAATGCACTAAAC PCR validation was performed using 24 genomic samples from both male and female Culter albicans of known sex as templates. The PCR amplification system consisted of 2 μL of 10× buffer, 2 μL of dNTPs, 1 μL each of Sca826401-F and Sca826401-R primers, 1.0 U of rTaq enzyme, and 1 μL of genomic template, made up to 20 μL with deionized sterile water. PCR reaction conditions were: initial denaturation at 94°C for 5 min, followed by 32 cycles of denaturation at 94°C for 20 s, annealing at 56°C for 30 s, and extension at 72°C for 2 min, followed by extension at 72°C for 10 min. PCR products were analyzed by 1.5% agarose gel electrophoresis. ♂ represents male individuals, and ♀ represents female individuals.

[0069] The results are as follows Figure 1 As shown, if a single bright specific band can be amplified in the sample, it is a female individual, if two bands can be amplified, it is a male individual, and the other band amplified in both female and male individuals is a short band, and the nucleic acid sequence of the short band is shown in SEQ ID NO.4.

[0070] SEQ ID NO.4: AGATTATCGATTAATTAAGACTTATTTTCATGCAGTTCCATGCACAATATGTTATGACCTCAAAACACTTTTTATGGAGCATGATTTGTAATCTAATACAATATGAAATGTGCATGACATAACTAACTCCATATGCATAGCTTTTCTAGC GAGTCACGATAAAATAGTTCAAAGACATAAGCCAGCTAAAAGGGCATGGTTGCTTCAACAAATGTCTGTTTATTTCACATTTGACCACTATCGCTTAGGTTTAGAGTGGGGTTTAGTGCATTCTTAAAAATAAATGTTCTTTACTGACATT Experimental Example 2: The DNA concentration was detected by a micro-nucleic acid detector. First, the measuring head was washed with water three times and then wiped dry. Then, a blank zero adjustment was performed and 1 μl of EB elution buffer was taken to the measuring head for a blank test. Finally, the concentration of the Culter alba genomic DNA prepared in Examples 1-5 and Comparative Example 1 was tested. 1 μl of the Culter alba genomic DNA to be tested was taken to the measuring head for measurement. The maximum absorption wavelength of nucleic acid is 260 nm, and the Nanodrop software will automatically calculate the concentration of nucleic acid.

[0071] Table 1 DNA concentration determination results

[0072] The test results of the genomic DNA concentration of C. alba prepared in Examples 1-5 and Comparative Example 1 are shown in Table 1. Compared with Example 2, Example 1 shows that the increase in the amount of chitosan derivative solution used within a certain range can increase the DNA extraction rate by improving the adsorption of DNA, thereby increasing the genomic DNA concentration of C. alba; Compared with Example 3, Example 1 shows that the reduction in the amount of chitosan derivative solution used within a certain range will reduce the genomic DNA concentration of C. alba; Compared with Example 4, Example 1 shows that the chitosan derivative solution can be used to extract the genomic DNA of C. alba. On the basis of the above, the use of 1,3-bis(3-aminopropyl)-1,1,3,3-tetramethyldisiloxane can further improve the concentration of the extracted Culter alba genomic DNA; Example 4 shows that increasing the amount of 1,3-bis(3-aminopropyl)-1,1,3,3-tetramethyldisiloxane used within a certain range can also improve the concentration of the extracted Culter alba genomic DNA; Example 1 shows that the amount of chitosan derivative solution used needs to be in an appropriate range, and too low a range will result in a low concentration of the extracted Culter alba genomic DNA.

[0073] Experimental Example 3: DNA background impurities were detected, and the background impurity values of the Culter alba genomic DNA prepared in Examples 1-5 and Comparative Example 1 were measured by ultraviolet spectrophotometry at 325 nm.

[0074] Table 2 Determination results of background impurity values

[0075] The purity test results of the Culter alba genomic DNA prepared in Examples 1-5 and Comparative Example 1 are shown in Table 2. Compared with Example 2, Example 1 shows that increasing the amount of chitosan derivative solution used within a certain range can effectively improve the specific adsorption of DNA and reduce impurity contamination; Compared with Example 3, Example 1 shows that decreasing the amount of chitosan derivative solution used within a certain range can increase the background impurity value of the Culter alba genomic DNA extracted; Compared with Example 4, Example 1 shows that on the basis of using chitosan derivative solution, using 1,3-di( 3-aminopropyl)-1,1,3,3-tetramethyldisiloxane can further reduce the impurity impact of the extracted Culter carp genomic DNA; Example 4 is compared with Example 5, indicating that increasing the usage of 1,3-bis(3-aminopropyl)-1,1,3,3-tetramethyldisiloxane within a certain range can also reduce the background impurity value of the extracted Culter carp genomic DNA; Example 1 is compared with Comparative Example 1, indicating that the usage of the chitosan derivative solution needs to be in an appropriate range, and too low a level has no obvious effect on reducing the background impurities of the Culter carp genomic DNA.

