SNP (Single Nucleotide Polymorphism) molecular marker related to sheep body weight character and application of SNP molecular marker
By using KASP technology to detect SNP molecular markers in sheep weight traits, the problem of low flux in traditional methods is solved, efficient identification and breeding of sheep weight traits is achieved, and breeding efficiency is improved.
Patent Information
- Application Number
- CN202510612574.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-13
- Publication Date
- 2025-08-08
AI Technical Summary
Traditional genotype detection methods have low flux in the identification of sheep weight traits, making it difficult to achieve efficient and automated measurements, affecting the sheep breeding process.
KASP technology was used to detect the SNP molecular marker at chromosome 2 of the sheep genome, and PCR amplification was performed using KASP primers to distinguish AA, GA and GG genotypes through fluorescence signals to achieve efficient identification and screening of sheep weight traits.
The efficiency of breeding of sheep weight traits can be improved, which can explain the 5.14% variance of weight variance. By selecting the AA genotype for breeding and hybridization, the breeding efficiency is significantly improved.
Smart Images

Figure CN120442809A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of molecular markers, and in particular relates to a SNP molecular marker related to sheep weight traits and an application thereof. Background Art
[0002] In the field of sheep genetics and breeding, body weight is a key indicator of growth and development. This crucial trait is closely related to meat production. Generally speaking, heavier sheep are larger and have more muscle mass, resulting in higher meat yields. Measuring body weight can be used to predict a sheep's meat production performance, providing a crucial reference for the use of body weight in meat production and sheep breeding.
[0003] Traditional genotyping methods, mostly using PCR-RFLP (polymerase chain reaction-restriction fragment length polymorphism) and PCR-SSCP (polymerase chain reaction-single strand conformation polymorphism), have low throughput and complex procedures, making high-throughput automated testing difficult. KASP (Kompetitive Allele-Specific PCR), a competitive allele-specific PCR, enables precise detection of SNPs. It is a high-throughput, low-cost, and low-error SNP typing technology that can be automated and operated on a platform. Leveraging SNPs and KASP technology for early assisted selection of sheep for weight is crucial, as it provides a comprehensive guide to the breeding process for weight traits in sheep. Summary of the Invention
[0004] The purpose of the present invention is to provide a SNP molecular marker related to sheep weight traits and its application, to quickly screen and identify sheep weight traits, and to improve the breeding efficiency of sheep populations with weight advantages.
[0005] The present invention provides a SNP molecular marker related to the sheep weight trait. The SNP molecular marker corresponds to the 159223939bp of chromosome 2 of the sheep genome, and the base is A / G; wherein the base A is a favorable allele variation of the sheep weight trait.
[0006] The present invention also provides a DNA fragment related to the sheep weight trait, the DNA fragment comprises the nucleotide sequence shown in SEQ ID NO: 1, wherein Y is a polymorphic site, the base is A / G, and the base A is a favorable allele variation of the sheep weight trait.
[0007] The present invention also provides KASP primers for amplifying the SNP molecular marker described in the above technical solution or the DNA fragment described in the above technical solution, wherein the KASP primers include a first forward primer, a second forward primer and a reverse primer;
[0008] The first forward primer comprises the nucleotide sequence shown in SEQ ID NO: 2;
[0009] The second forward primer comprises the nucleotide sequence shown in SEQ ID NO: 3;
[0010] The reverse primer includes the nucleotide sequence shown in SEQ ID NO:4.
[0011] Preferably, the 5' ends of the first forward primer and the second forward primer are connected to fluorescent groups respectively, and the fluorescent groups connected to the first forward primer and the first upstream primer emit different fluorescence colors.
[0012] Preferably, the 5' end of the first forward primer is connected to a fluorescent group VIC; the 5' end of the second forward primer is connected to a fluorescent group FAM.
[0013] The present invention also provides a kit for detecting the SNP molecular marker described in the above technical solution, wherein the kit comprises the KASP primers described in the above technical solution.
[0014] The present invention also provides the use of a substance for detecting the SNP molecular marker described in the above technical solution, a substance for detecting the DNA fragment described in the above technical solution, a KASP primer described in the above technical solution, or a kit described in the above technical solution in one or more of the following:
[0015] (1) Identify or assist in identifying the weight traits of sheep;
[0016] (2) distinguish between sheep with an advantage in weight traits and sheep with an disadvantage in weight traits;
[0017] (3) Breeding or assisting in breeding sheep with superior weight traits;
[0018] (4) Screening or assisting in screening sheep with superior weight traits.
[0019] Preferably, the sheep include Bamer sheep; the age of the sheep is ≥12 months.
[0020] The present invention also provides a method for identifying the weight trait of sheep, comprising the following steps:
[0021] Using the genomic DNA of the sheep to be tested as a template, PCR amplification is performed using the KASP primers described in the above technical solution to obtain a PCR amplification product;
[0022] If the PCR amplification product corresponds to the deoxyribonucleotide pair 159223939 of chromosome 2 of the sheep genome is AA, then the sheep to be tested is a sheep with an advantage in weight trait.
[0023] The present invention also provides a genetic breeding method for sheep weight traits, comprising the following steps: determining the genotype of the SNP molecular marker described in the above technical solution or the polymorphic site in the DNA fragment described in the above technical solution in a sheep population; selecting individuals with the genotype AA and eliminating individuals with the genotypes GA and GG, so as to increase the frequency of gene A generation by generation, thereby optimizing the weight traits of offspring sheep.
[0024] Beneficial effects:
[0025] The present invention provides a single-nucleotide polymorphism (SNP) molecular marker associated with sheep weight, corresponding to bp 159223939 of chromosome 2 of the sheep genome, with bases A / G; base A is the favorable allele for the sheep weight trait. The SNP molecular marker described in the present invention is significantly correlated with sheep weight and can explain 5.14% of the weight variance. The SNP molecular marker described in the present invention can be used to identify sheep weight traits, distinguish between sheep with advantageous and disadvantageous weight traits, screen for sheep with advantageous weight traits, select the AA genotype for seed preservation during breeding, use the AA genotype as breeding stock, exclude sheep with the G allele when crossing with other sheep, and use semen from AA genotype rams for artificial insemination. This can greatly improve breeding efficiency, produce a flock with advantageous weight, and ensure stable inheritance. BRIEF DESCRIPTION OF THE DRAWINGS
[0026] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments are briefly introduced below.
[0027] Figure 1 This is a diagram showing the KASP typing results of the SNP molecular marker (chr2_159223939:A>G) of the present invention;
[0028] Figure 2 This is a box plot of the residual values of the SNP molecular marker (chr2_159223939:A>G) of Bamberg sheep with different genotypes after weight correction of fixed effects. DETAILED DESCRIPTION
[0029] The present invention provides a SNP molecular marker related to the sheep weight trait. The SNP molecular marker corresponds to the 159223939bp of chromosome 2 of the sheep genome, and the base is A / G; wherein the base A is a favorable allele variation of the sheep weight trait.
[0030] As an embodiment, the reference genome of the sheep genome described in the present invention is ovis_aries_rambouillet_1.0 (https: / / uswest.ensembl.org / Ovis_aries_rambouillet / Info / Index). The present invention has an A / G mutation at bp 159223939 of chromosome 2 of the sheep genome, which is included in the KCN H7 gene and has a significant correlation with sheep weight.
[0031] The present invention also provides a DNA fragment related to the sheep weight trait, the DNA fragment comprises the nucleotide sequence shown in SEQ ID NO: 1, wherein Y is a polymorphic site, the base is A / G, and the base A is a favorable allele variation of the sheep weight trait.
[0032] The nucleotide sequence shown in SEQ ID NO: 1 of the present invention is specifically: 5'-AATACGGGGGAAGGAGGAAGTAAAAGAAAAATTGGTAATTTAAC ACCTGTTTTTGCAGAAGCCATCTTGTTTTACTTCTTATGGTCGTGTTGAGCTYATGTATAGATATTCTGTCTTTTTCTATTCATTGCACTTCTGGGTCCCTAACG AAACTTGTCAGACCTCCAAAAAGAACAAATCCAGGAGGCAAATCATG-3'; wherein, Y is a polymorphic site and the base is A / G.