[0076] The embodiments and / or implementation methods described above are only used to illustrate the preferred embodiments and / or implementation methods for realizing the technology of the present invention, and do not impose any form of limitation on the implementation methods of the technology of the present invention. Any person skilled in the art may make slight changes or modifications to other equivalent embodiments without departing from the scope of the technical means disclosed in the content of the present invention, but they should still be regarded as technologies or embodiments that are essentially the same as the present invention.

[0077] This article uses specific examples to illustrate the principles and implementation methods of this application. The description of the above embodiments is only used to help understand the method and core ideas of this application. The above is only the preferred implementation method of this application. It should be pointed out that due to the limitations of textual expression, there are objectively infinite specific structures. For ordinary technicians in this technical field, without departing from the principles of this application, they can also make several improvements, modifications or changes, and can also combine the above technical features in an appropriate manner; these improvements, modifications, changes or combinations, or the direct application of the inventive concept and technical solution to other occasions without improvement, should be regarded as the scope of protection of this application.

Claims

1. A molecular marker for identifying the genetic sex of Culter alba, wherein the nucleic acid sequence of the molecular marker is shown in SEQ ID NO.

1.

2. A method for identifying the genetic sex of Culter alba, comprising: S1: mince the fins of the Culter alba sample, add tissue cell lysis buffer and enzyme water bath, and then add binding solution and magnetic beads for incubation; After incubation, centrifugal magnetic separation was performed, the magnetic beads were washed and dried, and then a buffer solution was added to the water bath. Finally, the liquid was centrifuged and magnetic separation was performed to obtain the genomic DNA of Culter albus. S2: designing primers based on the molecular specific marker according to claim 1, and performing PCR amplification using the Culter alba genomic DNA of S1 as a template to obtain a PCR amplification product, and subjecting the PCR amplification product to agarose gel electrophoresis; S3: Analysis results, the results are (1) or (2): (1) If the PCR amplification product is a single bright specific band, it is a female individual; (2) If the PCR amplification product has two bands, it is a male individual.

3. The method for identifying the genetic sex of Culter alba according to claim 2, wherein: The magnetic beads in S1 are prepared from Fe3O4 and chitosan derivatives, and the chitosan derivatives are prepared from chitosan, 3-chloro-2,2-dimethyl-1-propanol and 2-chloroethoxyethanol.

4. The method for identifying the genetic sex of Culter alba according to claim 2, wherein: The mass ratio of the sample fins to the magnetic beads used in S1 is 1:0.0008-0.

002.

5. The method for identifying the genetic sex of Culter alba according to claim 2, wherein: The usage ratio of the sample fin ray to the tissue cell lysate in S1 is 1 mg: 8-15 μL.

6. The method for identifying the genetic sex of Culter alba according to claim 2, wherein: The enzyme in S1 is proteinase K, and the usage ratio of sample fin ray to proteinase K is 1 mg: 0.15-0.5 μL.

7. The method for identifying the genetic sex of Culter alba according to claim 2, wherein: The combining solution in S1 is a sodium chloride solution and a PEG6000 solution. The sodium chloride solution is composed of sodium chloride and water, and the amount of sodium chloride in the sodium chloride solution is 4-4.5 g / L. The PEG6000 solution is composed of PEG6000 and water, and the amount of PEG6000 in the PEG6000 solution is 0.15-0.3 g / ml. The usage ratio of the sample fin to the sodium chloride solution is 1 mg: 2-5 μL.

8. The method for identifying the genetic sex of Culter alba according to claim 7, wherein: The volume ratio of the sodium chloride solution to the PEG6000 solution is 1:0.8-1.

2.

9. The method for identifying the genetic sex of Culter alba according to claim 2, wherein: The buffer in S1 is EB elution buffer, and the usage ratio of magnetic beads to EB elution buffer is 1 μg:0.8-1.5 μL.

10. The method for identifying the genetic sex of Culter alba according to claim 2, wherein: The PCR amplification system in S2 includes 10× Buffer solution, dNTP, primers, rTaq enzyme, genomic DNA template and water.

Images