[0033] The present invention also provides KASP primers for amplifying the SNP molecular marker described in the above technical solution or the DNA fragment described in the above technical solution, wherein the KASP primers include a first forward primer, a second forward primer and a reverse primer; the first forward primer includes the nucleotide sequence shown in SEQ ID NO: 2; the second forward primer includes the nucleotide sequence shown in SEQ ID NO: 3; and the reverse primer includes the nucleotide sequence shown in SEQ ID NO: 4.
[0034] The nucleotide sequences shown in SEQ ID NOs: 2 to 4 of the present invention are as follows:
[0035] SEQ ID NO: 2: 5'-TTCTTATGGTCGTGTTGAGCTG-3';
[0036] SEQ ID NO: 3: 5'-TTCTTATGGTCGTGTTGAGCTA-3';
[0037] SEQ ID NO: 4: 5'-TGCAATGAATAGAAAAAGACAGAATA-3'.
[0038] As an embodiment, the 5' end of the first forward primer and the second forward primer of the present invention are respectively connected to fluorescent groups, and the fluorescent groups connected to the first forward primer and the first upstream primer emit different fluorescence colors. As an embodiment, the 5' end of the first forward primer of the present invention is connected to the fluorescent group VIC. As an embodiment, the 5' end of the second forward primer of the present invention is connected to the fluorescent group FAM. As an embodiment, the nucleotide sequence of the first forward primer of the present invention is shown in SEQ ID NO:5. As an embodiment, the nucleotide sequence of the second forward primer of the present invention is shown in SEQ ID NO:6. The present invention uses the fluorescent group VIC and the fluorescent group FAM to distinguish between two isogenic sites C and T, and has the best accuracy when used for fluorescent signal intensity and stability assessment.
[0039] The present invention also provides a kit for detecting the SNP molecular marker described in the above technical solution, wherein the kit comprises the KASP primers described in the above technical solution.
[0040] As an embodiment, the kit of the present invention further comprises 2×Taq DNA Polymerase Mix.
[0041] The present invention also provides the use of a substance for detecting the SNP molecular marker described in the above technical solution, a substance for detecting the DNA fragment described in the above technical solution, a KASP primer described in the above technical solution, or a kit described in the above technical solution in one or more of the following: (1) identifying or assisting in identifying the weight trait of sheep; (2) distinguishing between sheep with superior weight traits and sheep with inferior weight traits; (3) breeding or assisting in breeding sheep with superior weight traits; and (4) screening or assisting in screening sheep with superior weight traits.
[0042] In the present invention, if the genotype corresponding to the 159223939bp position of chromosome 2 of the sheep genome in the genome of the sheep to be tested is AA, then the sheep to be tested is a sheep with an advantageous weight trait; or, if the genotype corresponding to the polymorphic site described in the DNA fragment described in the above technical solution in the genome of the sheep to be tested is AA, then the sheep to be tested is a sheep with an advantageous weight trait.
[0043] In one embodiment, the sheep with an advantageous weight trait of the present invention include high-weight sheep, and the sheep with an inferior weight trait include low-weight sheep. In one embodiment, the sheep of the present invention include Bamer sheep. In one embodiment, the sheep of the present invention are ≥12 months old; in another embodiment, the sheep of the present invention are 24 months old.
[0044] The present invention also provides a method for identifying the weight trait of sheep, comprising the following steps:
[0045] Using the genomic DNA of the sheep to be tested as a template, PCR amplification is performed using the KASP primers described in the above technical solution to obtain a PCR amplification product;
[0046] If the PCR amplification product corresponds to the deoxyribonucleotide pair 159223939 of chromosome 2 of the sheep genome is AA, then the sheep to be tested is a sheep with an advantage in weight trait.
[0047] In one embodiment, the PCR amplification system described herein comprises: 2 μL of 2×Taq DNA Polymerase Mix, 1 μL of KASP primers, and 2 μL of genomic DNA from the sheep to be tested. In one embodiment, the KASP primers described herein comprise 100 μL / mL of a first forward primer, 100 μL / mL of a second forward primer, 100 μL / mL of a reverse primer, and water. In one embodiment, the volume ratio of 100 μL / mL of the first forward primer, 100 μL / mL of the second forward primer, 100 μL / mL of the reverse primer, and water in the KASP primers described herein is 24:24:48:100. In one embodiment, the concentration of the genomic DNA from the sheep to be tested described herein is 20 ng / μL. As an embodiment, the amplification program of the PCR amplification described in the present invention includes: pre-denaturation at 94°C for 10 minutes; denaturation at 94°C for 20 seconds, annealing / extension at 61-55°C (reduction of 0.6°C / cycle) for 45 seconds, 10 cycles; denaturation at 94°C for 20 seconds, annealing / extension at 55°C for 45 seconds, 37 cycles.
[0048] The present invention also provides a genetic breeding method for sheep weight traits, comprising the following steps: determining the genotype of the SNP molecular marker described in the above technical solution or the polymorphic site in the DNA fragment described in the above technical solution in a sheep population; selecting individuals with the genotype AA and eliminating individuals with the genotypes GA and GG, so as to increase the frequency of gene A generation by generation, thereby optimizing the weight traits of offspring sheep.
[0049] In one embodiment, the present invention uses genomic DNA from a sheep to be tested as a template and performs PCR amplification using the KASP primers described in the above technical solution to obtain a PCR amplification product. The PCR amplification product is then used to determine the base type of Y in the SNP molecular marker described in the above technical solution or the DNA fragment described in the above technical solution in the sheep population. The reaction system and procedure for PCR amplification described in the present invention have been described above and are not further described here.
[0050] In the SNP molecular marker described herein, T represents a favorable allele for the weight trait in sheep. The SNP molecular marker described herein can be used to identify weight traits in sheep, distinguishing between those with advantageous and disadvantageous weight traits. By selecting the AA genotype for seed preservation during breeding, using AA genotypes as breeding stock, and excluding sheep with the G allele from crossbreeding with other sheep, artificial insemination using semen from AA genotype rams can significantly improve breeding efficiency and produce flocks with advantageous weight.
[0051] To further illustrate the present invention, a SNP molecular marker associated with sheep weight traits and its application provided by the present invention are described in detail below with reference to the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.
[0052] Example 1
[0053] 1. Experimental materials: 185 24-month-old Bamian sheep.
[0054] 2. Reagents and instruments: Reagents: 2× Taq DNA Polymerase Mix; PCR amplification: ABI 9700196Dual; fluorescence value reading: FLUOstar OEMGA; fluorescence value analysis: Kluster Callergenotypingsoftware; all reagents and instruments were purchased from Beijing Yinuo Zhongda Biotechnology Co., Ltd.
[0055] 3. Extraction of genomic DNA: Take jugular vein blood from Bamberg sheep and use a DNA extraction kit to extract genomic DNA from Bamberg sheep; dilute the DNA to 20 ng / μL.
[0056] 4. PCR amplification
[0057] (1) PCR primer dilution: Beijing Yinuo Zhongda Biotechnology Co., Ltd. was commissioned to synthesize PCR primers (forward primer-VIC (F1), forward primer-FAM (F2), and reverse primer (R)); the dry powder of the PCR primers was diluted to 100 μL / mL, and then the diluted PCR primers were mixed with water in a volume ratio of F1:F2:R:water = 24:24:48:100 to obtain a PCR primer master solution. The nucleotide sequences of the PCR primers are as follows:
[0058] Forward primer-VIC (F1): 5'-GAAGGTCGGAGTCAACGGATTTTCTTATGGT CGTGTTGAGCTG-3' (SEQ ID NO: 5); wherein the bold portion is the universal fluorescent group VIC;
[0059] Forward primer-FAM (F2): 5'-GAAGGTGACCAAGTTCATGCTTTCTTATGG TCGTGTTGAGCTA-3' (SEQ ID NO: 6); wherein the bold part is the universal fluorescent group FAM;
[0060] Reverse primer (R): 5′-TGCAATGAATAGAAAAAGACAGAATA-3′ (SEQ ID NO: 4);
[0061] (2) Using the genomic DNA of Bamei sheep as a template, PCR amplification was performed using the diluted PCR amplification primers; wherein, the PCR amplification system was: 2 μL 2× Taq DNA Polymerase Mix, 1 μL 4× PCR amplification primer master solution and 2 μL Bamei sheep genomic DNA;
[0062] The PCR amplification program was as follows: pre-denaturation at 94°C for 10 min; denaturation at 94°C for 20 s, annealing / extension at 61-55°C (decrease 0.6°C / cycle) for 45 s, 10 cycles; denaturation at 94°C for 20 s, annealing / extension at 55°C for 45 s, 37 cycles.
[0063] 5. Fluorescence value reading
[0064] After PCR amplification, fluorescence was read using a FLUOstar OEM instrument from LGC Genomics Ltd. at temperatures below 40°C. SNP detection used the fluorophores VIC (excitation 535 nm, emission 556 nm) and FAM (excitation 485 nm, emission 520 nm) to distinguish between the two isogenic loci, G and A. The passive reference dye ROX was used to correct for signal variations between wells due to reaction volume errors.
[0065] 6. Determination of chr2_159223939:A>G genotype
[0066] The fluorescence values were analyzed using the KlusterCaller genotyping software that comes with the FLUOstar OEM device from LGC Genomics Ltd. In this software, VIC and FAM data are plotted on the x-axis and y-axis, respectively. The fluorescence values of VIC and FAM in each reaction well are corrected and normalized by the fluorescence value of ROX to obtain the relative fluorescence values corresponding to VIC and FAM in each PCR reaction well. Based on the relative fluorescence values, the samples were clustered and the genotypes were determined based on the sample clusters and fluorescence types. The specific results are shown in Figure 2. Figure 1As shown in Table 1, red represents GG type, green represents GA type, and blue represents AA type. The genotype frequencies are shown in Table 1. The gene frequency of GG type is 0.28, the gene frequency of GA type is 0.44, and the gene frequency of AA type is 0.28.
[0067] Table 1 Statistical results of the genotype frequency of chr2_159223939:A>G in the tested Bamei sheep
[0068]
[0069] 7. Calculate the relationship between chr2_159223939:A>G genotype and sheep weight
[0070] First, the general linear model (GLM) was used to correct the effects of age and sheep farm in the weight data, and the residuals were derived as phenotypic values ( Figure 2 The results were compared with those in Tables 2-3 (see Tables 2-3). Principal component analysis (PCA) was then performed, with the first three principal components obtained from the PCA used as covariates. The BLINK function in the BLINK software package (https: / / github.com / YaoZhou89 / BLINK) was then used to calculate the effect of the single-point SNP on the weight phenotype using a mixed linear model (MLM) based on the chr2_159223939:A>G genotype. The MLM was as follows: y = Q + K + S + e; where y represents the phenotypic data; Q represents the first three principal components obtained from the PCA residuals derived from the general linear model (GLM) after adjusting for age and farm effects in the weight data; K represents the kinship matrix between individuals; S represents the coefficient matrix for the chr2_159223939:A>G genotype (0 represents homozygous AA, 1 represents heterozygous GA, and 2 represents homozygous GG); and e represents the random residual effect. The results are shown in Table 4.
[0071] Table 2 Statistical results of body weight and chr2_159223939:A>G genotype of tested Bamei sheep
[0072]
[0073]
[0074] Table 3 Statistical analysis results of body weight and chr2_159223939:A>G genotype of tested Bamei mutton sheep
[0075]
[0076] Note: Different lowercase letters in the table indicate significant differences.
[0077] Table 4 Association analysis between body weight and chr2_159223939:A>G genotype of Bamei sheep
[0078] SNP total P.value Effects of mutations Phenotypic variance explained by SNPs (%) chr2_159223939:A>G 185 5.75E-19 -4.57905 5.14%
[0079] according to Figure 2 As can be seen from Tables 2 to 4, the molecular marker chr2_159223939:A>G is significantly correlated with the weight of Bamei meat sheep. Sheep carrying the GA genotype weigh less than sheep carrying the AA genotype (P.value=5.75E-19). The G allele reduces the weight of sheep, with an effect value of -4.57905. This SNP site can explain 5.14% of the phenotypic variance. Although body weight is controlled by multiple genes, this SNP site still has a large effect. From this, it can be seen that the AA genotype is selected for seed preservation during breeding, and the AA genotype is used as breeding sheep during breeding. When crossing with other sheep, the G allele needs to be excluded. In particular, artificial insemination with semen from AA genotype rams can greatly improve breeding efficiency, obtain a flock with an advantage in weight, and ensure stable inheritance.
[0080] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.
Claims
1. A SNP molecular marker associated with sheep body weight traits, characterized in that: The SNP molecular marker corresponds to 159223939bp of chromosome 2 of the sheep genome, and the base is A / G; wherein base A is a favorable allele variation of the sheep weight trait.
2. A DNA fragment associated with a sheep weight trait, characterized in that: The DNA fragment includes the nucleotide sequence shown in SEQ ID NO: 1, wherein Y is a polymorphic site, the base is A / G, and the base A is a favorable allele variation of the sheep weight trait.
3. KASP primers for amplifying the SNP molecular marker according to claim 1 or the DNA fragment according to claim 2, characterized in that: The KASP primers include a first forward primer, a second forward primer and a reverse primer; The first forward primer comprises the nucleotide sequence shown in SEQ ID NO: 2; The second forward primer comprises the nucleotide sequence shown in SEQ ID NO: 3; The reverse primer includes the nucleotide sequence shown in SEQ ID NO:
4.
4. The KASP primer according to claim 3, characterized in that The 5' ends of the first forward primer and the second forward primer are respectively connected to fluorescent groups, and the fluorescent groups connected to the first forward primer and the first upstream primer emit different fluorescence colors.
5. The KASP primer according to claim 4, characterized in that The 5' end of the first forward primer is connected to the fluorescent group VIC; the 5' end of the second forward primer is connected to the fluorescent group FAM.
6. A kit for detecting the SNP molecular marker according to claim 1, characterized in that: The kit comprises the KASP primer according to any one of claims 3 to 5.
7. Use of the substance for detecting the SNP molecular marker of claim 1, the substance for detecting the DNA fragment of claim 2, the KASP primer of any one of claims 3 to 5, or the kit of claim 6 in one or more of the following: (1) Identify or assist in identifying the weight traits of sheep; (2) distinguish between sheep with an advantage in weight traits and sheep with an disadvantage in weight traits; (3) Breeding or assisting in breeding sheep with superior weight traits; (4) Screening or assisting in screening sheep with superior weight traits.
8. The use according to claim 7, characterized in that The sheep include Bamer sheep; the age of the sheep is ≥12 months.
9. A method for identifying the weight trait of sheep, characterized in that: The steps include: Using the genomic DNA of the sheep to be tested as a template, PCR amplification is performed using the KASP primers described in any one of claims 3 to 5 to obtain a PCR amplification product; If the PCR amplification product corresponds to the deoxyribonucleotide pair 159223939 of chromosome 2 of the sheep genome is AA, then the sheep to be tested is a sheep with an advantage in weight trait.
10. A genetic breeding method for sheep weight traits, characterized in that: The method comprises the following steps: determining the genotype of the SNP molecular marker according to claim 1 or the polymorphic site in the DNA fragment according to claim 2 in a sheep population; selecting individuals with the genotype AA and eliminating individuals with the genotypes GA and GG, so as to increase the frequency of gene A generation by generation, thereby optimizing the weight traits of offspring sheep.